Corrigendum
for Smit et al., Nucl. Acids Res. 16 (16) 7773-7782.
Nucleic Acids Research, 1988, Vol. 16, No. 22 10952
© 1988
KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas
V. T. H. B. M. Smit,
A. J. M. Boot,
A. A. M. Smits,
G. J. Fleuren,
C. J. Cornelisse and
J. L. Bos
The 5' outside primer of KRAS 12 in Table I was listed incorrectly. The sequence should read:
20TATTATAAGGCCTGCTGAAA1

CiteULike
Connotea
Del.icio.us What's this?
Disclaimer: Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our
Customer Services Department.