Skip Navigation

This Article
Right arrow Full Text Freely available
Right arrow Print PDF (178K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (8)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Jiang, L.
Right arrow Articles by Russu, I. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jiang, L.
Right arrow Articles by Russu, I. M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 2001, Vol. 29, No. 20 4231-4237
© 2001 Oxford University Press

Proton exchange and local stability in a DNA triple helix containing a G.TA triad

Lihong Jiang and Irina M. Russu1,*

Department of Molecular Biology and Biochemistry and 1Department of Chemistry, Molecular Biophysics Program, 203 Hall-Atwater Laboratories, Wesleyan University, Middletown, CT 06459, USA

Recognition of a thymine-adenine base pair in DNA by triplex-forming oligonucleotides can be achieved by a guanine through the formation of a G.TA triad within the parallel triple helix motif. In the present work, we provide the first characterization of the stability of individual base pairs and base triads in a DNA triple helix containing a G.TA triad. The DNA investigated is the intramolecular triple helix formed by the 32mer d(AGATAGAACCCCTTCTATCTTATATCTGTCTT). The exchange rates of imino protons in this triple helix have been measured by nuclear magnetic resonance spectroscopy using magnetization transfer from water and real-time exchange. The exchange rates are compared with those in a homologous DNA triple helix in which the G.TA triad is replaced by a canonical C+.GC triad. The results indicate that, in the G.TA triad, the stability of the Watson–Crick TA base pair is comparable with that of AT base pairs in canonical T.AT triads. However, the presence of the G.TA triad destabilizes neighboring triads by 0.6–1.8 kcal/mol at 1°C. These effects extend to triads that are two positions removed from the site of the G.TA triad. Therefore, the lower stability of DNA triple helices containing G.TA triads originates, in large part, from the energetic effects of the G.TA triad upon the stability of canonical triads located in its vicinity.

* To whom correspondence should be addressed. Tel: +1 860 685 2428; Fax: +1 860 685 2211; Email: irussu{at}wesleyan.edu


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Nucleic Acids ResHome page
D. Coman and I. M. Russu
Site-resolved stabilization of a DNA triple helix by magnesium ions
Nucleic Acids Res., February 9, 2004; 32(3): 878 - 883.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
T. G. Uil, H. J. Haisma, and M. G. Rots
Therapeutic modulation of endogenous gene function by agents with designed DNA-sequence specificities
Nucleic Acids Res., November 1, 2003; 31(21): 6064 - 6078.
[Abstract] [Full Text] [PDF]


Disclaimer: Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.