Skip Navigation

This Article
Right arrow Print PDF (152K)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Ulbrich, N.
Right arrow Articles by Erdmann, V. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ulbrich, N.
Right arrow Articles by Erdmann, V. A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 1984, Vol. 12, No. 3 1577-1580
© 1984

MOLECULAR BIOLOGY

The nucteotide sequence of the cytoplasmtc 5S rRNA from the horsetail, Equisetum arvense

N. Ulbrich, M. Digweed and V. A. Erdmann

Institut für Biochemie, Freie Universität Berlin Thielaliee 69–73, D-l000 Berlin 33, FRG

Received November 9, 1983. Accepted December 23, 1983.

Using 3'- and 5'-end labelling sequencing techniques, the following Sesequence for the cytoplasmic 5S rRNA of the horsetail Equisetum arvense could be determined: pGUGGUGCGGUCAUACCAGCGCUAAUGCACCGGAUCCCAUCAGAACUCCGCAGUIJA AGCGCGCUUGGGCCAGAACAGUACUGGGAUGGGUGACCUCCCGGGAAGUCCUGGUGCCGCACCCCOH. This sequence exhthits all features expected for higher plant cytoplasmic 5S rRNAs, and can be fitted to the secondary structure model for 5S rRNA proposed by De Wachter et al. (15).


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?




Disclaimer: Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.