ABSTRACT
We show that two invertase genes in potato, like most other plant invertase
genes, include a very short second exon of 9 bp which encodes the central three
amino acids of a motif highly conserved in invertases of diverse origin. This
mini-exon is one of the smallest known in plants and pre-mRNA from these genes may be susceptible to alternative splicing,
because of a potential requirement for specialized interaction with the
splicing machinery to ensure correct processing for the production of a mature
mRNA. No evidence of aberrant post-transcriptional processing was observed during normal invertase gene
expression in potato. The fidelity of post-transcriptional processing of the pre-mRNA from one of the genes was perturbed by cold stress, resulting
in the deletion of the mini-exon from some transcripts. This alternative splicing event occurred under
cold stress in both leaf and stem, but was not induced by wounding. This adds
an example of exon skipping and the induction of alternative processing by cold
stress to the small number of transcripts which have been shown to exhibit
alternative splicing in plants. The differential sensitivity of post-transcriptional processing to cold stress observed for the two transcripts
examined will permit further dissection of the nucleotide sequence requirements
for their accurate splicing.
In plants the cleavage of sucrose to glucose and fructose can be catalysed by
invertase ([beta]-fructosidase, EC 3.2.1.26;
1
) or sucrose synthase (EC 2.4.1.13;
2
). These enzymes are central to sucrose metabolism and so are involved in
fundamental physiological processes, at both the whole plant and cellular
levels, such as source-sink interaction and carbohydrate partitioning (
3
,
4
). Invertases can be divided into neutral (cytosolic) and acid (vacuolar and
apoplastic) classes (
5
). Acid invertases have been purified from a wide variety of plants (for a
compilation of references see
6
,
7
) and, with many cDNA and genomic clones also having been isolated, have been
shown in some plants to be encoded by a family of related genes (see for
example
8
,
9
). Derived amino acid sequences reveal that plant invertase proteins share a
number of highly conserved motifs with each other and with invertases from
yeast and bacteria (
10
). These include a potential active site motif (WECPD) and a further highly
characteristic motif (NDPNG/A), which may also participate in the catalytic
mechanism, near the N-terminal of the protein. This latter motif has been included in protein
databases (e.g. PROSITE) as the definitive [beta]-fructosidase motif. Characterization of plant genomic clones
encoding invertases has shown that, with a single exception, the central core
of this motif (DPN) is encoded by a mini-exon of 9 bp. This is one of the smallest exons known in plants. In animal
systems a minimal exon length of 51 bp for the promotion of correct splicing
has been proposed, with smaller exons being liable to aberrant splicing
resulting from the close juxtaposition of 5' and 3' splice sites (
11
). A significant number of animal, but few plant, exons are shorter than this
limit and it has been further proposed that these shorter exons may require
splice sites which are `stronger' than normal and/or additional enabling
elements for their correct recognition (
12
). A variety of alternative splicing events (involving intron retention,
alternative 3' or 5' splice sites, exon skipping, etc.) have been catalogued in animal
systems (
13
). Such events have been shown to result in the synthesis of alternative
proteins which may differ in their function or tissue distribution. The widely
documented occurrence of alternative splicing has prompted suggestions that it
constitutes an alternative mechanism at which the regulation of gene expression
can be effected. In plants, only a few examples of alternative splicing have
been described. Several examples of alternative 5' splicing events are known: e.g. in transcripts for rubisco activase in
spinach and
Arabidopsis
(
14
) and in barley (
15
), for RNA binding protein 1 in tobacco (
16
) and for chorismate synthase in tomato (
17
). Alternative 3' splicing occurs in processing of transcripts from the maize
P
gene (
18
) and encoding the H protein of
Flaveria trinervia
(
19
). Alternative processing of the transcript for granule-bound starch synthase in rice can result in the retention of intron I in
the mature message (
20
). Given the small size of the mini-exon in plant invertase genes, their transcripts are candidates for
alternative splicing events which would result in omission of sequences encoded
by the mini-exon from the mature mRNA and translation to a mutated polypeptide which
lacks the core of the [beta]-fructosidase motif. This possibility has led us to survey expression
from invertase genes in potato for alternative splicing events. We demonstrate
that alternative splicing can be induced by cold stress and that a differential
effect is observed during expression of the two plant invertase genes examined.
DNA was isolated from leaf of
Solanum tuberosum
(cv. Cara) by extraction including an alkaline SDS lysis step (
21
). Aliquots of 30 ng were used as template in a PCR assay of a total volume of
50 [mu]l containing 1 [mu]M each of 5' and 3' primers [for CD111, AMWT1 (CCAGGGTTGCAATCTACAAGCACGG) and AMW6 (GTCGGTTGAAACTGAATGGGCCCAA) respectively; for CD141,
AMWT4 (CCATGTTGATGTTAGCAAGGTCCAT) and AMW2 (GCCCCATATCGCTCCCTTTGGGTTG)], 0.2 mM
dNTPs, 1.5 mM MgCl
2
, 50 mM KCl and 20 mM Tris-HCl, pH 8.4, with 1 U
Taq
polymerase (Gibco-BRL). PCR was conducted for 40 cycles (95oC/1 min, 65oC/1 min, 72oC/3 min per cycle) with a final extension at 72oC for 5 min. Reaction products were analysed by
agarose gel electrophoresis and the single products obtained were cloned into
pGEM-T (Promega) and sequenced (
22
) in both directions.
Total RNA was isolated from leaf and stem of
Solanum tuberosum
(cv. Cara) following the procedure of Schröder
et al.
(
23
). Contaminating DNA was removed by incubation with 1 U RQ1 DNase (RNase-free; Promega) in 100 [mu]l 10 mM Tris-HCl, pH 8, 1 mM EDTA containing 72 U RNase inhibitor (RNAguard;
Pharmacia Biotechnology) for 20 min at 37oC followed by RNA precipitation and repetition of this treatment. Aliquots
of 2 [mu]g total RNA (DNA-free) were reverse transcribed with 200 U Superscript reverse
transcriptase (Gibco-BRL) in a final volume of 25 [mu]l of 75 mM KCl, 3 mM MgCl
2
, 10 mM DTT, 50 mM Tris-HCl, pH 8.3, at 42oC for 45 min in the presence of 1 mM dNTPs and 0.5 [mu]g of the appropriate 3' primer [for CD111, 111R (GATAGACACCATTATAGTACATTGG); for
CD141, 141R (GATACACTCCATTGTAATACATTGG)]. Samples of 5 [mu]l from this reaction were used to provide the cDNA template for PCR using
the same 3' primer with the appropriate 5' primer [for CD111, 111F (GCACGGTGATGAGAAAAATGTTCA); for CD141,
141F (GCCATGTGATGTTAGCAAGGTCCA)] end-labelled with
32
P and buffer as described above. PCR conditions were 35 cycles of 94oC/1 min, 60oC/2 min and 72oC/3 min followed by a final extension at 72oC for 5 min. RT-PCR products were resolved by electrophoresis in 6% polyacrylamide-10% formamide gels and detected by autoradiography.
Products obtained using CD111 primers were eluted from the polyacrylamide gel
and used as substrate for PCR assays using these primers with conditions as for
the genomic PCR except that an annealing temperature of 60oC and 35 cycles were used. Single products from these reactions were cloned
into pGEM-T and sequenced (
22
) in both directions.
Stress experiments were conducted on plantlets in tissue culture grown on MS-30 medium (
24
) under a 16/8 h day/night cycle at 25oC. Three weeks after subculture of apical nodes, plantlets were stressed by
either cold or wounding. For cold stress, plantlets were transferred to a
growth cabinet and held at 4oC, with other conditions similar to those previously described. Plantlets
were harvested after 0 (control), 6, 24 and 48 h. For recovery, after 48 h at 4oC, plantlets were returned to 25oC for 24 h prior to harvest. For wounding stress, leaves on the
plantlets were punctured with a sharp sterile scalpel over the entire surface
and harvested after 24 h.
Genomic clones encoding invertase enzymes have now been isolated from carrot,
Arabidopsis,
maize and tomato (
9
,
25
-
29
). The intron/exon
organization of all of these (Fig.
1
a) is characterized by the presence of a major exon of ~1 kb encoding the majority of the polypeptide, including the proposed
active site.
Downstream of this some variation in the size of introns is evident, with their
absence
in some cases
(e.g. one
Arabidopsis
gene where the major exon incorporates sequences represented by two further
exons in the other genes). Upstream of the major exon an unusual feature of
these genes is the presence of a very small exon, only 9 bp in size, which is
present in all the genes except in one carrot gene, where it is incorporated
into the major exon.
Both introns flanking the mini-exon show variability in length in these plant species. The 9 bp exon
encodes the central three amino acids of the [beta]-fructosidase motif (DPN), which has been proposed to be involved in
the formation of the catalytic site of the enzyme, a function consistent with
its high degree of evolutionary conservation.
To assay for alternative splicing events
involving the mini-exon of each of the potato genes we used two further sets of primers
designed specifically to amplify, by RT-PCR, the same region (exon I-exon III, including exon II and its flanking introns) of the transcripts
derived from the two potato invertase genes. In both cases, if transcripts were
correctly spliced a product of 105 bp would result, while if exon II was
skipped in an alternative splicing event an alternative product of 96 bp would
be generated.
RNA isolated from tissues where both genes are expressed (leaf and stem)
was used
for RT-PCR, but no evidence of alternative splicing events was observed, with
only a single product of 105 bp representing accurate splicing being detected
(results not shown). It is known that stress, e.g. heat shock, can induce
alternative splicing in animals (
31
). In potato, invertase enzymes have been implicated in the accumulation of
reducing sugars (low temperature sweetening) in tubers
undergoing cold storage (
32
). For this reason the potential for alternative splicing of invertase
transcripts induced by cold stress is of particular interest in potato. We
exposed plantlets of potato in tissue culture to a time course of cold exposure
and a subsequent recovery period. Leaf RNA isolated from each time point was
used as substrate for RT-PCR with the same sets of primers previously
described. With primers against CD111 transcripts, after 6 h under cold stress
two major products were detected (Fig.
2
), one of 105 bp and a second product of 96 bp, representing a potential product
of alternative splicing. The amount of this second product increased with the
time of exposure to cold stress. However, no evidence of this smaller product
was detected after the recovery period. A further product was also detected
between the two major products in all samples. All three products were cloned
and sequenced to check their correspondence to the products from the accurate
and alternative splicing events. Both the 105 bp and intermediate products
correspond to the accurate splicing product as predicted from the cDNA sequence
and the intermediate product may therefore represent a denaturation artefact
generated from the 105 bp product. The 96 bp product was confirmed as an
alternatively spliced product which lacked the 9 bp corresponding to exon II
(Fig.
3
). With primers for CD141 transcripts, no evidence of an alternative spliced
product was detected even after 48 h under cold stress (result not shown).
To examine further the specificity of the alternative splicing event we have
looked for its occurrence in a different tissue and under an alternative stress
condition. RNA was extracted from stem tissue after 48 h of cold stress and
used in RT-PCR with both sets of primers. Again, for CD111 transcripts an
alternatively spliced product was observed after cold stress but not in control
plantlets, whereas for CD141 transcripts only the correctly spliced product was
detected for both sets of plantlets (Fig.
4
). This indicates that the alternative processing event is not specific to leaf
but can occur in another tissue where this gene is expressed. To examine an
alternative stress condition we have conducted a wounding experiment. RNA was
prepared from wounded tissue and used as substrate for RT-PCR, again using both
sets of primers. In this case no alternative splicing was observed for either
transcript (Fig.
4
).
We have analysed the nucleotide sequences of both the exons which have been
suggested to be important for correct splicing (
33
) and the introns involved in this splicing event. The relevant nucleotide
sequences from both genes are deposited in the EMBL nucleotide sequence
database under the accession nos X95820 and X95821. One feature apparent in the
exon sequences is the presence of a pentanucleotide (YAAYG) which is repeated
four times in the gene encoding CD111: at the end of exon I, in exon II and
twice at the start of exon III. The number and location of these repeats is
conserved in the gene encoding CD141 with the exception of within the mini-exon, where the sequence AAATG is found. An examination of other plant
invertase gene exon sequences in this region shows that this pentanucleotide
repeat is largely conserved in number and location, although more variation in
sequence is observed. The sequences of the smaller intron II of both genes,
with A/T contents of 83 and 81%, lie at the upper end of the range of AU
content for dicotyledon introns (~60-80%) (
34
). The AU/GC transitions of intron/exon borders may represent an important
signal in plant intron recognition (
35
) and the high AU content of these introns constitutes a sharp transition in
this measure from the neighbouring sequences of intron I and exon II on one
side and exon III on the other. Both introns contain long A/T-rich tracts which, notably in the case of CD111, include a 15 bp perfect
repeat. Sequences resembling this repeat are also found in the CD141
transcript.
The two potato genes whose expression we have studied (
8
) share with most other plant invertase genes an intron/exon organization which
features a mini-exon II of 9 bp (Fig.
1
). Under cold stress pre-mRNA from one of these genes (CD111) was subject to alternative splicing
which resulted in the omission of sequences corresponding to exon II from some
mature transcripts (Figs
2
and
3
). These aberrant processing events occurred in both tissues in which this gene
is expressed, but accurate splicing was restored on removal of cold stress. No
alternative splicing of invertase gene transcripts was induced by wounding
(Fig.
4
), indicating that it does not result from a generalized response to stress.
It seems unlikely that this alternative splicing results from a non-specific decrease in the efficiency of processing of precursor mRNAs in
the cold, since no such effect was observed for CD141 transcripts. This
inference is reinforced by control experiments (results not shown) which
detected no cold-induced effects on processing of downstream introns in CD111 transcripts.
We suggest that accurate splicing of invertase gene transcripts may be mediated
by signals within their exon/intron organization and that the difference
observed in the processing of CD111 and CD141 transcripts results from
differential interaction of the splicing machinery with these under cold
stress. The pentanucleotide YAAYG is repeated four times in the exon I border-exon II-exon III border sequence of potato invertase genes and represents
a potential signal. These sequences are, however, within coding regions and may
be conserved because of a strict requirement for a particular amino acid
sequence: this is consistent with the involvement of this region in an
essential function at the enzyme level. Alternatively they may, in plants, have
a composite function, at both the RNA and protein levels. Within the context of
the short but highly AT-rich intron II we have detected a perfect repeat of 15 nt in CD111, with
similar sequences in CD141. These repeat sequences may act to signal the
presence of the mini-exon in a fashion similar to the repeated hexanucleotides found in animal
introns, which are thought to exert an influence on exon selection (
36
). A wider analysis of the corresponding invertase introns in dicotyledons
reveals similar features, with the smaller intron II having a higher A/T
content than surrounding sequences and including A/T-rich tracts similar to the repeat sequences found in the potato genes
intron II, although the high A/T content precludes definitive assignment as
such. Also present are sequences which, on the basis of similarity to consensus
plant sequences, are potential 5' and 3' splice site signals. Thus a variety of potential signals are
present which may mediate correct splicing of the invertase sequences encoded
by these mini-exons and the differences which exist between CD111 and CD141 transcript
processing under cold stress in potato may reflect altered affinity of one or
more splicing factors interacting with these. Sequestration of the mini-exon could also be effected by modification to secondary structures in
intron sequences at low temperature. Further analysis of the differential
splicing, complemented by a directed mutation approach, might aid dissection of
the relative importance of potential splicing signals and the sequence of
splicing events.
We have demonstrated that exon skipping induced by cold stress can occur during
expression of one of two invertase genes in leaves and stem of potato. Under
the controlled conditions applied in tissue culture the proportion of
alternative to correctly spliced transcripts is low. While this may represent
either a low level of alternative splicing of CD111 throughout these organs or
a higher level of alternative splicing in specific tissues or cell lineages set
against a background of correct splicing elsewhere, CD111 expression occurs in
young developing leaf tissue where extracellular invertase levels are likely to
be critical to the maintenance of sink strength. Further work on the specific
expression patterns of these genes and the sensitivity of this to cold stress
is required, in addition to a determination of the effect of the deletion of
the core of the [beta]-fructosidase motif on the activity and the stability of the enzyme,
before the importance of the effects of aberrant splicing of invertase genes to
the physiology of the whole plant can be assessed.
A.-S.B. was supported by the EC under the AIR programme, A.M. by a BBSRC Post-graduate Research Studentship, R.W. and G.C.M. by the Scottish
Office Agriculture, Environment and Fisheries Department. We thank Dr J. W. S.
Brown for help in the interpretation of exon/intron sequence signals.
REFERENCES
Return