Skip Navigation

This Article
Right arrow Print PDF (3830K)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Haidar, M. A.
Right arrow Articles by Busch, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Haidar, M. A.
Right arrow Articles by Busch, H.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 1991, Vol. 19, No. 23 6559-6563
© 1991

MOLECULAR BIOLOGY

Sp1 is essential and its position is important for p120 gene transcription: a 35 bp juxtaposed positive regulatory element enhances transcription 2.5 fold

Mohammad A. Haidar, Dale Henning and Harris Busch

Department of Pharmacology, Baylor College of Medicine Houston, TX–77030, USA

Received July 29, 1991. Revised October 18, 1991. Accepted October 18, 1991.

Human proliferating cell nucleolar antigen p120 is expressed in tumor cells in the early G1 phase of the cell cycle. Deletion analyses of the essential cis–acting region – 537/– 278 showed that a 58 bp sequence from –457 to –400 is an important cis–acting element. An Sp1 transcription factor binds to the sequence AGAGGCGGGG(– 425to –416) within the – 458/– 400 cisacting region. Deletion of the Sp1 binding sequence eliminated transcription. Substitution of the Sp1 box( – 437/– 406), containing the Sp1 recognition site, for the entire cis–acting region ( – 537/ – 278) restored transcription only at a very low level (18%). Deletion of the –537/–278 cis–acting region followed by substitutions showed that the Sp1 box (–437/–406) stimulated transcription 2.4 fold, when juxtaposed and downstream of a 35 bp ( – 472 GGGCGAGCGTAAGTTCCGGGTGCGGCGGCCGACTA –438) positive regulatory cis–element (PRE) over that by substitution of the Sp1 box alone. When the – 406/ – 278 sequence was downstream of the PRE–Sp1 box, transcription was stimulated 4.4 fold over that produced by substitution of the Sp1 box alone. These results suggest that Sp1 is essential and its proper position in the 5' flanking sequence, juxtaposed and down stream of a 35 bp positive regulatory sequence, is required for efficient transcription.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 J. Leukoc. Biol.Home page
A. Khanna-Gupta, H. Sun, T. Zibello, L. Lozovatsky, P. K. Ghosh, D. C. Link, M. L. McLemore, and N. Berliner
p120 nucleolar-proliferating antigen is a direct target of G-CSF signaling during myeloid differentiation
J. Leukoc. Biol., May 1, 2006; 79(5): 1011 - 1021.
[Abstract] [Full Text] [PDF]


Disclaimer:
Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.