Skip Navigation

Corrigendum for Holloway et al., Nucl. Acids Res. 21 (16) 3905-3606.
This Article
Right arrow Print PDF (18K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Holloway, B.
Right arrow Articles by Murtagh, J.J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Holloway, B.
Right arrow Articles by Murtagh, J.J., Jr
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 1993, Vol. 21, No. 21 4990
© 1993

CORRIGENDUM

An exonuclease-amplification coupled capture technique improves detecton of PCR product

B. Holloway, D.D. Erdman, E.L. Durigon and J.J. Murtagh, Jr

Please note that the sequence of the digoxigenin probe used in the method described in this paper should read as follows: digoxigenin- (5 GCTAAAAGTGTTCCAGTATATGGCA 3)


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Clin. Chem.Home page
K. Boissinot, A. Huletsky, R. Peytavi, S. Turcotte, V. Veillette, M. Boissinot, F. J. Picard, E. A. Martel, and M. G. Bergeron
Rapid exonuclease digestion of pcr-amplified targets for improved microarray hybridization.
Clin. Chem., November 1, 2007; 53(11): 2020 - 2023.
[Full Text] [PDF]


Disclaimer: Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.