Skip Navigation

This Article
Right arrow Full Text Freely available
Right arrow Print PDF (82K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (19)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Marsich, E
Right arrow Articles by Manzini, G
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marsich, E
Right arrow Articles by Manzini, G
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, Vol 24, Issue 20 4029-4033, Copyright © 1996 by Oxford University Press

ARTICLES

Evidence for a HeLa nuclear protein that binds specifically to the single-stranded d(CCCTAA)n telomeric motif

E Marsich, A Piccini, LE Xodo and G Manzini
Department of Biochemistry, Biophysics and Macromolecular Chemistry, University of Trieste, Italy.

In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Nucleic Acids ResHome page
K. Kanaori, N. Shibayama, K. Gohda, K. Tajima, and K. Makino
Multiple four-stranded conformations of human telomere sequence d(CCCTAA) in solution
Nucleic Acids Res., February 1, 2001; 29(3): 831 - 840.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
A. Eversole and N. Maizels
In Vitro Properties of the Conserved Mammalian Protein hnRNP D Suggest a Role in Telomere Maintenance
Mol. Cell. Biol., August 1, 2000; 20(15): 5425 - 5432.
[Abstract] [Full Text]

Home page
 Nucleic Acids ResHome page
L. Lacroix, H. Lienard, E. Labourier, M. Djavaheri-Mergny, J. Lacoste, H. Leffers, J. Tazi, C. Helene, and J.-L. Mergny
Identification of two human nuclear proteins that recognise the cytosine-rich strand of human telomeres in vitro
Nucleic Acids Res., April 1, 2000; 28(7): 1564 - 1575.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Reprod.Home page
A. Kozik, E. M. Bradbury, and A. O. Zalensky
Identification and Characterization of a Bovine Sperm Protein That Binds Specifically to Single-Stranded Telomeric Deoxyribonucleic Acid
Biol Reprod, February 1, 2000; 62(2): 340 - 346.
[Abstract] [Full Text]


Disclaimer: Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.