Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (90K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Sears, L.
Right arrow Articles by Kong, H
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sears, L.
Right arrow Articles by Kong, H
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 1996 Oxford University Press 3590-3592

Footnote

Bae I, another unusual Bcg I-like restriction endonuclease

Bae I, another unusual Bcg I-like restriction endonuclease Lauren E. Sears , Bing Zhou , Jason M. Aliotta , Richard D. Morgan and Huimin Kong*

New England Biolabs, Inc., 32 Tozer Road, Beverly , MA 01915, USA

Received May 13, 1996; Revised and Accepted August 5, 1996

ABSTRACT

Bcg I and Bcg I-like restriction endonucleases have a very distinct characteristic which causes them to differ from the other classified restriction enzymes; they all cleave double-stranded DNA specifically on both sides of the recognition sequence to excise a short DNA fragment including the recognition sites. Here we report a new Bcg I-like restriction endonuclease, Bae I, isolated from Bacillus sphaericus . Like Bcg I, Bae I also cleaves double-stranded DNA on both strands upstream and downstream of its recognition sequence (10/15)ACNNNNGTAYC(12/7). There are two dominant polypeptides in the final preparation of Bae I with molecular masses of ~ 80 and 55 kDa. Both are slightly larger than the two Bcg I subunits. Bae I requires both Mg 2+ and AdoMet to cleave DNA. Accompanying bilateral cleavage activity, the heteromeric Bae I also has an N 6-adenine methyltransferase activity which modifies the symmetrically located adenines within its recognition sequence.


More than 2700 restriction endonucleases have been isolated from bacterial sources and most of them can be grouped into three classes based on subunit composition, cofactor requirements and the type of DNA cleavage ( 6 , 10 ). Increasing numbers of restriction endonucleases that do not fit into the conventional classification have been reported. Among these, one family of restriction endonucleases is unique in that they all cleave double-stranded DNA on both sides of their recognition sequences to excise a short fragment containing the recognition site. Typically they require Mg 2+ and S -adenosylmethionine for cleavage. Four examples of this new type of restriction enzyme have been documented: Bcg I ( 3 ), Bsp 24I ( 1 ), Cje I and Cje PI ( 9 ). The genes coding for Bcg I have been cloned and sequenced ( 4 ). The Bcg IA gene codes for a 71.6 kDa protein that resembles certain m 6 A-specific DNA-methyltransferases. The Bcg IB gene codes for a 39.2 kDa protein. Neither protein can cleave or modify DNA by itself, but together they form a complex of composition of A 2 B that can do both ( 4 ).

Here we report a new Bcg I-like restriction endonuclease, Bae I, isolated from Bacillus sphaericus , NEB 659. The yield of this enzyme was at least 3200 U/g of cells in the crude cell extract. The Bae I protein has been purified to near-homogeneity by phosphocellulose, heparin sepharose, Mono-Q (Pharmacia) and Heparin Tsk (Toso Haas) column chromatography. There are two dominant polypeptides in the final preparation of Bae I with molecular masses of ~80 and 55 kDa (Fig. 1 A). Thus both the Bae I and Bcg I enzymes contain two protein subunits, however they differ in the sizes of these subunits.


Figure 1 . ( A ) Coomassie-stained 10-20% gradient SDS-PAGE of purified Bae I endonuclease (lane 1) with Bcg I as a control (lane 2). ( B ) 1% agarose gel showing the electrophoresis patterns of Bae I digested DNA. Lane 1, lambda DNA + Hin dIII, [Phi]174 + Hae III, size standard; lane 2, lambda DNA + Bae I; lane 3, adenovirus 2 DNA + Bae I. ( C ) Electrophoresis pattern of Bae I digested lambda DNA on a 3 % agarose gel (NuSieve, FMC). Lane 1, pBR322 + Msp I, size standard; lane 2, lambda DNA + Bae I. Arrow indicates the 33 bp fragment.

Like Bcg I, Bae I requires both Mg 2+ and S -adenosylmethionine for cleavage. S -adenosyl-l-homocysteine can also replace S -adenosylmethionine as a cleavage cofactor in Bae I digestion. In the case of Bcg I, S -adenosyl-l-homocysteine is unable to stimulate its cleavage activity ( 3 ). Complete digestion of lambda DNA and adenovirus 2 DNA was achieved by Bae I and resulted in 10 and five bands respectively (Fig. 1 B). Analysis of these DNA banding patterns resulting from Bae I-cleavage suggests that the enzyme recognizes the asymmetric non-contiguous sequence: 5'-ACNNNNGTAYC-3', or 5'-GRTACNNNNGT-3' on the complementary strand (Y: pyrimidine, R: purine). The cleavage site of Bae I was determined by comparing dideoxy sequencing ladders with polymerized extension products cleaved with Bae I as detailed previously ( 2 , 3 , 5 ). Two prominent DNA bands were observed following digestion with Bae I (Fig. 2 , lane -): one positioned 11 bases before the recognition sequence, and another positioned 12 bases following it. The lane marked + in Figure 2 shows the result of treating the - lane products with the Klenow fragment of Escherichia coli DNA polymerase I. Both fragments were reduced by 5 nt, suggesting that Bae I makes a double-strand cleavage on both sides of its recognition sequence to produce two five-base 3' extensions. To verify that cleavage occurs on both sides of the recognition sequence, lambda DNA was digested with Bae I and then loaded to a 3% agarose gel. The expected 33 base pair (bp) fragments were observed (Fig. 1 C). We conclude that Bae I cleaves double-stranded DNA on both strands upstream and downstream of its recognition sequence (10/15)ACNNNNGTAYC(12/7).


Figure 2 . The cleavage site of Bae I. Plasmid DNA that contains a Bae I recognition sequence and a synthetic primer were used in a sequencing reaction based upon the dideoxynucleotide chain termination method. An additional extension reaction was carried out in the presence of four deoxynucleotides and [ 33 P]dATP containing the same plasmid and primer. The labeled substrate was then digested with Bae I. After incubation at 65oC for 15 min to inactivate Bae I, the reaction mixture was divided into two aliquots: one was mixed with stop solution immediately (lane -); the other was treated with Klenow fragment at room temperature for 10 min and then mixed with stop solution (lane +). The two Bae I cleavage reaction products were loaded on an 8% denatured polyacrylamide gel along with standard G, C, A and T ladders.

The cleavage patterns of all five Bcg I-like enzymes are shown in Figure 3 . They all share the following properties: (i) they all produce 3' overhangs; (ii) their cleavage sites (indicated by arrows) are all located symmetrically; (iii) they all contain a pair of adenines (in bold type) which is located symmetrically relative to the center of the double-stranded duplex that is being cleaved. Indeed the pair of adenines in the Bcg I recognition sequence is the target site for methylation ( 3 , 4 ). Thus, it is reasonable to speculate that the symmetrically located adenines are the possible methylation target sites for all Bcg I-like enzymes, based on the presence and location of the two common adenines.


Figure 3 . All five Bcg I-like enzymes contain a pair of adenines (in bold type) which are located symmetrically relative to the center of the double-stranded duplex that is being cleaved. The cleavage sites are indicated by arrows.

To test this hypothesis, the target base of Bae I methylation was determined by in vitro methylation of a DNA duplex containing a Bae I site with this enzyme and [ 3 H]AdoMet. The duplex DNA was degraded to mononucleotides, separated by thin-layer chromatography and visualized by unlabelled methyldeoxynucleotides which were added to the reaction ( 5 ). The m 6 A, m 5 C and m 4 C spots were counted for radioactivity, >95% of the radioactivity co-migrated with m 6 A (Table 1 ), indicating that N 6-methyladenine is the sole product of Bae I methylation.

Table 1 . Identification of the nucleosides methylated by Bae I

Solvent G

Solvent D

m 6 A

m 5 C + m 4 C

m 6 A + m 4 C

m 5 C

3H Incorporation a

185

28

192

24

Purified Bae I enzyme complex was incubated with [ 3 H]AdoMet and an unmodified duplex containing a Bae I site (Fig. 4). Following methylation, the duplex was digested to mononucleosides, mixed with unlabelled methyldeoxynucleosides, and separated by thin-layer chromatography. Two different solvents were used to distinguish all possible methylated bases. Solvent G is 66:33:1 isobutyric acid:water:ammonium hydroxide (v/v); solvent D is 80:20 ethanol:water (v/v). The methylated deoxynucleosides are m 4 C: N 4-methylcytosine; m 5 C: 5-methylcytosine; m 6 A: N 6-methyladenine. a Counts per minute. Raw data; background counts of 24 c.p.m. have not been subtracted.

There are three adenines within the Bae I recognition sequence of the duplex used in this assay: two on the top strand (A21 and A29) and one on the bottom strand (A20) (Fig. 4 ). To distinguish which adenines are methylated by Bae I, three more oligonucleotides were made (in addition to the two unmodified oligonucleotides), containing a N 6-methyladenine at each potential position, so that different combinations of hemi-methylated duplex substrates can be produced as shown in Figure 4 .


Figure 4 . The methylation and cleavage activities of Bae I enzyme on various duplex DNA substrates. Complementary single-stranded oligodeoxynucleotides (CCGCCAGGCAAAGGCCGTTA AC CATG GTATC GTTTACGGAATTAGCGATTAC and CGCTAATTCCGTAAAC GATAC CATG GT TAACGGCCTTTGCCTGGCGG) were annealed by heating to 93oC for 3 min and then slowly cooling to 25oC. The DNA duplexes are presented schematically with only the Bae I recognition sequence being shown in the figure. The numbers indicate the positions of underlined adenines from 5'-ends. Y, pyrimidine; R, purine. The three adenines within the Bae I recognition sequence were methylated each at a time in some duplexes, as indicated by `-CH 3 '. DNA methylation activities on different substrates were determined by incubating annealed duplex with Bae I is the presence of [ 3 H]AdoMet, 10 mM Tris-HCl (pH 8.0), 5 mM Na 2 EDTA and 1 mM DTT. Acid-insoluble radioactivity was quantified by liquid scintillation counting. All DNA duplexes were incubated with Bae I in separate reactions in the presence of Mg 2+ . The digestion products were visualized on 4% agarose gel.

Bcg I and its closest relative, the type I methyltransferases, are maintenance methyltransferases which highly prefer hemi-methylated DNA substrate for methylation (unpublished observation on Bcg I; 8 ). Indeed Bae I shares this characteristic of maintenance methylases based on the following observations. First, the Bae I was only able to methylate 1.1% of the potential sites on the unmodified substrate which was sensitive to Bae I endonuclease in the presence of Mg 2+ (Fig. 4 , line 1). Second, the methylation of adenine 20 on the bottom strand of the hemi-methylated duplex not only increases Bae I methylation activity by 30-fold, but also makes it resistant to the Bae I endonuclease digestion (line 3). The methylations of the two adenines on the top strand have different effects: methylation on adenine 21 results a hemi-methylated duplex which is a preferred substrate for Bae I methylation (13-fold increase) and is insensitive to Bae I digestion (line 4); while methylation of adenine 29 on top strand generates a false hemi-methylated substrate which behaves just like the unmodified one (line 5 versus line 1), indicating adenine 21 on the top strand is the appropriate methylation target site not adenine 29. Finally, the lack of Bae I methylation activity on the DNA substrate with methylated adenine 21 on the top strand and methylated adenine 20 on the bottom shows that Bae I cannot transfer any methyl group to the substrate from AdoMet when these two proposed target sites are fully methylated. These results support our speculation: the symmetrically located adenines existing in all Bcg I-like enzymes are the possible target bases for DNA methylation.

ACKNOWLEDGEMENTS

The authors would like to thank Drs Richard Roberts, Ira Schildkraut, Charles Cantor and Cassandra Smith for critical reading of this manuscript, and Dr Peter Barrett for communicating his unpublished observation regarding the Bae I cleavage site.

REFERENCES

1 Degtyarev,S.K., Rechkunova,N.I., Zernov,U.P., Dedkov,V.S., Chizikov,V.E., Calligan,M.V., Williams,R. and Murray,E. (1993) Gene 131, 93-95. MEDLINE Abstract

2 Friedman,S. (1986) Nucleic Acids Res. 14, 4543-4556.

3 Kong,H., Morgan,R.D., Maunus,R.E. and Schildkraut,I. (1993) Nucleic Acids Res. 21, 987-991.

4 Kong,H., Roemer,S.E., Waite-Rees,P.A., Benner,J.S., Wilson,G.G. and Nwankwo,D.O. (1994) J. Biol. Chem. 269, 683-690. MEDLINE Abstract

5 Landry,D., Looney,M.C., Feehery,G.R., Slatko,B.E., Jack,W.E., Schildkraut,I. and Wilson,G.G. (1989) Gene 77, 1-10.

6 Roberts,R.J. and Macelis,D. (1996) Nucleic Acids Res. 23, 223-235.

7 Sanger,F. , Nicklen,S. and Coulson,A.R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. MEDLINE Abstract

8 Suri,B., Nagaraja,V. and Bickle,T.A. (1984) Curr. Top. Microbiol. Immunol. 108, 1-9.

9 Vitor,J.M.B. and Morgan,R.D. (1995) Gene 157, 109-110.

10 Yuan,R. (1981) Annu. Rev. Biochem. 50, 285-315. MEDLINE Abstract


Return

* To whom correspondence should be addressed
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
MicrobiologyHome page
R. M. Dempsey, D. Carroll, H. Kong, L. Higgins, C. T. Keane, and D. C. Coleman
Sau42I, a BcgI-like restriction-modification system encoded by the Staphylococcus aureus quadruple-converting phage {pi}42
Microbiology, April 1, 2005; 151(4): 1301 - 1311.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
P. M. Skowron, J. Majewski, A. Zylicz-Stachula, S. M. Rutkowska, I. Jaworowska, and R. I. Harasimowicz-Slowinska
A new Thermus sp. class-IIS enzyme sub-family: isolation of a 'twin' endonuclease TspDTI with a novel specificity 5'-ATGAA(N11/9)-3', related to TspGWI, TaqII and Tth111II
Nucleic Acids Res., July 15, 2003; 31(14): e74 - e74.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (90K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Sears, L.
Right arrow Articles by Kong, H
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sears, L.
Right arrow Articles by Kong, H
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?