Skip Navigation

Corrigendum for Smit et al., Nucl. Acids Res. 16 (16) 7773-7782.
This Article
Right arrow Print PDF (31K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Smit, V. T. H. B. M.
Right arrow Articles by Bos, J. L.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Smit, V. T. H. B. M.
Right arrow Articles by Bos, J. L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 1988, Vol. 16, No. 22 10952
© 1988


Corrigendum

KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas

V. T. H. B. M. Smit, A. J. M. Boot, A. A. M. Smits, G. J. Fleuren, C. J. Cornelisse and J. L. Bos

The 5' outside primer of KRAS 12 in Table I was listed incorrectly. The sequence should read:

–20TATTATAAGGCCTGCTGAAA–1


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?




Disclaimer:
Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.