Identification of
in vivo
target RNA sequences bound by thymidylate synthase
Identification of in vivo target RNA sequences bound by thymidylate synthase
Edward
Chu*
,
Tiziana
Cogliati
,
Sitki M.
Copur
,
Aldo
Borre
,
Donna M.
Voeller
,
Carmen J.
Allegra
and
Shoshana
Segal
NCI-Navy Medical Oncology Branch, National Cancer Institute, National
Institutes of Health,
Bethesda
, MD 20889-5105,
USA
Received April 17, 1996;
Revised and Accepted June 26, 1996
ABSTRACT
We developed an immunoprecipitation-RNA-random PCR (rPCR) method to isolate cellular RNA sequences that
bind to the folate-dependent enzyme thymidylate synthase (TS). Using this approach, nine
different cellular RNAs that formed a ribonucleoprotein (RNP) complex with
thymidylate synthase (TS) in human colon cancer cells were identified. RNA
binding experiments revealed that seven of these RNAs bound TS with relatively
high affinity (IC
50
values ranging from 1.5 to 6 nM). One of the RNAs was shown to encode the
interferon (IFN)-induced 15 kDa protein. Western immunoblot analyses demonstrated that the
level of IFN-induced 15 kDa protein was significantly decreased in human colon cancer
H630-R10 cells compared with parent H630 cells. While the level of IFN-induced 15 kDa mRNA expression was the same in parent and TS-overexpressing cell lines, the level of IFN-induced 15 kDa RNA bound to TS in the form of a RNP
complex was markedly higher in H630-R10 cells relative to parent H630 cells. These studies begin to define a
number of cellular target RNA sequences with which TS interacts and suggest
that these TS protein-cellular RNA interactions may have a biological role.
INTRODUCTION
Thymidylate synthase (TS) is a folate-dependent enzyme that catalyzes the reductive methylation of 2'-deoxyuridine-5'-monophosphate by the reduced folate 5,10-methylenetetrahydrofolate to form
thymidylate (
1
). Given that the TS-catalyzed enzymatic reaction provides the sole intracellular
de novo
source of thymidylate, an essential precursor for DNA biosynthesis, this enzyme
is an important target for cancer chemotherapy (
2
,
3
).
Although its critical role in catalysis and cellular metabolism has been well
characterized, it is now appreciated that TS also functions as an RNA binding
protein (
4
,
5
). Experiments using an
in vitro
translation system (rabbit reticulocyte lysate) revealed that translation of
human TS mRNA is controlled by its own protein product via a negative
autoregulatory mechanism. The translational repression of TS mRNA is mediated
by specific binding of TS to two different
cis
-acting elements on its own mRNA. The first site is contained within the
first 188 nt of the mRNA and includes the translational start site in a
putative stem-loop structure, while the second site is located within a 200 nt sequence
in the protein coding region (
5
). Recent work has revealed that the interaction between TS and its target TS
mRNA is exquisitely sensitive to the redox state of the protein and is mediated
by a reversible but complicated sulfhydryl switch mechanism (
6
), an observation that also holds true for a number of other RNA binding
proteins (
7
-
10
).
Further evidence to support the specific interaction between TS and its own mRNA
comes from studies identifying a TS ribonucleoprotein (RNP) complex in cultured
H630 human colon cancer cells (
11
). This complex consists of TS protein bound to its own mRNA. In addition to
interacting with its own mRNA, TS forms an RNP complex both
in vivo
and
in vitro
with the mRNA of the transcription factor c-
myc
(
11
,
12
). The specific
cis
-acting sequence to which TS protein binds has been localized to the C-terminal coding region. Additional studies using the rabbit
reticulocyte translation system demonstrated that binding of TS protein to c-
myc
mRNA resulted in translational repression (
12
). These findings, taken together, suggest that TS may be involved in the
regulation of not only its own biosynthesis but also that of the unrelated c-
myc
gene.
There is now increasing evidence in the literature demonstrating the binding of regulatory proteins to various target DNA sequences (
13
-
19
). In contrast, relatively little work has been done to identify RNA sequences
that bind to cellular proteins in intact cells. Given our recent results on the
high affinity binding of the mRNAs of TS and c-
myc
to TS protein, we investigated the potential for TS, as an RNA binding protein,
to interact with other cellular RNAs. An immunoprecipitation-RNA-random PCR (RNA-rPCR) method was developed to purify human cellular RNA
sequences bound to TS from actively growing cells. This approach has led to the
identification of nine RNA sequences. The specificity of each of these RNA-TS protein interactions was investigated by cell-free RNA binding experiments and the results confirmed that seven
of the nine newly identified RNAs bind TS with relatively high affinity (IC
50
values 1.5-6 nM). These initial findings suggest that the immunoprecipitation-RNA-rPCR method can be used to identify target RNA species that
bind TS and that such an approach may begin to define those genes whose
expression may be under some regulatory control by TS.
MATERIALS AND METHODS
Cell culture
The H630 human colon cancer cell line and its 5-fluorouracil- resistant H630-R10 subline have been previously described (
11
,
20
). Cell lines were grown in 75 cm
2
plastic tissue culture flasks (Falcon Labware, Oxnard, CA) in RPMI 1640 growth medium containing 10% dialyzed fetal bovine serum and 2 mM glutamine. Dialyzed
fetal bovine serum and all other tissue culture reagents were obtained from
Gibco BRL (Grand Island, NY).
Whole cell extraction and immunoprecipitation of TS RNP complexes
Immunoprecipitation of TS RNP complexes was performed as described by Steitz (
21
,
22
). In brief, extracts from ~5 * 10
8
cells were initially pre-cleared by incubation with pre-immune serum (350 [mu]l) for 30 min on ice. The cleared extract was then incubated
with TS polyclonal antibody (350 [mu]l) for 30 min on ice to which Immunoprecipitin (150 [mu]l; Gibco BRL), 35 [mu]g yeast carrier RNA (US Biochemical, Cleveland, OH) and 30 U
inhibitase (5-Prime, 3-Prime, Boulder, CO) were added for an additional 30 min.
Immunoprecipitates were centrifuged at 14 000
g
for 3 min and then washed five times with 300 [mu]l NET-2 buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl and 0.05% v/v Nonidet P-40). After addition of 300 [mu]l NET-2 buffer, the pellets were subjected to
phenol/chloroform extraction. The supernatant containing the nucleic acid was
treated with 10 U RQ DNase (Promega, Madison, WI) for 15 min at 37oC. RNA was then extracted with phenol/chloroform (1:1), chloroform/isoamyl
alcohol (24:1) and precipitated with 2.5 vol ethanol in the presence of 0.3 M
sodium acetate (5-Prime, 3-Prime) and 20 [mu]g glycogen (Boehringer Mannheim).
Immunoprecipitated RNA was subjected to reverse transcription in a reaction (50 [mu]l) containing 50 mM Tris-HCl, pH 8.3, 10 mM DTT, 3 mM MgCl
2
, 500 [mu]M each dNTP, 1 U RNase Block I (Stratagene), 50 U StrataScript reverse
transcriptase (Stratagene) and 150 ng of either the universal primer dN6 [5'-d(GCCGCTCGAGTGCAGAATTCNNNNNN)-3'] or a modified form of universal primer dN6 [5'-d(GCCGGAATTCTGCAGAATTCNNNNNN)-3']. The reaction conditions
were as previously described by Froussard (
23
) except for the modifications as outlined below. In brief, the RT reaction was
performed at 42oC for 1 h, after which the sample was heated to 95oC for 3 min and then cooled rapidly on ice. RNase H (0.5 [mu]l; Gibco BRL) was added and the reaction mix was incubated at 37oC for 15 min. The sample was then heated to 95oC for 3 min and cooled on ice. Synthesis of the cDNA was
then performed using Klenow fragment of DNA polymerase I. After incubation at
37oC for 30 min, the sample was purified on a G-50 D-RF column (5-Prime, 3-Prime) to eliminate excess universal primer dN6.
Double-stranded cDNA was then used as template for rPCR amplification. The
reagents used were those outlined by the Perkin-Elmer protocol (Perkin-Elmer, Foster City, CA) and included 1.5 mM MgCl
2
. The total volume of the reaction was 100 [mu]l. Amplification was performed using 100 pmol of either the universal primer
5'-d(GCCGCTCGAGTGCAGAATTC)-3' or the modified universal primer 5'-d(GCCGGAATTCTGCAGAATTC)-3'. The samples were incubated
at 94oC for 1 min, 55oC for 1 min, 72oC for 3 min and amplified for 40 cycles. Following this initial
PCR step, a chase reaction was performed according to previously published
methods to ensure the synthesis of intact double-stranded cDNA (
24
). Amplified, selected cDNA products were resolved on a 1% non-denaturing agarose gel.
To verify the presence of TS, c-
myc
and IFN-induced 15 kDa sequences in the amplified selected cDNA, PCR reactions
were performed using 100 pmol of each of the following primer sets: TS-1, 5'-d(GAGCTCCCGAGACTTTTTGGACAGCC) 3' (sense), TS-2, 5'-d(AAGCTTAAGAATCCTGAGCTTTGGGA)-3'
(antisense); c-
myc
-1, 5'-d(GGCGAACACACAACGTCTTGGAG)-3' (sense), c-
myc
-2, 5'-d(GCTCAGGACATTCTGTTAGAAGG)-3' (antisense); IFN-1, 5'-d(ACC
AAGCTT
CGTCTGGCTGTCCACCCGAG)-3' (sense), IFN-2, 5'-d(ACC
AAGCTT
GATGCTCAGAGGTTCGTCGC)-3' (antisense). Reactions were incubated as previously described (
11
,
12
) at 97oC for 1 min, 62oC for 1 min, 72oC for 1 min and amplified for 40 cycles. At the end of the last
cycle, the reactions were incubated for an additional 10 min at 72oC then cooled to 4oC. PCR reactions were also performed with 30 and 35 cycles of
amplification and identical results, as observed for the 40 cycle reaction,
were obtained.
Library construction and screening
The cDNA products were purified using the Promega PCR Prep kit (Promega,
Madison, WI) and digested with
Xho
I. For construction of the plasmid library, 1-5 ng
Xho
I-digested amplified cDNA was ligated to 100 ng
Xho
I-digested, dephosphorylated pGEM-7Z plasmid (Promega) and the recombinant plasmid was used to
transform JM109 cells, which were grown overnight on ampicillin LB agar plates.
Colonies were lifted onto nitrocellulose filters (
25
) which were then hybridized to an [[alpha]-
32
P]dCTP-labeled probe representative of the cDNA used in construction of the
library (
26
). To confirm the presence of an insert in all positive clones, a colony PCR
method employing SP6 and T7 promoter primers was used (
27
).
For construction of the phage library, 1-5 ng
Eco
RI-digested amplified cDNA was ligated to 100 ng
Eco
RI-digested, dephosphoryated Uni-Zap II vector (Stratagene, La Jolla, CA) and the phage packaged
using the Gigapack II Gold packaging extract (Stratagene). Plaques were lifted
onto nitrocellulose filters (
26
) and the filters subsequently hybridized to an [[alpha]-
32
P]dCTP- labeled c-
myc
fragment corresponding to the protein coding region or to an [[alpha]-
32
P]dCTP-labeled full-length TS cDNA (
26
). To confirm the presence of insert-containing phages, a colony PCR assay (
27
) was employed.
Plasmid preparation and
in vitro
mRNA transcription
Double-stranded DNA prepared from positive clones was sequenced by the fmol DNA
sequencing system (Promega) using either the T7 or the SP6 promoter primer. DNA
from selected clones was linearized with either
Hin
dIII or
Xba
I and transcribed
in vitro
with T7 RNA polymerase or with SP6 RNA polymerase to generate the corresponding
mRNA transcript. All
in vitro
transcription reactions were performed as previously described (
4
,
5
,
28
). Labeled RNAs were synthesized by inclusion of [[alpha]-
32
P]CTP at 200 Ci/mmol in the reaction mixture. RNA products were analyzed on 1%
agarose-formaldehyde gel to verify their integrity and size. The concentration of
unlabeled RNA was determined by measuring UV absorbance at 260 nm, while the
concentration of radioactively labeled RNAs was determined by the specific
activity.
RNA-protein binding assay
RNA electrophoretic gel mobility shift assays (EMSAs) were performed as
previously described (
4
,
5
,
28
). In brief, radiolabeled RNAs (2 fmol, 100 000 c.p.m.) were incubated with TS
protein (3 pmol) for 15 min at room temperature in a reaction mixture
containing 10 mM HEPES, pH 7.4, 40 mM KCl, 3 mM MgCl
2
, 3 U inhibitase (5-Prime, 3-Prime), 250 mM 2-mercaptoethanol and 5% glycerol. RNase T1 (12 U; 5-Prime, 3-Prime) was then added for 10 min followed by 5
mg/ml heparin (Sigma, St Louis, MO) for an additional 10 min at room
temperature. The entire reaction mix (total volume 30 [mu]l) was resolved on a 4% non-denaturing polyacrylamide gel (acrylamide/methylenebisacrylamide 60:1)
for ~40 min at 500 V. The gel was dried and the bands visualized by
autoradiography.
Competition experiments were performed with blue-dye Sepharose-purified human recombinant TS protein (3 pmol, specific activity
0.05 U/mg) (
4
) and radiolabeled TS mRNA (2 fmol, 100 000 c.p.m.). These conditions were
selected on the basis of control experiments using a fixed amount of
radiolabeled RNA probe with increasing TS protein concentration to determine
the linearity of protein binding. Unlabeled competitor RNAs were mixed with
radiolabeled TS mRNA probe prior to addition of TS protein. The relative
binding affinity (IC
50
) of each selected RNA was established by determining the concentration at which
unlabeled RNA inhibits specific binding of radiolabeled TS mRNA by 50%. Each
RNA competition experiment was performed three to four times. Quantitation by
densitometry was done using a ScanJet Plus scanner (Hewlett Packard) and the
results analyzed by the NIH Image 1.36 software (Wayne Rasband, National
Institute of Mental Health, Bethesda, MD).
Western immunoblot analysis
H630 cells were harvested and processed as previously described (
29
). Protein concentrations were determined by the BioRad protein assay and
equivalent amounts of protein (250 [mu]g) from each cell line were resolved by 15% SDS-PAGE according to the method of Laemmli (
30
). The gels were then electroblotted onto Schleicher & Schuell nitrocellulose membranes. Primary antibody staining was performed by
incubating filter membranes (overnight at 4oC) with either an anti-TS monoclonal antibody (1/100 dilution) (
20
) or an anti-ubiquitin cross-reactive protein (URCP) polyclonal antibody (10 [mu]g/ml) (
31
) that recognizes the interferon (IFN)-induced 15 kDa protein. The membranes were subsequently incubated with
horseradish peroxidase-conjugated secondary antibody (1/500 dilution; BioRad) for an additional 2
h (room temperature) and processed by the ECL chemiluminescent method (Amersham
Life Science, Little Chalfont, UK). Protein bands were visualized by
autoradiography.
Isolation and analysis of total RNA
H630 cells were harvested and total RNA was isolated according to methods
previously described (
29
). After extraction, an aliquot of 25 [mu]g total cellular RNA was denatured, resolved on 1% formaldehyde-agarose gel and transferred onto a Nytran filter membrane. The
membrane was hybridized to an [[alpha]-
32
P]dCTP-labeled DNA insert encoding the IFN-induced 15 kDa protein. The membrane was then processed as
previously described (
29
).
RESULTS AND DISCUSSION
While the characterization of DNA-protein interactions by means of immunopurification of DNA-protein complexes has been well described (
15
-
19
), significantly less work has been done to isolate RNA-protein complexes either
in vitro
or
in vivo
. Previous studies by Steitz and colleagues employed an immunoprecipitation
method to isolate small nuclear RNAs (snRNAs) (
21
,
22
). Using this same technique, we attempted to identify TS RNP complexes from
human colon cancer cells. However, these initial efforts were unsuccessful,
presumably due to the relatively low level of expression of TS mRNA, ~1000 molecules/cell, when compared with the relatively high level of
expression of the various snRNAs, ~10
5
-10
6
molecules/cell.
ACKNOWLEDGEMENTS
The authors thank Drs Bruce Chabner, Frank Maley and Gladys Maley for their
insightful and helpful discussions and Janet Edds for her editorial assistance
in the preparation of this manuscript.
REFERENCES
1 Friedkin,M. and KornbergA. (1957) In McElroy,W.D. and Glass,B. (eds), Chemical Basis of Heredity. Johns Hopkins Press, Baltimore, MD, pp. 609-614.
2 Santi,D.V. and Danenberg, P.V. (1984) In Blakely,R.L. and Benkovic,S.J. (eds), Folates and Pteridines. Wiley, New York, NY, Vol. 1, pp. 345-398.
*
To whom correspondence should be addressed at present address: VA Connecticut
Healthcare System, Comprehensive Cancer Center, 950 Campbell Avenue, West
Haven, CT 06516, USA
