Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (103K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Florian, V
Right arrow Articles by Klein, A
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Florian, V
Right arrow Articles by Klein, A
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 1996 Oxford University Press 3195-3201

Footnote

A nascent micronuclear pseudogene in the ciliate Euplotes crassus

A nascent micronuclear pseudogene in the ciliate Euplotes crassus Volker Florian and Albrecht Klein*

Molecular Genetics, Department of Biology, Philipps University, D-35032 Marburg , Germany

Received April 29, 1996; Revised and Accepted July 1, 1996 EMBL accession nos +

ABSTRACT

The macronuclear genome of Euplotes crassus contains two different genes, EFA1 and EFA2 , encoding EF-1 [alpha] proteins. They are derived from micronuclear precursors in the course of a sexual process termed conjugation. We have found that two apparent micronuclear precursors exist for EFA1 . They differ in their potential coding sequences and in the internal sequences interrupting the genes, which are normally removed during the processing from micronuclear into macronuclear genes. One of these genes is not processed into a macronuclear gene and has accumulated C -> T transitions in a limited section of the coding region. The gene obviously constitutes a recent duplication which has lost its ability to be processed into a macronuclear gene and has therefore become a micronuclear pseudogene. The true EFA1 precursor harbours a novel type of internal sequence in addition to a classical AT-rich IES. As usual, only one micronuclear EFA2 precursor gene was found. Its coding sequence is interrupted by a 79 bp TelIES.

INTRODUCTION

Ciliated protozoa are characterized by nuclear dimorphism ( 1 , 2 ). The cells contain generative diploid micronuclei and vegetative macronuclei. This situation can be viewed as a parallel to the germ line-soma differentiation of higher eukaryotes, since only macronuclei are physiologically active. The DNA contents and sequence complexities of the two nuclear types differ. Macronuclei have lower sequence complexity but contain more DNA. This is due to the mode of their generation. During a sexual phase cells of compatible mating types form pairs and exchange meiosis products of their micronuclei. They fuse with the non-transferred haploid nuclei of the respective partner cell to form synkarya. The new diploid nucleus in each of the partner cells divides at least once to form one or more micronuclei, depending on the organism, and the macronuclear precursor, termed the anlage. The anlagen chromosomes undergo rearrangements, which are most pronounced in the hypotrichous ciliates ( 3 - 6 ) to which Euplotes crassus belongs. First, the anlagen chromosomes undergo polytenization. Different types of sequences which interrupt the macronucleus-destined sequences of the micronuclear genes are then removed in several steps ( 7 , 8 ) and the chromosomes are subsequently fragmented into gene sized molecules. These nascent macronuclear genes are differentially amplified and telomeres are attached ( 9 - 11 ) before a further, general amplification follows to complete the development of the new macronuclear chromosomes. The macronucleus-destined sequences, i.e. the precursor sequences of the macronuclear genes, are clustered in the micronuclear chromosomes ( 12 ). Since in addition to the removed intragenic sequences the long intergenic regions are lost during formation of the macronuclear chromosomes, the sequence complexity is reduced by >90%, while the total DNA content increases.

Three classes of sequences that can interrupt the coding regions of macronucleus gene precursors have been described. Internal eliminated sequences (IES) are AT-rich non-coding short sequences ( 13 ), transposon-like elements of E.crassus (Tec) are very frequent long sequences with open reading frames and inverted repeats ( 14 - 16 ), which probably enable them to transpose ( 17 ). TelIES elements are very short relatively GC-rich sequences containing C 4 A 4 motifs reminiscent of macronucleus chromosome telomeres ( 18 ). All these elements are flanked by TA repeats. A common excision mechanism has been proposed for the Tec and IES sequences involving circular intermediates which are most likely not formed in the course of removal of the very short TelIES ( 19 , 20 ).

We have been interested in the organization and expression of genes encoding EF-1[alpha] translation factors in hypotrichous ciliates. Euplotes crassus contains two different such genes, EFA1 and EFA2 , which are both transcribed ( 21 ). They differ in copy number and codon usage, pointing to different expression levels, which have indeed been found. Since we have indications that the macronuclear gene copy number might be correlated with the timing of excision from the polytene anlagen chromosome (Dönhoff and Klein, unpublished results), we were interested to characterize the micronuclear counterparts of the two EFA genes. The micronuclear EFA1 gene is interrupted by an AT-rich IES sequence and in addition contains a long novel interrupting sequence with 12 bp terminal repeats. In addition, we have discovered an EFA1 pseudoprecursor which is not processed into a macronuclear gene. It contains the same IES element but lacks the novel intervening sequence found in the functional precursor and shows point mutations in a narrow range of its open reading frame. Only one EFA2 precursor was found, which harbours a short TelIES element.

MATERIALS AND METHODS

Organisms and growth conditions

Euplotes crassus strains Por-3 and Liv-1 ( 22 ), as well as the feeding alga Dunaliella tertiolecta , were kindly supplied by Prof. P. Luporini (University of Camerino, Italy). The ciliates and the algae were grown at 22oC in artificial seawater as described previously.


Figure 1 . Location of primers used in the present study. The EFA1 (top) and EFA2 (bottom) genes are shown. The locations of the intervening sequences (open bars) in the micronuclear genes are indicated. Filled bars show the coding sequences. Non-coding sequences of the genes are given as hatched bars. The sequences of the two macronuclear genes have been deposited in the GenBank (accession nos: EFA1 , U26260; EFA2 , U26267).

General methods of DNA purification and analysis

General DNA preparation, electrophoresis, restriction analysis and hybridization techniques have been previously described ( 23 - 25 ).

Preparation of total E.crassus DNA

For the preparation of total cellular DNA E.crassus was grown to a density of 2-3 * 10 3 /ml. Feeding was then stopped and the organisms left without food for 3 days. The cells were harvested by two subsequent filtration steps through 30 and 10 [mu]m nylon gauze, rinsed off with seawater and collected by low speed centrifugation. They were resuspended in 3 vol lysis buffer (10 mM Tris-HCl, pH 7.5, 10 mM EDTA, 250 mM NaCl, 0.5% SDS) ( 8 ) and lysed at 65oC for 15 min. Proteins were digested at 50oC overnight after addition of 200 [mu]g/ml proteinase K. The solution was extracted with phenol and the DNA dissolved in TE (10 mM Tris-HCl, pH 7.5, 1 mM EDTA) after ethanol precipitation.

Preparation of micronuclear DNA

The cells were collected as described above. They were resuspended in 10 ml TE/ml packed cells. After addition of 0.1% Triton X-100 and 1 [mu]g/ml trypsin the suspension was incubated at room temperature. Lysis of the cells and the macronuclei was followed microscopically. As soon as the macronuclei had been destroyed the trypsin treatment was stopped by transferring the lysate to ice and addition of 2 [mu]g/ml trypsin inhibitor. The nuclei were spun out of the lysate at low speed (500 g ) and 4oC, then washed twice with TE to remove most of the macronuclear DNA. After the addition of 1 ml lysis buffer, the micronuclear DNA was prepared by proteinase K digestion, phenol extraction and ethanol precipitation as described above. The DNA was applied to a preparative 1% agarose gel and separated from residual macronuclear DNA. The visible high molecular weight DNA was cut out of the gel and electrophoresed through a similar gel. The DNA was removed from the agarose by electroelution and precipitated by isopropanol in the presence of 1% glycogen.

Polymerase chain reactions and DNA sequencing

DNA amplification by polymerase chain reactions (PCR) and inverse PCR were performed as described ( 26 , 27 ). The products were directly sequenced according to established methods ( 28 , 29 ). The primers used are listed in Table 1 . Their positions are shown in Figure 1 . Sequencing of cloned DNA was performed according to the dideoxynucleotide termination method ( 30 ).

Table 1 . Primers used for analysis of the micronuclear EF-1[alpha] encoding genes
Name

Sequence

Position a

1F1

GATAAATTTTCCGAGTTGAGCG

3

1R1

CAATAACGACAAGATTGAGATG

139

1F2

GAGTCTGCTGAAATGGGTAAGGC

232

1R2

AGCCTTGAGCTTATCGAGTACCC

294

1F3

GAAGCTGGTATCTCCAAGGAAGG

469

1F4

CATACAGTGAAGGACAGATACG

581

1R3

CTGGCTTGTATCCGACCTTAGCG

660

1F5

GCCGGTATGGTCATCACCTTCGC

883

1R4

GTTTCCTGGAGCCGCTTCTGGGAC

981

1F6

ATTGTCACACTGCCCATATTGCC

1148

1R5

CTTGGTGAGGAGTTCTTCG

1197

1R6

TGATGAGTCCAGCATCTCCTGCC

1270

1F7

GCTGTCAGAGATATGAGACA

1336

1F8

CTGTCGCAGTCGGTGTCATC

1357

1R7

ATGATGACTATACTATAGAAGAG

1488

1iF

GCCATGGTATAGGCCCTATC

723

1iR

GTTGGGCCCTTGTATAATCT

743

2F1

CCATTGGAGATGACAAATTTATCGC

45

2R1

CCAGATGGTCAGAGACGTTCTCTAC

685

2F2

GAGATTCAATGAGATCGTAGAG

644

2R2

CTTGTTGTGATGAGCTTCTAAAG

1004

2F3

GAAGTTCAGTTCACCACTGGAG

942

2R3

CCTCTGTGTAATCAAGAGG

1495

a The numbers are the positions of the 5'-ends of the primers in the published macronuclear sequences of EFA1 (GenBank accession no. U26260) or EFA2 (GenBank accession no. U26267) for primers 2F1 and 2R1. Primers 1iR and 1iF start in the macronuclear sequence and reach into the AT-rich IES element (compare Fig. 3). All primers designated F read in the 5' -> 3' direction of the gene. The R primers read in the opposite direction.

Analysis of single strand conformational polymorphisms (SSCP)

The method of Hongyo et al. ( 31 ) was modified as follows. PCR products were separated on agarose gels to separate them from primer DNA and eluted from the gel. Aliquots of 10 ng each of the DNA samples to be compared were mixed in 15 [mu]l H 2 O. Then 1 [mu]l sample buffer (15% Ficoll, 0.25% bromophenol blue, 0.25% xylene cyanol FF) and 1 [mu]l 1 N NaOH were added. The DNA was denatured at 90oC for 4 min and immediately chilled on ice. The samples were analysed on 120 * 155 * 1 mm 10% polyacrylamide gels containing 5% glycerol in 0.5* TBE (4.5 mM Tris-borate, pH 8.3, 0.25 M EDTA). The gels were run at 120 V for 16-18 h at 4 and 20oC in parallel, since the single strand conformation critically depends on temperature. The DNA was visualized by silver staining ( 32 ).

RESULTS

A 347 bp IES sequence interrupts an apparent micronuclear EFA1 precursor


Figure 2 . Amplification products of macronuclear and micronuclear DNA with primers located in the EFA1 sequence. Macronuclear (lanes 1, 3 and 5) or micronuclear DNA (lanes 2, 4 and 6) was used as templates for PCR reactions employing primer pairs 1F1/1R3 (lanes 1 and 2), 1F3/1R4 (lanes 3 and 4) or 1F5/1R7 (lanes 5 and 6). In lane M a size marker is shown. The fragment sizes are given in kb. Note that a product obtained due to a macronuclear DNA impurity is seen beside the micronucleus-specific product in lane 4. For primer locations compare Figure 1.


Macronuclear or micronuclear DNA was used as template for the amplification of EFA1 sequences with three primer pairs derived from the coding sequence of the macronuclear gene (Fig. 1 ). Figure 2 shows that one of the obtained products from the micronuclear DNA was ~350 bp longer than its macronuclear counterpart. Sequence determination yielded a 347 bp AT-rich IES sequence interrupting the open reading frame (Fig. 3 ). In order to see whether the known coding sequence of the macronuclear and newly obtained micronuclear EFA1 genes were identical, primers (1iF and 1iR) were designed which have their 5'-termini in the coding sequence and their 3'-termini in the IES sequence. When combined with the primers from the non-coding 5' and 3' gene regions (1F1 and 1R7) only micronuclear sequences can be obtained by PCR amplification (compare Fig. 1 ). The products were sequenced directly in order to avoid cloning artifacts. Surprisingly, point mutations were discovered in a limited area of the coding region of the micronuclear copy (Fig. 4 ) This gene is subsequently called Mic EFA1 A.


Figure 3 . Sequence of the IES interrupting the coding sequences in the mic EFA1 genes. Identical sections of the mic EFA1 A and mic EFA1 B genes are shown. Nucleotides of the coding sequences adjacent to the IES are given in lower case, together with the encoded amino acids. Imperfect inverted repeat sequences are underlined. The terminal repeats are shown in bold.


Figure 4 . C -> T transition mutations found in the coding sequence of the mic EFA1 A pseudoprecursor gene. Three examples are visible by comparison of the micronuclear mic EFA1 A (Mi) and the macronuclear EFA1 (Ma) sequences. Two more such transitions were found at positions 1038 and 1073. The numbering follows that of the gene sequences in GenBank.


The mutational changes could also be visualized by a subsequent SSCP analysis of amplification products in comparison with their counterparts from macronuclear DNA (Fig. 5 ). In order to see whether additional mutations had occurred in different parts of the coding region as well, amplification products of micronuclear and macronuclear DNA with primers encompassing the other parts of the genes were also included in the SSCP analysis. Surprisingly, no differences in SSCP behaviour were seen in any other case, confirming that the point mutations were localized to a short region of the mic EFA1 A gene (Fig. 4 ). This was confirmed by analysis of the parts of the pseudogene corresponding to the potential micronucleus-destined sequences of this pseudoprecursor. These sequences were found to be identical to the respective sequences of the macronuclear EFA1 gene.


Figure 5 . SSCP analysis of amplification products from the EFA1 and mic EFA1 A genes. PCR reactions were performed with macronuclear DNA employing primers from the terminal non-coding regions (1F1/1R7) or with micronuclear DNA employing primers from the non-coding region combined with those located in the IES (1F1/i1R and i1F/1R7). The products were re-amplified with the primer combinations 1F1/1R2 (lane A and A'), 1F2/1R3 (lanes B and B'), 1F5/1R6 (lanes C and C') or 1F6/1R7 (lanes D and D'). The products of the second amplifications were denatured and the single strands separated electrophoretically on a polyacrylamide gel at room temperature under non-denaturing conditions. Lanes A-D, products from macronuclear templates; lanes A'-D', products from micronuclear templates. Note that the 3'-terminal part of the mic EFA1 B gene was not amplified in the first round due to the long insertion sequence between the IES and the 3'-terminus (compare Fig. 1).

When cells carrying this micronuclear gene were mated and the exconjugants analysed, the mutated gene was not found in the new macronuclear DNA, confirming that the mic EFA1 A gene is not a precursor for a macronuclear gene but rather a micronuclear pseudogene.

A second micronuclear EFA1 gene has the same coding sequence as the macronuclear EFA1 gene and contains a novel intervening sequence

Southern hybridization of a restriction digest of micronuclear DNA showed that two different micronuclear EFA1 genes exist. The DNA was digested with the restriction endonuclease Stu I, which does not cut within the sequence of the macronuclear gene nor in the IES sequence described above (compare Fig. 3 ). The DNA was then electrophoretically separated and a Southern blot was hybridized with the macronuclear EFA1 sequence as a probe. The autoradiogram presented in Figure 6 shows a relatively strong signal caused by a macronuclear impurity and two additional ones. One of these corresponds to the Stu I fragment containing the mic EFA1 A gene. The second one is due to a restriction fragment containing most of a second micronuclear EFA1 gene, mic EFA1 B, as will be shown below. The fact that the signal strength of this smaller micronuclear fragment is lower than that of the larger one indicated that one of the Stu I sites was located in an intervening sequence interrupting the coding sequence of mic EFA1 B. This could indeed be shown by inverse PCR. Micronuclear DNA was digested with Afl II or Eae I restriction endonucleases, which fulfil the same criteria as Stu I, and subsequently religated to obtain DNA circles. These were suitable substrates for amplification with the primer pairs 1R2 and 1F3 or 1R6 and 1F7 respectively. The amplification products were re-amplified with primer pairs 1R1 and 1F4 or 1R5 and 1F8 respectively, to make sure that specific products had been obtained. Sequence analyses yielded the nucleotide sequences of the ends of an intervening sequence between nucleotides 1134 and 1135 of the EFA1 sequence. Strikingly, a 12 bp sequence is duplicated at the ends of this intervening sequence, in contrast to the TA duplication found in IES and Tec sequences (Fig. 7 ). Attempts to amplify the missing part of the intervening sequence with appropriate primer combinations, derived from the sequences obtained after the inverse PCR reactions, failed. This indicates that it may be quite long, because >2 kb amplification products with other primer-template combinations were obtained under the same conditions. The amplification product obtained with the primer pair 1R1 and 1F4 also includes the region containing the 347 bp IES in the mic EFA1 A gene. Sequence analysis of the resulting product did show the known 347 bp IES in the mic EFA1 B gene in the same location. If this gene is indeed the precursor of the EFA1 gene, identical coding sequences are expected in both genes. Sequence determination of the portion of the mic EFA1 B gene known to have deviations from the macronuclear sequence in the mic EFA1 A gene yielded the same sequence as in the macronuclear gene. This supports the view that mic EFA1 B is the precursor of EFA1 .


Figure 6 . Autoradiogram of a Southern hybridization of electrophoretically separated Stu I fragments of micronuclear DNA (lane 1). Cloned EFA1 DNA was used as a radioactive probe. Bacteriophage [lambda] DNA digested with Pst I was used as a size marker (lane M). The strong signal at ~1.8 kb is due to macronuclear EFA1 DNA contamination.


Figure 7 . 5'- and 3'-ends of the intervening sequence contained in the mic EFA1 B gene. Adjacent nucleotides of the coding sequences are given in lower case, together with the encoded amino acids. The terminal repeats are shown in bold.

The precursor of the EFA2 gene contains a TelIES

PCR reactions with micronuclear DNA as template and three sets of primers derived from the sequence of the macronuclear EFA2 gene (compare Fig. 1 and Table 1 ) yielded overlapping products, one of which (obtained with the primer pair 2F1 and 2R1) was slightly longer than the corresponding PCR product obtained with a macronuclear EFA2 template. Sequence analysis showed a 79 bp TelIES sequence characterized by sequences reminiscent of the telomeric repeats of E.crassus macronuclear chromosomes (Fig. 8 ). It ends in a 5 bp repeat.


Figure 8 . TelIES sequence contained in the mic EFA2 gene. Nucleotides of the coding sequences adjacent to the TelIES are given in lower case, together with the encoded amino acids. The terminal repeats are shown in bold.

Putative chromosome fragmentation sequences for processing of the mic EFA1 and mic EFA2 genes


Figure 9 . Potential fragmentation sequences near the 5'- and 3'-ends of the micronuclear EFA1 and EFA2 genes. The sequences surrounding the 5'- or 3'-ends of the genes are shown. The gaps mark the junctions between the macronucleus-destined sequences, which are identical to the corresponding sequences of the macronuclear genes, and the micronucleus-specific flanking sequences. The dashes indicate continuation of the macronucleus-destined sequences. As shown, no differences were seen between the sequences of the flanking sequences of the mic EFA1 A and mic EFA1 B genes. The bases of potential fragmentation sequences are shown in bold and underlined as far as they agree with the fragmentation consensus sequence (33) shown at the bottom of the figure.


Consensus sequences of putative chromosome fragmentation sequences have been defined in E.crassus ( 33 ). An analysis of the sequences of the non-coding regions of the EFA1 and EFA2 macronuclear genes and the sequences adjacent to the ends of the macronucleus-destined sequences of both mic EFA1 and the mic EFA2 was performed in order to obtain clues as to whether excision of the different genes might be influenced by variant fragmentation, which has been observed for the rDNA of Tetrahymena thermophila ( 34 ). The results are shown in Figure 9 . Well-preserved fragmentation sequences are found in the 5'-non-coding region of the EFA1 and the 3'-non-coding region of the EFA2 genes. Of particular interest is the finding that identical fragmentation sequences are seen in the 3'-flanking region adjacent to both mic EFA1 genes. This rules out fragmentation sequence variations preventing processing of the mic EFA1 A gene.

DISCUSSION

Comparison of the two micronuclear EFA1 genes, mic EFA1 A and mic EFA1 B, indicates that mic EFA1 A is a recent pseudogene

Comparative sequence analysis of the two micronuclear EFA1 genes has shown that they are very similar. This concerns not only the coding sequences but also the 347 bp IES, which is identical in both genes, as well as the flanking sequences up to positions -220 and +130 at their 5'- and 3'-ends (data not shown). Since no selective pressure is imposed on the micronuclear genes except for the conservation of their capability to be processed into macronuclear genes, one would expect an accumulation of mutations in both the coding and non-coding sequences in an inactive gene. However, only a few mutations in a limited area of the coding sequence of the pseudoprecursor have occurred so far. This indicates that we are looking at a recent duplication.

Possible reasons for the lack of mic EFA1 A processing

Analysis of the flanking sequences of the micronuclear EFA1 genes (Fig. 9 ) did not provide any clue as to why any of them should be processed more or less efficiently. A consensus sequence for chromosome fragmentation has been established for E.crassus ( 33 ). One of the potential fragmentation sequences detected in either the non-coding regions of the potential macronucleus-destined sequences or the neighbouring regions in the micronuclear sequences shows significant sequence similarity with the consensus sequence in each case, while the sequence similarity of the other one is at most moderate. One fragmentation sequence close to each end of the genes would suffice for excision of the macronucleus-destined sequences according to the current model of the excision process ( 33 ). Of course, other determinants in the intergenic regions may be necessary, which might be more distant than the sequences we have analysed adjacent to the two EFA1 genes. Such fragmentation signals would therefore have escaped our attention. Since the mic EFA1 B gene apparently contains an additional internal sequence, it cannot be ruled out that it could be a prerequisite for the processing of mic EFA1 B into the macronuclear EFA1 gene. This intervening DNA sequence is most likely >2 kb long. It will therefore be interesting to obtain its entire sequence and look for potential open reading frames. Such analyses are presently underway.

The mutations encountered in the mic EFA1 A gene are all C -> T transitions. This situation is reminiscent of repeat induced point mutations (RIP) in fungi, in which duplicated genes are mutated in the same way ( 35 - 37 ). In this case the mutations are correlated with methylation of cytosines. There are indications that cytosine methylation can cause elevated rates of deamination, leading to the observed mutation type ( 38 ). If this was true, the pseudogene could be expected to be more highly methylated. This might also indicate that duplication has led to its positioning in a special region of the chromosome, most likely outside a gene cluster, since high mutation rates in macronucleus-destined sequences have not been observed in authentic micronuclear precursor genes so far. This interpretation is in line with the recent finding that chromosomal regions exist into which Tec elements can be positioned outside gene clusters. These Tec elements are amplified to a lesser degree in the polytene stage of the anlagen chromosomes at a late stage of the processing events. They are probably lost during chromosome fragmentation (S. Frels, C. M. Tebeau, S. Z. Doktor and C. L. Jahn, personal communication).

The terminal structure of the apparent novel intervening sequence in the mic EFA1 B gene suggests a mechanism for its removal, distinct from that of IES, TelIES and Tec elements

The 12 bp repeats flanking the intervening sequence in the mic EFA1 B gene (Fig. 7 ) suggest that the rearrangement of the coding sequence leading to the coherent macronuclear gene sequence involves a site-specific recombination event. This is reminiscent of the events occurring during formation of several genes in Oxytricha , where macronuclear genes have to be formed from patches of coding sequences in their micronuclear precursors, involving intricate recombination processes between short repeated sequences separating the various macronucleus-destined sequences (reviewed in 4 ). In the cyanobacterium Anabaena removal of an intervening sequence by site-specific recombination in the course of the activation of genes involved in nitrogen fixation is another example of the transformation of a precursor into a functional gene by site-specific recombination ( 39 ). We are presently looking for a potential ring intermediate, which is to be expected if our hypothesis invoking an intrachromosomal element that is removed by a simple recombination step is correct.

ACKNOWLEDGEMENTS

We thank Helga Bestgen for photographic work and Sophie Curtenaz for critical reading of the manuscript. This work was supported by the Deutsche Forschungsgemeinschaft.

REFERENCES

1 Nanney,D.L. (1986) In Gall,J.G. (ed.), The Molecular Biology of Ciliated Protozoa. Academic Press, New York, NY, pp. 1-21.

2 Heckmann,K. (1964) Z. Vererbungsl., 95, 114-124.

3 Yao,M.-C. (1989) In Berg,D.E. and Howe,M.M. (eds), Mobile DNA. American Society of Microbiology, Washington, DC, pp. 715-734.

4 Prescott,D.M.(1992) Trends Genet., 8, 439-445. MEDLINE Abstract

5 Prescott,D.M.(1994) Microbiol. Rev., 58, 233-267. MEDLINE Abstract

6 Klobutcher,L.A. and Prescott,D.M.(1986) In Gall,J.G. (ed.), The Molecular Biology of Ciliated Protozoa. Academic Press, New York, NY, pp. 111-154.

7 Tausta,S.L. and Klobutcher,L.A. (1989) Cell, 59, 1019-1026. MEDLINE Abstract

8 Tausta,S.L. and Klobutcher,L.A. (1990) Nucleic Acids Res., 18, 845-853. MEDLINE Abstract

9 Roth,M. and Prescott,D.M. (1985) Cell, 4, 411-417.

10 Vermeesch,J.R., Williams,D. and Price,C.M. (1993) Nucleic Acids Res., 21, 5366-5371. MEDLINE Abstract

11 Vermeesch,J.R. and Price,C.M. (1994) Mol. Cell. Biol., 14, 554-566. MEDLINE Abstract

12 Jahn,C.L., Nilles,L.A. and Krikau,M.F. (1988) J. Protozool., 35, 590-601. MEDLINE Abstract

13 Klobutcher,L.A., Jahn,C.L. and Prescott,D.M.(1984) Cell, 36, 1045-1055 MEDLINE Abstract

14 Jahn,C.L., Krikau,M.F. and Shyman,S. (1989) Cell, 59, 1009-1018. MEDLINE Abstract

15 Krikau,M.F. and Jahn,C.L. (1991) Mol. Cell. Biol., 11, 4751-4759. MEDLINE Abstract

16 Jahn,C.L., Doktor,S.Z., Frels,J.S., Jaraczewski,J.W. and Krikau,M.F. (1993) Gene, 133, 71-78. MEDLINE Abstract

17 Jaraczewski,J.W., Frels,J.S. and Jahn,C.L. (1994), Nucleic Acids Res., 22, 4535-4542.

18 Klobutcher,L.A. (1995) Proc. Natl. Acad. Sci. USA, 92, 1979-1983. MEDLINE Abstract

19 Klobutcher,L.A., Turner,L.R. and LaPlante,J. (1993) Genes Dev., 7, 84-94. MEDLINE Abstract

20 Jaraczewski,J.W. and Jahn,C.L. (1993) Genes Dev., 7, 95-105. MEDLINE Abstract

21 Bergemann,J., Florian,V., Kremser,T. and Klein,A. (1996) Gene, 168, 109-112. MEDLINE Abstract

22 Valbonesi,A., Ortenzi,C. and Luporini,P. (1992) J. Protozool., 39, 45-54.

23 Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

24 Ausubel,F.M., Brent,R., Kingston,R.E., Moore,D.D., Seidmann,J.G., Smith,J.A. and Struhl,K. (1995) Current Protocols in Molecular Biology. Wiley Interscience, New York, NY.

25 Chomczynski,P. (1992) Anal. Biochem., 201, 134-139. MEDLINE Abstract

26 Saiki,R.K., Gelfand,D.H., Stoffel,S., Scharf,S.J., Higuchi,R. Horn,G.T., Mullis,K.B. and Ehrlich,H.A. (1988) Science, 239, 487-491. MEDLINE Abstract

27 Silver,J. (1991) In McPherson,M.J., Quirke,P. and Taylor,G.R. (eds), PCR: A Practical Approach. Oxford University Press, New York, NY, pp. 137-146.

28 Casanova,J.-L., Pannetier,C., Jaulin,C. and Kourilsky,P. (1990) Nucleic Acids Res., 18, 4028. MEDLINE Abstract

29 Winship,P.R. (1989) Nucleic Acids Res., 17, 1266. MEDLINE Abstract

30 Sanger,F., Nicklen,S. and Coulson,A.R. (1977) Proc. Natl. Acad. Sci. USA, 85, 5463-5467. MEDLINE Abstract

31 Hongyo,T., Buzard,G.S., Calvert,R.J. and Weghorst,C.M. (1993) Nucleic Acids Res., 21, 3637-3642. MEDLINE Abstract

32 Santos,F.R., Pena,S.D.J. and Epplen,J.T. (1993) Hum. Genet., 90, 655-656. MEDLINE Abstract

33 Baird,S.E. and Klobutcher,L.A. (1989) Genes Dev., 3, 585-597. MEDLINE Abstract

34 Kapler,G.M. and Blackburn,E.H. (1994) Genes Dev., 8, 84-95. MEDLINE Abstract

35 Selker,E.U. and Stevens,J.N. (1985) Proc. Natl. Acad. Sci. USA, 82, 8114-8118. MEDLINE Abstract

36 Cambareri,E.B., Jensen,B.C., Schabtach,E. and Selker,E.U. (1989) Science, 244, 1571-1575. MEDLINE Abstract

37 Singer,M.J., Marcotte,B.A. and Selker,E.U. (1995) Mol. Cell. Biol., 15, 5586-5597. MEDLINE Abstract

38 Wu,J.C. and Santi,D.V. (1987) J. Biol. Chem., 262, 4778-4786. MEDLINE Abstract

39 Haselkorn,R. (1992) Annu. Rev. Genet., 26, 113-130. MEDLINE Abstract


Return

* To whom correspondence should be addressed + X97409-X97412 and X98602-X98605 (incl.)
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Print PDF (103K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Florian, V
Right arrow Articles by Klein, A
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Florian, V
Right arrow Articles by Klein, A
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?