Skip Navigation

This Article
Right arrow Print PDF (237K)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Luehrsen, K. R.
Right arrow Articles by Gross, H. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Luehrsen, K. R.
Right arrow Articles by Gross, H. J.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research, 1981, Vol. 9, No. 4 965-970
© 1981

MOLECULAR BIOLOGY

The nucleotide sequence of the 5S rRNA from the archaebacterium Thermoplasma acidophilum

Kenneth R. Luehrsen*, George E. Fox*, Michael W. Kilpatrick**, Richard T. Walker**, Horst Domdey$,{dagger}, Guido Krupp$,{dagger} and Hans J. Gross$,{dagger}

*Department of Biophysical Sciences, University of Houston Houston, TX 77004, USA **Chemistry Department, Birmingham University Birmingham B15 2TT, UK $Max Planck Institut für Biochemie 8033 Martinsried, GFR

Received December 31, 1980.

The complete nucleotide sequence of the 5S ribosomal RNA isolated from the archaebacterium Thermoplasma acidophilum has been determined. The sequence is: pG GCAACGGUCAUAGCAGCAGGGAAACACCAGAUCCCAUUCCGAACUCGACGGUUA AGCCUGCUGCGUAUUGCGUUGUACUGUAUGCCGCGAGGGUACGGGAAGCGCAA UAUGCUGUUACCAC(U)OH. The homology with the 5S rRNA from another archaebacterial species, Halobacterium cutirubrum, is only 60.6% and other 5S rRNAs are even less homologous. Examination of the potential for forming secondary structure is revealing. T. acidophilum does not conform to the usual models employed for either procaryotic or eucaryotic 5S rRNAs. Instead this 5S rRNA has a mixture of the characteristic features of each. On the whole this 5S rRNA does however appear more eucaryotic than eubacterial. These results give further support to the notion that the archaebacteria represent an extremely early divergence among entities with procaryotic organization.

{dagger}Present address: Institut für Biochemie, Universität Würzburg, Roentgenring 11, 8700 Würzburg, GFR


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?




Disclaimer:
Please note that abstracts for content published before 1996 were created through digital scanning and may therefore not exactly replicate the text of the original print issues. All efforts have been made to ensure accuracy, but the Publisher will not be held responsible for any remaining inaccuracies. If you require any further clarification, please contact our Customer Services Department.