Skip Navigation

This Article
Right arrow Full Text Freely available
Right arrow Print PDF (227K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Coman, D.
Right arrow Articles by Russu, I. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Coman, D.
Right arrow Articles by Russu, I. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Published online 9 February 2004

Nucleic Acids Research, 2004, Vol. 32, No. 3 878-883
© 2004 Oxford University Press

Site-resolved stabilization of a DNA triple helix by magnesium ions

Daniel Coman and Irina M. Russu*

Department of Chemistry and Molecular Biophysics Program, Wesleyan University, Middletown, CT 06459, USA

*To whom correspondence should be addressed. Tel: +1 860 685 2428; Fax: +1 860 685 2211; Email: irussu{at}wesleyan.edu

Proton exchange and NMR spectroscopy have been used to define the effects of Mg2+ ions upon the stability of individual base pairs in the intramolecular parallel triple helix formed by the DNA oligonucleotide d(GAAGAGGTTTTTCCTCTTCTTTTTCTTCTCC). The rates of exchange of individual Watson–Crick and Hoogsteen imino protons in the DNA triple helix were measured in the absence and in the presence of Mg2+ ions. The results reveal that Mg2+ lowers the exchange rates of most imino protons in the structure by stabilizing the corresponding base pairs in their native closed conformation. Comparison of the DNA triple helix containing Na+ counterions to the same helix containing Mg2+ counterions shows that these stabilizing effects result, in large part, from Mg2+ ions closely associated with the DNA. Moreover, the effects are site-specific and depend on the number and location of protonated cytosines relative to the observed base. These findings provide new insights into the molecular roles of C+·GC triads in determining the stability of DNA triple-helical structures.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
RNAHome page
P. V. Cornish, S. N. Stammler, and D. P. Giedroc
The global structures of a wild-type and poorly functional plant luteoviral mRNA pseudoknot are essentially identical
RNA, November 1, 2006; 12(11): 1959 - 1969.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Coman and I. M. Russu
Base Pair Opening in Three DNA-unwinding Elements
J. Biol. Chem., May 27, 2005; 280(21): 20216 - 20221.
[Abstract] [Full Text] [PDF]



Disclaimer: Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.