Skip Navigation


Nucleic Acids Research Advance Access originally published online on October 5, 2007
Nucleic Acids Research 2007 35(20):6788-6797; doi:10.1093/nar/gkm782
This Article
Right arrow Full Text Freely available
Right arrow Print PDF (907K) Freely available
Right arrow Screen PDF (411K) Freely available
Right arrow Supplementary Data
Right arrowOA All Versions of this Article:
35/20/6788    most recent
gkm782v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (4)
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Abella, M.
Right arrow Articles by Barbé, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abella, M.
Right arrow Articles by Barbé, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 2007, Vol. 35, No. 20 6788-6797
© 2007 The Author(s)
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.


Molecular Biology

The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

Marc Abella1, Sonia Rodríguez1, Sonia Paytubi2, Susana Campoy3, Malcolm F. White2 and Jordi Barbé1,3,*

1Departament de Genètica i Microbiologia, Universitat Autònoma de Barcelona 08193 Bellaterra, Spain, 2Centre for Biomolecular Sciences, University of St Andrews, North Haugh, St Andrews, Fife KY16 9ST, UK and 3Centre de Recerca en Sanitat Animal (CReSA), 08193 Bellaterra, Spain

*To whom correspondence should be addressed. Tel: +34 93 581 1837; Fax: +34 93 581 2387; Email: jordi.barbe{at}uab.es

Received August 10, 2007. Revised September 14, 2007. Accepted September 17, 2007.

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
MicrobiologyHome page
J. Aranda, M. E. Garrido, N. Fittipaldi, P. Cortes, M. Llagostera, M. Gottschalk, and J. Barbe
Protective capacities of cell surface-associated proteins of Streptococcus suis mutants deficient in divalent cation-uptake regulators
Microbiology, May 1, 2009; 155(5): 1580 - 1587.
[Abstract] [Full Text] [PDF]



Disclaimer: Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.