Skip Navigation

This Article
Right arrow Print PDF (1766K)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (36)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Sor, F.
Right arrow Articles by Fukuhara, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sor, F.
Right arrow Articles by Fukuhara, H.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 1982, Vol. 10, No. 5 1625-1633
© 1982

MOLECULAR BIOLOGY

Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast

Frédéric Sor and Hiroshi Fukuhara*

Institut Curie, Section de Biologie, Bâtiment 110, Centre Universitaire 91405 Orsay, France

*To whom correspondence should be addressed

Received November 24, 1981. Revised February 1, 1982. Accepted February 1, 1982.

The small ribosomal RNA, or 15S RNA, of yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3').We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA. Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae. The 5' and 3' terminal structures of all these sequences are highly constant.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Mol Biol EvolHome page
B. Paquin, M.-J. Laforest, and B. F. Lang
Double-Hairpin Elements in the Mitochondrial DNA of Allomyces: Evidence for Mobility
Mol. Biol. Evol., November 1, 2000; 17(11): 1760 - 1768.
[Abstract] [Full Text] [PDF]

Home page
 ScienceHome page
R. Butow, P. Perlman, and L. Grossman
The unusual varl gene of yeast mitochondrial DNA
Science, June 28, 1985; 228(4707): 1496 - 1501.
[Abstract] [PDF]


Disclaimer: Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.