Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (58K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Keese, P
Right arrow Articles by Graf, L
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Keese, P
Right arrow Articles by Graf, L
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 1996 Oxford University Press 3474-3475

Footnote

A positive screen for cloning PCR products

A positive screen for cloning PCR products Paul Keese* and Lynda Graf

CSIRO, Division of Plant Industry, GPO Box 1600, Canberra , ACT 2601, Australia

Received May 27, 1996; Revised and Accepted July 23, 1996

ABSTRACT

We have developed a positive screen for cloning PCR products based on translational activation of lac Z. A vector with a translationally deficient lac Z [alpha] gene has been made by deletion of the Shine-Dalgarno sequence and initiation codon. The Shine-Dalgarno sequence and initiation codon are incorporated into one of the PCR primers to allow complementation by the PCR product of the inactive lac Z [alpha] gene, which results in blue transformed bacterial colonies. This screen allows more efficient detection of clones containing inserts made by PCR.


Most general purpose plasmid vectors use a blue to white screen for detecting inserts. A polylinker is placed between the initiation codon and about codon seven of lacZ [alpha]. In the presence of the inducer isopropyl-[beta]-d-galactopyranoside (IPTG) and substrate X-gal, [beta]-galactosidase activity is observed in the form of blue bacterial colonies. The insertion of a PCR product into the polylinker usually disrupts translation of lacZ [alpha] which results in the failure of transformed bacteria to turn blue. However, a lack of [beta]-galactosidase activity may also be due to other factors, such as the deletion of lacZ [alpha]. In addition, some inserts do not prevent translation of lacZ [alpha] due to maintenance of the lacZ [alpha] open reading frame, or by allowing translation reinitiation ( 1 , 2 ) in frame with lacZ [alpha], thus giving rise to false negative blue colonies.

To improve the efficiency of identifying clones with inserts, we have developed a positive, white to blue, screen. A Shine-Dalgarno (SD) sequence and an ATG initiation codon are incorporated into one of the PCR primer sequences to allow complementation by the PCR product of a translationally silent lacZ [alpha] gene in the vector. Two vectors were made by deletion of the lacZ [alpha] SD sequence and initiation codon using inverse PCR mutagenesis of pGEM3Zf(+) (Promega) and pJKKmf(-) ( 3 ) with the primers 5'-ACCATC GGATCC GATATCTCGAATTCGCCCTATAGTGA -3' and 5'-CACTAC GGATCC AAGCTTGTGTGAAATTGTTATCCGCT -3' (the restriction site is bold and the hybridizing sequence underlined). Inverse PCR amplification of plasmid DNA was done according to the protocols provided with the Perkin-Elmer XL-PCR kit. The resultant DNA products were cut with Bam HI, self-ligated, and electroporated into competent Escherichia coli JM109 cells. The transformed cells were plated in the presence of 8 [mu]l 0.1 M IPTG and 32 [mu]l 4% X-gal. Plasmid DNA was isolated from white colonies and the sequence changes were confirmed by dideoxyribonucleotide chain termination sequencing. The resultant vectors, pKG1 and pKG2, retain the lac promoter sequence and the functional amino-terminal sequence encoded by lacZ [alpha], but lack an ATG initiation codon (Fig. 1 ). A small polylinker with four restriction sites ( Hin dIII, Bam HI, Eco RV and Eco RI) was included for cloning PCR products.


Figure 1 . Nucleotide sequence of the modified polylinker region of pKG1 and pKG2. The -35 and -10 regions of the lac promoter are double underlined; the site of transcription initiation is a filled circle; the primer sequence used for sequencing inserts is overlined. The T7 RNA promoter (underlined) allows RNA transcription of inserts within the polylinker, but the SP6 promoter has been deleted.

Detection of inserts cloned into pKG1 and pKG2 is based on translational activation of the lacZ [alpha] open reading frame. This is done by cloning a DNA fragment with a 3' terminal SD-ATG sequence in frame with lacZ [alpha]. For example, one SD-ATG sequence of 14 nucleotides (corresponding to the native lacZ SD-ATG region) is added as its complement to the 5' end of one of the PCR primers (Fig. 2 ). When a resultant PCR product is cloned into pKG1 or pKG2 in the correct orientation (Fig. 2 B), RNA transcripts expressed from the lac promoter, or a chance promoter within the insert, will contain insert sequence at the 5' end and the SD-ATG sequence proximal to lacZ [alpha] at the 3' end. Translation initiation ( 1 , 2 ) at the ATG codon adjacent and in frame with lacZ [alpha] results in [beta]-galactosidase activity and blue colonies. If the insert is in the opposite orientation, then it will mostly give rise to white colonies, the same as the parental vector.


Figure 2 . Design of PCR primers to restore translation initiation of lacZ [alpha] by insertion of the PCR product into the polylinker of either pKG1 or pKG2. ( A) The primer P2a has the sequence 5'-CATAGCTGTTTCCT-3' (complementary to the SD-ATG region of lacZ ) added 5' of the hybridizing sequence represented by Xs. For blunt-end ligation into the Eco RV site additional sequences are not strictly required. For insertion into cloning sites with staggered ends a restriction site is also included in the primer sequence, together with a 5' extension of arbitrary size and sequence, depicted as Ns, to assist with efficient cutting of the PCR product. Unlike primers with the restriction sites Bam HI (P2b) and Hin dIII (P2c), the primer with an Eco RI restriction site (P2d) has the Eco RI sequence overlapping the G nucleotide of the ATG initiation codon, to ensure that the ATG is in frame with lacZ [alpha]. ( B ) Schematic representation of a PCR product (bold) ligated into the Eco RV site in the appropriate orientation such that RNA transcripts will have a SD-ATG sequence (complementary to the 5' end of P2a) adjacent and in frame with lacZ [alpha].

We have used this new method to clone three different PCR products (Fig. 3 ). PCR product A was made using Vent DNA polymerase to ensure flush ends and then cloned by blunt-end ligation into the Eco RV site of pKG1. The sequence and orientation of the insert was confirmed by sequencing the clone with the M13 forward primer and a primer 5'-TATGCTTCCGGCTCGTATGT-3' which corresponds to part of the lac promoter sequence (Fig. 1 ). The M13 reverse primer sequence was deleted during construction of pKG1 and pKG2, because it includes the lacZ [alpha] initiation codon. PCR products B and C were cut with Bam HI and ligated into the Bam HI site of either pKG1 or pKG2. Although blue colour development occurred overnight for transformation of all three PCR products ligated into pKG1, colour production was slower for clones with an insert in pKG2 which has a kanamycin selectable marker.


Figure 3 . Three PCR products made using the Perkin-Elmer XL-PCR kit were cloned into pKG1 or pKG2. PCR product A of 623 bp was made by amplification of a gene from the violacein gene cluster (4; D. Quiggin, L.G. and P.K., unpublished data) using the primers 5'-ACTCAC GGATCC GAGGAGGCCGCATGGAAAAC -3' and 5'-AGCAAT GGATCC CATAGCTGTTTCCT AGCGCTTGGCGGCGAAGA -3' (the sequence complementary to the SD-ATG region is in italics). The DNA was blunt-end ligated into the 5' phosphorylated Eco RV site of pKG1 and transformed into E.coli JM109. Plasmid DNA was isolated from two independent blue colonies and the insert excised with Bam HI (A1 and A2). PCR products B and C (507 and 630 bp, respectively) correspond to the coding and non-coding regions of component 4 of subterranean clover stunt virus (5) and were made using the pairs of PCR primers 5'-CACACGCGT GGATCC CATAGCTGTTTCCT AATGGCGGACTGGTTTCACAG -3', 5'-ACTACGCGT GGATCC TTACACCTTAATACGCATCGTATG -3' and 5'-ACTACGCGT GGATCC AGTTCATACGATGCGTATTAAGGT -3', 5'- CACACGCGT GGATCC CATAGCTGTTTCCT GTGAAACCAGTCCGCCATT -3'. The DNA was cut with Bam HI and ligated into the 5' phosphorylated Bam HI site of either pKG1 or 2. Plasmid DNA was isolated from independent blue colonies and the inserts excised with Bam HI (B1, B2 and C1-C4). Samples were run on a 1.2% agarose, 40 mM Tris-HCl, pH 8.3, 40 mM boric acid, 1 mM EDTA gel and stained with ethidium bromide. The size markers are SPPI DNA cut with Eco RI (Bresatec).

More than 30 blue colonies were obtained from each transformation described in Figure 3 and six blue colonies were screened for inserts in each case. Only PCR product B produced two clones that failed to contain the correct insert. This is probably due to the lack of purification of the desired product after PCR. Sequencing of incorrect inserts has revealed primer dimers and trimers (results not shown).

In conclusion, this cloning strategy provides a positive screen because the gain of [beta]-galactosidase activity (and thus blue colonies) specifically depends upon the insertion of an SD sequence and initiation codon in frame with a deficient lacZ [alpha] gene in the vector. Consequently, we have found that fewer colonies need to be assessed for inserts, and that rare cloning events are more reliably detected. Moreover, this method provides for automatic determination of insert orientation.

Other features of this positive screen include easy detection of blue colonies against a background of many white colonies when the vector has not been dephosphorylated; positive identification of inserts that fail to disrupt translation of the lac Z gene in blue to white vectors; and the opportunity to monitor clones with unstable inserts. This screen could also be readily adapted for cDNA cloning using plasmid or [lambda] based vectors.

REFERENCES

1 Steege,D.A. (1977) Proc. Natl. Acad. Sci. USA, 74, 4163-4167. MEDLINE Abstract

2 Das,A. and Yanofsky,C. (1984) Nucleic Acids Res., 12, 4757-4768. MEDLINE Abstract

3 Kirschman,J.A. and Cramer,J.H. (1988) Gene, 68, 163-165. MEDLINE Abstract

4 Pemberton,J.M., Vincent,K.M. and Penfold,R.J. (1991) Curr. Microbiol., 22, 355-358.

5 Boevink,P., Chu,P.W.G. and Keese,P. (1995) Virology, 207, 354-361. MEDLINE Abstract

Return

* To whom correspondence should be addressed
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Print PDF (58K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Keese, P
Right arrow Articles by Graf, L
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Keese, P
Right arrow Articles by Graf, L
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?