Skip Navigation

This Article
Right arrow Print PDF (895K)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Agrawal, H. P.
Right arrow Articles by Randerath, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Agrawal, H. P.
Right arrow Articles by Randerath, E.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 1981, Vol. 9, No. 11 2535-2541
© 1981

MOLECULAR BIOLOGY

Tumor mitochondrial transfer ribonucleic acids: the nucleotide sequence of Morris hepatoma 5123D mitochondrial tRNA Asp

Hari P. Agrawal, Kurt Randerath and Erika Randerath

Department of Pharmacology, Baylor College of Medicine, Texas Medical Center Houston, TX 77030, USA

Received March 23, 1981. A mitochondrial as partate tRNA (anticodon GUC) was isolated from a transplantable rat tumor, Morris hepatoma 5123D, and sequenced. The sequence, pGAGAUAinjm1AGUAAAAUAAUUACAVAACCUUGUCAAGGUUAAGUUAUAGACUUAAAUCUAUAUAUCUUACCA0H, can be arranged in a clover leaf structure. The RNA exhibits a number of unusual features, such as lack of the constant -G-G- and -T-{varphi}-C- sequences in loops I and IV, respectively, small size of these loops, lack of the constant G-C base pair adjacent to loop IV, predominance of A-U base pairs in general, and presence of m1-A in position 9. The RNA exhibits 82 and 70% homology withthe DNA-derived putative sequences of human placenta and beef heart mito-chondrial tRNAAsp, respectively, and bears little resemblance to other sequenced aspartate tRNAs of non-mitochondrial origin.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?




Disclaimer:
Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.