Skip Navigation

This Article
Right arrow Print PDF (873K)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Morvan, F.
Right arrow Articles by Imbach, J.-L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morvan, F.
Right arrow Articles by Imbach, J.-L.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 1988, Vol. 16, No. 3 833-847
© 1988

Articles

{alpha}-DNA VII. Solid phase synthesis of {alpha}-anomeric oligodeoxyribonucleotides

François Morvan, Bernard Rayner, Jean-Paul Leonetti1 and Jean-Louis Imbach

Leboratoire de Chimie Bio-Organique, UA 488 CNRS, Université des Sciences et Techniques du Languedoc Place E.-Baiaillon, 34060 Montpellier Cédex, France 1Laboratoire de Biochimie des Protéines, UA 1191 CNRS, Université des Sciences et Techniques du Languedoc Place E.-Baiaillon, 34060 Montpellier Cédex, France

Received December 8, 1987. Accepted January 11, 1988.

An efficient procedure for the synthesis of unnatural {alpha}-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of {alpha}-nucleoside phosphoramidites and {alpha}-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 {alpha}-deoxynucleotide units in length. After HPLC purification, a 15-mer: {alpha}-d(CCTCTCGTTCTTTAC) and a 20-mer {alpha}-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
D. G. Semizarov, A. A. Arzumanov, N. B. Dyatkina, A. Meyer, S. Vichier-Guerre, G. Gosselin, B. Rayner, J.-L. Imbach, and A. A. Krayevsky
Stereoisomers of Deoxynucleoside 5'-Triphosphates as Substrates for Template-dependent and -independent DNA Polymerases
J. Biol. Chem., April 4, 1997; 272(14): 9556 - 9560.
[Abstract] [Full Text] [PDF]


Disclaimer:
Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.