Skip Navigation

This Article
Right arrow Print PDF (161K)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Diels, L.
Right arrow Articles by Wachter, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Diels, L.
Right arrow Articles by Wachter, R. D.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 1981, Vol. 9, No. 19 5141-5144
© 1981

MOLECULAR BIOLOGY

The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

Ludo Diels, Raymond De Baere, Antoon Vandenberghe and Rupert De Wachter

Departement Celbiologie, Universiteit Antwerpen, Universiteitsplein 1 B-2610 Wilrijk, Belgium

Received July 30, 1981. The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGU ACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUG ACCGCCUGGGAACACCGGGUGCUGUUGGCAUOH.


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?




Disclaimer:
Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.