Skip Navigation

This Article
Right arrow Print PDF (5276K)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Lisziewicz, J.
Right arrow Articles by Dhar, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lisziewicz, J.
Right arrow Articles by Dhar, R.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 1990, Vol. 18, No. 14 4167-4174
© 1990

MOLECULAR BIOLOGY

Transcriptional regulatory elements of the RAS2 gene of Saccharomyces cerevisiae

J. Lisziewicz, J. Brown, D. Breviario1, T. Sreenath+, N. Ahmed, R. Koller§ and R. Dhar*

Laboratory of Molecular Virology, National Cancer Institute, National Institutes of Health Bethesda, MD 20892, USA 1Istituto Biosintesi Vegetali CNR 20133 Milan, Italy

*To whom correspondence should be addressed

Received March 30, 1990. Revised June 14, 1990. Accepted June 14, 1990.

We have analyzed a series of 5' deletions of the RAS2 gene to investigate its complex transcriptional regulation in the yeast Saccharomyces cerevisiae. Two positive transcriptional regulatory elements were identified. Element A regulates two of the three clusters of RAS2 transcripts. This element is capable of activating a heterologous promoter and contains two copies of the sequence CCTCGCCCC. Although one copy is sufficient for partial transcriptional activation, both copies are required for maximal RAS2 induction. Deletion of one copy resulted in a reduced level of RAS2 mRNA, selective loss of cluster II transcripts and reduced ability to activate the heterologous CYC1 promoter. Each of the 9 bp C rich repeats of element A is part of a sequence with extensive homology to a transcriptional regulatory element upstream of the human epidermal growth factor receptor (EGFR) gene. Element B contains a tandem duplication of a 21 nucleotide sequence TACATATATATATATCTTAG and activates cluster I RAS2 transcripts in the absence of Element A. The physiological role of these deletions was determined by assaying their ability to support growth on a nonfermentable carbon source. RAS2 promoter deletions containing either element A or B were able to overcome this growth defect characteristic of ras2 mutants cells. Deletion of both elements resulted in an insufficient amount of RAS2 protein for growth on a non-fermentable carbon source.

+Present addresses: American Red Cross, Jerome Holland Laboratory, 15601 Crabbs Branch Way, Rockville, MD 20855

§Laboratory of Genetics, National Cancer Institute, Bethesda, MD 20892, USA


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?




Disclaimer:
Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.