Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (125K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Kang, H
Right arrow Articles by Rokita, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kang, H
Right arrow Articles by Rokita, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 1995 Oxford University Press 3896-3902

Footnote

Site-specific and photo-induced alkylation of DNA by a dimethylanthraquinone-oligodeoxynucleotide conjugate

Site-specific and photo-induced alkylation of DNA by a dimethylanthraquinone-oligodeoxynucleotide conjugate Hyunmin Kang + and Steven E. Rokita*

Department of Chemistry, State University of New York at Stony Brook, Stony Brook , NY 11794, USA

Received July 29, 1996; Accepted August 22, 1996

ABSTRACT

A dialkyl-substituted anthraquinone derivative was synthesized and ligated to a sequence-directing oligodeoxynucleotide to examine its efficiency and specificity for cross-linking to complementary sequences of DNA. The anthraquinone appendage stabilized spontaneous hybridization of the target and probe sequences through non-covalent interactions, as indicated by thermal denaturation studies. Covalent modification of the target was induced by exposure to near UV light ([lambda] > 335 nm) to generate cross-linked duplexes in yields as great as 45%. Reaction was dependent on the first unpaired nucleotide extended beyond the duplex formed by association of the target and probe. A specificity of C > T > A [approx] G was determined for modification at this position. The overall site and nucleotide selectivity seems to originate from the chemical requirements of cross-linking and does not likely reflect the dominant solution structure of the complex prior to irradiation.

INTRODUCTION

Therapeutic intervention at the level of nucleic acids holds considerable promise, but technical challenges remain. Application of antisense and antigene strategies have been limited in vivo , for example by problems with delivery and stability of the necessary nucleic acid derivatives ( 1 - 5 ). The challenges associated with stability alone are numerous and range from concerns of metabolic lifetime to target affinity and reversibility of target association. Many significant advances have relied on modification of a reagent's oligonucleotide backbone, even though the resulting derivative often exhibits weaker binding to its target sequence. However, affinity can usually be regained and metabolic stability further enhanced by appending an intercalator or alkylating agent to a terminus of the oligomer ( 6 ). Psoralen has been used widely in this manner, since it can covalently cross-link single- and double-stranded nucleic acids upon exposure to near UV light ( 7 - 10 ). Our research has focused on a series of related reagents that similarly express an inducible ability to alkylate nucleic acids. In each case, highly reactive quinone methide intermediates have been generated under alternative control of light ( 11 , 12 ), enzymatic reduction ( 12 , 13 ), anion concentration ( 14 ) and the biological target itself ( 15 ). Much of our initial effort relied on a series of naphthoquinone derivatives; but due to their general instability, target modification was inefficient ( 11 - 13 ). This report now describes the synthesis and characterization of an anthraquinone derivative that exhibits superior properties as an affinity reagent and retains a potential for application in vivo .

Anthraquinone derivatives have long been associated with nucleic acid binding and cancer chemotherapy. The activity of many natural and synthetic anthracycline antibiotics is derived from their anthraquinone component ( 16 ). Numerous bis(aminoalkyl) anthraquinones have also been prepared as anticancer agents based on their strength as intercalators ( 17 - 19 ) and this binding property has since been used to promote platinum-DNA reaction through construction of anthraquinone-cisplatin conjugates ( 20 ). Anthraquinone derivatives have similarly been coupled to antisense and antigene reagents in order to strengthen their association with target DNA, as well as to enhance their cellular uptake and decrease their sensitivity to nucleases ( 21 - 27 ).

The oxidation-reduction and photochemical activity of anthraquinones offer additional opportunities for target recognition and modification. Bis(aminoalkyl)anthraquinones act as photosensitizers to generate singlet oxygen and may find use in photodynamic therapy ( 28 ). Other anthraquinones are capable of photochemically oxidizing DNA by electron transfer and hydrogen atom abstraction ( 29 - 31 ). Finally, 1-methylanthraquinone readily photoenolizes to form a transient quinone methide ( 32 ) in an equivalent manner to the naphthoquinone derivatives previously applied to site-directed modification of DNA ( 11 - 13 ). The appropriate anthraquinone-oligodeoxynucleotide conjugate thus has the potential to stabilize target hybridization and inducibly modify adjacent nucleotide residues via a number of alternative pathways. Our studies began with the photochemical activity of a dialkyl-substituted anthraquinone.


Scheme 1 Synthesis of the 1,4-dimethylanthraquinine-oligodeoxynucleotide conjugate OAQ . (a) Rh(PPh 3 ) 3 Cl, (b) 5-acetoxy-1-pentyne, (c) aqueous MeOH, K 2 CO 3 , (d) PDC, (e) N -hydroxysuccinimide, CDI, (f) heyxamethylene amino linker 5"-modified oligodeoxynucleotide.


Scheme 2 Oligodeoxynucleotdides used to determine the reaction specificity of OAQ .


RESULTS AND DISCUSSION

Design and synthesis of a photoactive anthraquinone derivative for coupling to an aminolinker (6)


Figure 1 . Target alkylation induced by irradiation ([lambda] > 335 nm). ( A ) Duplex formed by OAQ + OT1 (2.2 [mu]M) was irradiated for 0 (lane 1), 30 (lane 2), 60 (lane 3) or 120 min (lane 4). Interstrand cross-linking (XL) was detected by denaturing gel electrophoresis and autoradiography. ( B ) Formation of the alkylated product from (A) and equivalent reactions between OAQ and the other sequences OT2 - OT5 were quantified by gel excision and scintillation counting and yields determined relative to product + starting material. Lines were drawn as visual aids only and have no theoretical significance.


Our general goal was to develop a simple hydrophobic compound that could be easily manipulated, modified and coupled to site-directing reagents. The minimal criteria for our first analog was: (i) placement of an alkyl substituent in a position [beta] to one of the carbonyls, thus allowing photoenolization; (ii) attachment of a linker arm that would not inhibit this process. Additional alkyl groups at the remaining [beta] positions might likely support sequential cycles of photoenolization and target alkylation and hence a second alkyl group was included for future studies on triplex modification. This initial report focuses on a 1,4-dimethyl derivative that was conveniently prepared through a cyclization promoted by Wilkinson's catalyst ( 33 ; Scheme 1 ). The starting material 1 was prepared according to published procedures in excellent yield (87%), but its complexation with freshly prepared tris(triphenylphosphine)rhodium(I) chloride occurred in poor yield (15%). When a commercial rhodium complex was tested instead, no product was detected. The anthraquinone ring system was completed and the linker arm was formed by addition of 5-acetoxy-1-pentyne to 2 . The acetate protecting group was hydrolyzed nearly quantitatively by potassium carbonate in methanol and the resulting product alcohol was oxidized with pyridium dichromate (PDC). Finally, the carboxylic acid 5 was activated for oligodeoxynucleotide coupling by preparing its N -hydroxysuccinimide ester 6 with ethyl-3-[3-(dimethylamino) propyl]carbodiimide (CDI) in good yield (75%).

Oligodeoxynucleotide preparation and coupling to form the anthraquinone conjugate OAQ

All oligodeoxynucleotides, including the aminolinker-containing derivative, were synthesized using standard solid phase automated procedures. Coupling between hydrophobic activated esters and hydrophilic DNA remains one of the more difficult tasks in preparing sequence-directed reagents. Our laboratory has consistently had greatest success by mixing equal volumes of DNA dissolved in 0.25 M 3-( N -morpholino)propane sulfonate (MOPS), pH 7.5, and the activated ester dissolved in dimethylformamide (DMF). After incubation at room temperature, the coupled product was purified by reverse-phase chromatrography in a standard yield of 34%.

Anthraquinone stabilizes duplex hybridization

Numerous past reports have characterized the strong tendency for anthraquinone derivatives to intercalate into duplex DNA (see for example 16 - 27 ) and therefore a similar interaction was expected for the duplexes formed by the dimethylanthraquinone-oligodeoxynucleotide conjugate and its complementary target. This non-covalent binding was characterized by an increase in the thermal melting temperature ( T m ) of duplex DNA in the presence of the quinone (Table 1 ). Even the unligated dimethylanthraquinone stabilized duplex formation, as demonstrated by its ability to raise the duplex T m by 7oC. Further stabilization was gained by covalently attaching the anthraquinone to one DNA strand. Related naphthoquinone conjugates did not exhibit this activity and covalent attachment of a naphthoquinone had no effect on duplex hybridization ( 12 ). Interestingly, psoralen intercalates into duplex DNA, but it does not seem to stabilize hybridization when linked as a oligodeoxynucleotide-psoralen conjugate ( 7 , 34 - 36 ).

Table 1 . Thermal denaturation of oligodeoxynucleotide duplexes
Oligodeoxynucleotide a

T m (oC)

5'-AGTGCCACCTGACGTCAG ( OT1 )

47

3'-TCACGGTGGACTGCA

5'-AGTGCCACCTGACGTCAG ( OT1 )

54

3'-TCACGGTGGACTGCA

+ 1,4-dimethylanthraquinone

5'-AGTGCCACCTGACGTCAG ( OT1 )

57

3'-TCACGGTGGACTGCA-Me 2 AQ ( OAQ )

a DNA and 1,4-dimethylanthraquinone concentrations were 2.2 [mu]M.

Target alkylation induced by near UV irradiation

A series of oligonucleotide targets, OT1 - OT4 , were designed to test the specificity of the anthraquinone conjugate OAQ . Both double- and single-stranded regions were provided as possible reaction sites by extending the target strand beyond the conjugate sequence (Scheme 2 2). The nucleotide directly adjacent to the duplex was also varied in anticipation of its key role in modification. This site had been the sole target of alkylation in a related methylnaphthoquinone system ( 12 ) and dominated photocyclization in certain psoralen-based systems ( 35 ). Similar to psoralen and naphthoquinone, anthraquinone absorbs near UV light (340-360 nm), which allows for its selective activation in the presence of DNA. Irradiation at [lambda] > 335 nm was consequently used to initiate reaction following hybridization of OAQ and OT1 - OT4 and a combination of electrophoresis and autoradiography was used to characterize the products. Target alkylation would covalently link the duplex strands and generate derivatives of high molecular weight and low mobility, whereas oxidative scission would generate strand fragments of low molecular weight and high mobility.

Only target alkylation was observed over a 2 h irradiation and its yield approached 40% for a stoichiometric mixture of OAQ and OT1 (Fig. 1 A). Product formation was limited in part by a competing photochemical decomposition of OAQ , since a 1 h pre-irradiation of OAQ inhibited subsequent modification of the target by ~50%. Still, the anthraquinone chromophore was much more stable than an equivalent naphthoquinone analog, which completely decomposed within the first 10 min of irradiation ( 11 ). Modification of each target sequence was examined under the same standard conditions as in Figure 1 A and summarized in Figure 1 B. Greatest yields were obtained for N = C ( OT1 ) and this was not unique to sequences terminating in a single-stranded sequence -CAG. An alternative target, OT5 (5'-[ 32 P]AGTGCCACCTGACGTCTAAG), with a single-stranded extension of -CTAAG was cross-linked with the same efficiency as OT1 . In contrast, only slight reaction was detected for N = G or A ( OT3 and OT4 ), even though these nucleobases are known to react with quinone methide intermediates via their exo -amino groups ( 37 - 39 ). The moderate yields of cross-linking for N = T were most surprising, since this base does not even contain an exo -amino group.


Figure 2 . Chemical and photochemical characterization of the cross-linked duplex (XL) formed by irradiation of the target ( OT1 ) and probe ( OAQ ). Unmodified target OT1 (lane 1), G-lane of OT1 (49) (lane 2) and purified cross-linked OT1 ~ OAQ (lane 3) are presented for reference. The stability of the cross-linked product was examined by irradiation at [lambda] > 335 nm (60 min) (lane 4) and treatment with piperidine formate (0.25 M, pH 2, 37oC, 60 min) (lane 5), piperidine formate (0.25 M, pH 2, 37oC, 60 min) followed by piperidine (2 M, 90oC, 30 min) (lane 6), piperidine alone (1 M, 90oC, 30 min) (lane 7) and heat (90oC, 30 min) (lane 8). All samples were lyophilized and resuspended for polyacrylamide gel electrophoresis (20%, 7 M urea) as described in Materials and Methods.

Use of the anthraquinone-containing oligodeoxynucleotide OAQ in a 5-fold excess modestly increased target alkylation of OT5 to 45%. However, the reaction yield was reduced to 30 and 15% when a stoichiometric mixture of OAQ + OT5 was diluted from 2.2 [mu]M to 1 [mu]M and 10 nM respectively. Finally, modification of OT5 by OAQ was solely dependent on irradiation and could not be promoted by incubation in the absence of light or by heat (90oC), acid (0.25 M piperidine formate, pH 2, 37oC), base (1 M piperidine, 90oC), or reduction (100 mM NaBH 4 ).

Chemical characterization of the alkylated duplexes

Certain alkylation products of DNA can be identified by their characteristic lability to heat, alkali or other treatments. Accordingly, the stability of the high molecular weight derivative formed by OT1 / OAQ was examined under a variety of conditions after its isolation by preparative gel electrophoresis. In contrast to the cross-link formed by a naphthoquinone conjugate ( 11 ), the equivalent product of the anthraquinone reaction was relatively inert to standard manipulations and did not readily decompose to a material of similar gel mobility to the starting material (Fig. 2 , lane 3). Under additional exposure to UV light ([lambda] > 335 nm), the anthraquinone product began to decompose to form oligonucleotides with mobilities equivalent to that of the starting material OT1 and its fragment lacking the 3'-terminal -CAG (lane 4). Strand scission at the five bases on the 5'-side of the -CAG was also observed and may have resulted from anthraquinone's ability to act as a photochemical oxidant ( 30 , 31 ).

The covalent linkage generated between OT1 and OAQ remained stable under acidic conditions (pH 2; Fig. 2 , lane 5). However, the expected depurination reaction promoted by acid was detected after subsequent treatment with piperidine (90oC; lane 6). Other fragments were generated as well by these conditions and once again found comparable in gel mobility with the original target and its derivative lacking the 3'-terminal -CAG. These two species were not necessarily the result of sensitivity to acid or base (lane 7), since heat alone was sufficient for their production (lane 8). This fragmentation pattern suggested that at least some alkylation occurred at the single-stranded C extended from the duplex formed by OT1 / OAQ . A general specificity for this site was further implicated by the wide range of yields observed for cross-linking targets OT1 - OT4 that only differed at the first unpaired base.

Hydroxyl radical footprinting of the alkylated products

The major site of target alkylation was identified by a method of hydroxyl radical footprinting that had previously been used to characterize numerous interstrand reactions ( 13 , 40 , 41 ). This radical provides a non-specific method of strand scission via oxidation of the phosphoribose backbone. Fragmentation of the modified and unmodified duplexes was compared by gel electrophoresis (and densitometry) to determine the position at which the two profiles converge. This in turn indicated the site of cross-link on the labeled target strand ( 42 ). The hydroxyl radical cleavage patterns for the covalent and non-covalent complexes formed by [ 32 P] OT5 and OAQ were comparable through C16, the first unpaired nucleotide (Fig. 3 ). An equivalent result was observed for [ 32 P] OT1 and OAQ (data not shown) and confirmed a preferential modification of this nucleotide by the anthraquinone.


Figure 3 . Hydroxyl radical footprinting of OT5 subsequent and prior to photochemical cross-linking. Densitometric scans representing hydroxyl radical-generated fragments of ( A ) the cross-linked product OAQ ~5'-[ 32 P] OT5 and ( B ) the unirradiated duplex OAQ /5'-[ 32 P] OT5 were compared to identify the site of target modification. Experimental procedures are described in text.

The naphthoquinone analog described previously also reacted exclusively at the first unpaired nucleotide site ( 12 ). However, this earlier study could not distinguish whether this selectivity simply reflected the major solution conformation of the probe-target duplex or derived from a particular orientation required for productive cross-linking. The ligated naphthoquinone did not stabilize hybridization prior to target alkylation and therefore its relative ability to intercalate into or stack above the duplex was not apparent. In contrast, the anthraquinone appendage strongly stabilized hybridization in a manner consistent with interactions dominated by intercalation. Since target modification did not occur at a site of intercalation, covalent specificity of the anthraquinone was likely controlled by its reactivity rather than its binding.

Conclusion

The anthraquinone derivative described in these studies was developed for site-specific and inducible alkylation of nucleic acids and designed to overcome deficiencies with a previous naphthoquinone analog. Both chromophores were able to cross-link target sequences when irradiated at [lambda] > 335 nm and no oxidative degradation of the nucleotides was evident until prolonged exposure to light. As expected, the anthraquinone appendage was more stable and provided higher yields of target modification than the original naphthoquinone system. Although each quinone reacted at the first nucleotide extended beyond the duplex formed by probe-target hybridization, their nucleotide specificity differed. The naphthoquinone derivative selectively modified nucleotides containing exo -amino groups, as predicted for a reaction dependent on a quinone methide intermediate ( 12 ). In contrast, the anthraquinone derivative appeared selective for the pyrimidines C and T and independent of the presence of an exo -amine. The mechanism of this process is currently under investigation and may provide new opportunities in the design of site-directed modification of biopolymers.

MATERIALS AND METHODS

General

1 H-NMR spectra were recorded on a QE-300 (General Electric) at 300 MHz and chemical shifts ([delta], p.p.m.) were determined from an internal standard of CHCl 3 . Low resolution mass spectra (LRMS) were measured using electron impact with an HP5980A (Hewlett-Packard); high resolution mass spectra (HRMS) were measured with a MS890 (Kratos). Synthetic procedures were performed under a nitrogen atmosphere and solvents were freshly distilled (CH 3 CN, diethyl ether and CH 2 Cl 2 over calcium hydride and THF over sodium). Silica gel (230-400 mesh) for flash column chromatography was obtained from Fisher Scientific Co. Pyridinium dichromate ( 43 ), tris(triphenylphosphine)rhodium(I) chloride ( 44 ), 1,2-bis(1-oxo-2-butynyl)benzene 1 ( 33 ) and 1,4-dimethylanthraquinone ( 45 ) were prepared according to published procedures. All other organic chemicals, buffers and reagents were obtained as the highest commercial grade available and used without further purification. T4 kinase was obtained from US Biochemical and Gibco BRL. [[gamma]- 32 P]ATP was purchased from Amersham Corporation.

Rhodium complex of 1,2-(1-oxo-2-butynyl)benzene (2) (ref. 33)

1,2-Bis(1-oxo-2-butynyl)benzene 1 (37 mg, 170 [mu]mol) was added to tris(triphenylphosphine)rhodium(I) chloride (180 mg, 190 [mu]mol) in 2 ml xylene under nitrogen at 140oC. After stirring for 50 h, the reaction mixture was evaporated, redissolved in ethyl acetate and subjected to silica gel flash chromatography. The desired product was isolated in a low but predictable ( 33 ) yield of 15% (24 mg). 1 H NMR (CDCl 3 ) [delta] 2.10 (6H, s), 8.04-7.37 (34H, m).

2-(3-Acetoxypropyl)-1,4-dimethylanthraquinone (3) (ref. 33)

The rhodium complex above (24 mg, 26 [mu]mol) was added to 5-acetoxy-1-pentyne (4 mg, 31 [mu]mol, prepared by esterification of 4-pentyn-1-ol with acetic anhydride) in 2 ml benzene. The reaction mixture was maintained at 50oC for 15 h and then evaporated to dryness. The residue was redissolved in hexane:ethyl acetate (1:1) and subjected to silica gel flash chromatography to yield 4 mg product (45% yield). m.p. 119-120oC (uncorrected); 1 H NMR (CDCl 3 ) [delta] 1.91 (2H, m), 2.11 (3H, s), 2.75 (6H, s), 2.76 (2H, t), 4.19 (2H,t), 7.32 (1H, s), 7.65 (2H, m), 8.11 (2H, m); LRMS m / z (relative intensity) 336 (M + , 87.4), 261 (100), 249 (23.5), 235 (29.46), 189 (24.7); HRMS calculated for C 21 H 20 O 4 (M + ) 336.1362, found 336.1362.

2-(3-Hydroxypropyl)-1,4-dimethylanthraquinone (4)

The acetoxy derivative 3 (4 mg, 14 [mu]mol) was dissolved in 4 ml 5% aqueous K 2 CO 3 and MeOH (1:1) and stirred at room temperature for 6 h. The mixture was then evaporated to 2 ml and extracted with CHCl 3 and H 2 O. The organic layer was dried over MgSO 4 and filtered and the solvent was removed under reduced pressure. The crude product was purified via silica gel flash chromatography to yield ~4 mg product alcohol. 1 H NMR (CDCl 3 ) [delta] 1.64 (2H, m), 2.69 (6H, s), 2.95 (2H, t), 3.42 (2H, m), 4.45 (1H, t), 7.31 (1H, s), 7.55 (2H, m), 8.04 (2H, m); LRMS m / z (relative intensity) 294 (M + , 6.13), 279 (100), 249 (17.3), 235 (33.6), 205 (9.49); HRMS calculated for C 19 H 18 O 3 (M + ) 294.1256, found 294.1243.

2-(3-Propionic acid)-1,4-dimethylanthraquinone (5)

The alcohol 4 (4 mg, 14 [mu]mol) and PDC (184 mg, 49 [mu]mol) were dissolved in DMF (2 ml) and stirred for 10 h at room temperature. The reaction was then mixed with water (15 ml) and extracted with ether. The organic phase was dried over MgSO 4 , reduced in volume and subjected to silica gel flash chromatography to yield the desired acid quantitatively. 1 H NMR (CDCl 3 ) [delta] 2.77 (6H, s), 4.30 (2H, t), 4.69 (2H, t), 7.36 (1H, s), 7.68 (2H, m), 8.14 (2H, m), 10.58 (1H, s); LRMS m / z (relative intensity) 308 (M + , 84.59), 291 (14.8), 262 (100), 249 (30.4), 235 (88.6), 220 (14.6), 205 (22.0); HRMS calculated for C 19 H 16 O 4 (M + ) 308.1049, found 308.1046.

N -Hydroxysuccinimide ester of 2-(3-propionic acid)-1,4- dimethylanthraquinone (6)

The acid derivative 5 (4 mg, 13 [mu]mol), N -hydroxysuccinimide (18 mg, 16 [mu]mol) and CDI (2 mg, 13 [mu]mol) were dissolved in DMF (40 [mu]l) and maintained at 4oC for 14 h. The reaction mixture was then evaporated to dryness. The residue was redissolved in CH 2 Cl 2 (3 ml), extracted three times with H 2 O and dried over MgSO 4 . The product was purified by silica gel flash chromatography and yielded 4 mg activated ester product (75%). 1 H NMR (CDCl 3 ) [delta] 2.72 (6H, s), 2.80 (4H, s), 2.88 (2H,t), 3.17 (2H, t), 7.37 (1H, s), 7.67 (2H, m), 8.13 (2H, m).

Preparation of oligodeoxynucleotides

All oligodeoxynucleotides were synthesized via standard solid-phase cyanoethyl phosphoramidite chemistry (Clontech) and the unmodified species were purified by anion exchange chromatography (Mono Q, Pharmacia) under strongly denaturing conditions (pH 12) ( 46 ). The hexamethyleneaminolinker was attached in the last step of the automated synthesis using a monomethoxytrityl-protected precursor (Clontech). The protecting group was removed by treating the crude product with 80% acetic acid for 30 min under ambient conditions and then separated from the by-products with ether extraction. The crude aminolinker preparation was neutralized, dried and used directly in the coupling reaction below. DNA concentrations were calculated per mol oligonucleotide from their [epsilon] 260 values, estimated from the sum of nucleotide absorptivity as affected by adjacent bases ( 47 ). The target sequences OT1 - OT5 were radiolabeled at the 5'-terminus by incubation with [[gamma]- 32 P]ATP (50 [mu]Ci, sp. act. 3000 Ci/mmol) and T4 polynucleotide kinase (10 U) in kinase buffer (0.05 M Tris-HCl, pH 7.6, 0.01 M MgCl 2 , 5 mM DTT, 0.1 mM EDTA and 0.1 mM spermidine) for 45 min at 37oC ( 48 ). This mixture was then diluted to 2 ml with water and centrifuged in an Amicon concentrator (10 000 mol. wt cut-off) for 40 min to remove the excess salt and unincorporated [[gamma]- 32 P]ATP. This process of dilution-centrifugation was repeated twice more to provide ~5 [mu]Ci phosphorylated oligodeoxynucleotide.

Coupling of the oligodeoxynucleotide and anthraquinone derivative (OAQ)

The oligodeoxynucleotide aminolinker (1.2 A 260 units, 9 nmol) was dissolved in 0.25 M 3-( N -morpholino)propane sulfonic acid, pH 7.5, (20 [mu]l) and added to a DMF solution (20 [mu]l) of the activated anthraquinonyl ester 6 (2 mg, 5 [mu]mol) and left undisturbed at room temperature for 4 h. The oligodeoxynucleotide conjugate was purified by reverse-phase HPLC (C-18 Spherex column) using a gradient of 45 mM triethylammonium acetate, pH 6, 10% acetonitrile to 35 mM triethylammonium acetate, pH 6, 30% acetonitrile over 30 min at a flow rate of 1 ml/min. The product OAQ was isolated in 34% yield, estimated by the recovery of A 260 units.

Thermal denaturation of oligodeoxynucleotide duplexes ( T m measurements)

Equal concentrations of complementary strands (2.2 [mu]M) in the presence and absence of 1,4-dimethylanthraquinone (2.2 [mu]M) were mixed in potassium phosphate buffer (10 mM, pH 7) and NaCl (100 mM), heated to 80oC and then cooled slowly to 4oC over 4 h. Samples were then equilibrated in a temperature controlled UV spectrophotometer (Perkin-Elmer [lambda]-5) and absorbance at 260 nm was monitored as a function of temperature from 10 to 90oC. The T m values were determined from a plot of absorbance (A 260 ) versus temperature and assigned as the temperature at 1/2([Delta]A 260 ).

Standard condition for inducing oligodeoxynucleotide alkylation

Equimolar solutions of OAQ and a complementary strand OT1 - OT5 (typically 2.2 [mu]M) were dissolved in potassium phosphate (10 mM, pH 7) and annealed by first heating the solution to 65oC (10 min) and then allowing it to cool slowly back to room temperature over 3-4 h. The resulting solutions were transferred to conical Pyrex tubes and irradiated under ambient conditions at the focal point of a 150 W xenon arc lamp using a 335 nm long pass band filter. Samples were dried, denatured by addition of 80% formamide and analyzed by denaturing polyacrylamide gel (20%, 7 M urea) electrophoresis. Approximately 2 nCi labeled material was applied to each gel lane. Alkylation was detected by autoradiography and quantified by excising portions of the gel and measuring their radioactivity by scintillation counting.

Purification of cross-linked target/probe complex

The complementary targets and probe (2 [mu]M) were annealed, irradiated (1 h) and subjected to gel electrophoresis under standard conditions. The cross-linked DNA was located by autoradiography and extracted by routine crush and soak methods ( 48 ). This DNA was then precipitated in 75% EtOH and analyzed for purity by gel electrophoresis.

Chemical characterization and hydroxyl radical footprinting of the alkylation product

The cross-linked duplexes were subject to acid, base, heat and irradiation as described in Figure 2 . Hydroxyl radical footprinting followed published procedures ( 42 ). Cross-linked products (60 nCi) were dissolved in 2 mM Tris buffer, pH 7, and treated with (NH 4 ) 2 Fe(SO 4 ) 2 (1 mM), EDTA (4 mM, pH 8) and sodium ascorbate (2 mM). Reactions were initiated by addition of H 2 O 2 (1 mM), incubated for 3 min at room temperature and quenched with thiourea (80 mM). The resulting product fragments were then analyzed by denaturing gel electrophoresis, autoradiography and densitometry.

ACKNOWLEDGEMENT

This research was generously supported in part by the Center for Biotechnology, State University of New York at Stony Brook, in conjunction with the New York State Science and Technology Foundation.

REFERENCES

1 Cohen,J.S. (ed.) (1989) Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression. CRC press, Boca Raton, FL.

2 Goodchild,J. (1990) Bioconjugate Chem., 1, 165-187.

3 Uhlmann,E. and Peyman,A. (1990) Chem. Rev., 90, 543-584.

4 Milligan,J.F., Matteucci,M.D. and Martin,J.C. (1993) J. Med. Chem., 36, 1923-1937. MEDLINE Abstract

5 Miller,P.S. (1996) Prog. Nucleic Acid Res. Mol. Biol., 52, 261-291.

6 Miller,P.S. (1991) Biotechnology, 9, 358-362.

7 Lee,B.L., Murakami,A., Blake,K.R., Lin,S.-B. and Miller,P.S. (1988) Biochemistry, 27, 3197-3203. MEDLINE Abstract

8 Kean,J.M. and Miller,P.S. (1994) Biochemistry, 33, 9178-9186. MEDLINE Abstract

9 Grigoriev,M., Praseuth,D., Guieysse,A.L., Robin,P., Thuong,N.T., Hèléne,C. and Harel-Bellan,A. (1993) Proc. Natl. Acad. Sci. USA, 90, 3501-3505. MEDLINE Abstract

10 Gasparro,F.P., Havre,P.A., Olack,G.A., Gunther,E.J. and Glazer,P.M. (1994) Nucleic Acids Res., 22, 2845-2852. MEDLINE Abstract

11 Chatterjee,M. and Rokita,S.E. (1990) J. Am. Chem. Soc., 112, 6379-6399.

12 Chatterjee,M. and Rokita,S.E. (1994) J. Am. Chem. Soc., 116, 1690-1697.

13 Chatterjee,M. and Rokita,S.E. (1991) J. Am. Chem. Soc., 113, 5116-5117.

14 Li,T. and Rokita,S.E. (1991) J. Am. Chem. Soc., 113, 7771-7773.

15 Li,T., Zeng,Q. and Rokita,S.E. (1994) Bioconjate Chem., 5, 497-500.

16 Lown,J.W. (ed.) (1988) Anthracycline and Anthracenedione-based Anticancer Agents. Elsevier, New York, NY.

17 Zee-Cheng,R.K.-Y. and Cheng,C.C. (1978) J. Med. Chem., 21, 291-294.

18 Murdock,K.C., Child,R.G., Fabio,P.F., Angier,R.B., Wallace,R.E., Durr,F.E. and Citarella,R.V. (1979) J. Med. Chem., 22, 1023-1030.

19 Abgandje,M., Jenkins,T.C., McKenna,R., Reszka,A.P. and Neidle,S. (1992) J. Med. Chem., 35, 1418-1429.

20 Gibson,D., Gean,K.-F., Ben-Shoshan,R., Ramu,A., Ringel,I. and Katzhendler,J. (1991) J. Med. Chem., 34, 414-420.

21 Mori,K., Subasinghe,C. and Cohen,J.S. (1989) FEBS Lett., 249, 213-217. MEDLINE Abstract

22 Yamana,K., Nishijima,Y., Ikeda,T., Gokota,T., Ozaki,H., Nakano,H., Sangen,O. and Shimidzu,T. (1990) Bioconjugate Chem., 1, 319-324.

23 Lin,K.-Y. and Matteucci,M. (1991) Nucleic Acids Res., 19, 3111-3114. MEDLINE Abstract

24 Ono,A., Dan,A. and Matsuda,A. (1993) Bioconjugate Chem., 4, 499-508.

25 Keller,T.H. and Häner,R. (1993) Nucleic Acids Res., 21, 4499-4505. MEDLINE Abstract

26 Dan,A., Yoshimura,Y., Ono,A. and Matsuda,A. (1993) Bioorg. Med. Chem. Lett., 3, 615-618.

27 Deshmukh,H.M., Joglekar,S.P. and Broom,A.D. (1995) Bioconjugate Chem., 6, 577-586.

28 Reszka,K.J., Bilski,P., Chignell,C.F., Hartley,J.A., Khan,N., Souhami,R.L., Mendonca,A.J. and Lown,J.W. (1992) J. Photochem. Photobiol. B Biol., 15, 317-335.

29 Koch,T., Ropp,J.D., Sligar,S.G. and Schuster,G.B. (1993) Photochem. Photobiol., 58, 554-558. MEDLINE Abstract

30 Armitage,B., Yu,C., Devadoss,D. and Schuster,G.B. (1994) J. Am. Chem. Soc., 116, 9847-9859.

31 Breslin,D.T. and Schuster,G.B. (1996) J. Am. Chem. Soc., 118, 2311-2319.

32 Gritsan,N.P., Khmelinski,I.V. and Usov,O.M. (1991) J. Am. Chem. Soc., 113, 9615-9620.

33 Müller,E. and Langer,E. (1970) Tetrahedron Lett., 5271-5274. MEDLINE Abstract

34 Hearst,J.E. (1989) Chem. Res. Toxicol., 2, 69-75. MEDLINE Abstract

35 Bhan,P. and Miller,P.S. (1990) Bioconjugate Chem., 1, 82-88.

36 Kean,J.M. and Miller,P.S. (1993) Bioconjugate Chem., 4, 184-187.

37 Tomasz,M., Chowdary,D., Lipman,R., Shimotakahara,S., Veiro,D., Walker,V., Verdine,G.L. (1986) Proc. Natl. Acad. Sci. USA, 83, 6702-6706. MEDLINE Abstract

38 Egholm,M. and Koch,T.H. (1989) J. Am. Chem. Soc., 111, 8291-8293.

39 Angle,S.R. and Yang,W. (1992) J. Org. Chem., 57, 1092-1097.

40 Hopkins,P.B., Millard,J.T., Woo,J., Weidner,M.R., Kirchner,J.J., Sigurdsson,S.T. and Raucher,S. (1991) Tetrahedron, 47, 2475-2489.

41 Millard,J.T and Beachy,T.M. (1993) Biochemistry, 32, 12850-12856. MEDLINE Abstract

42 Weidner,M.F., Millard,J.T., Hopkins,P.B. (1989) J. Am. Chem. Soc., 111, 9270-9272.

43 Corey,E.J. and Schmidt,G. (1979) Tetrahedron Lett., 399-402.

44 Osborn,J.A., Jardine,F.H., Young,J.F. and Wilkinson,G. (1966) J. Chem. Soc. A, 1711-1732.

45 Rosenfeld,S. and VanDyke,S. (1991) J. Chem. Ed., 68, 691-692.

46 Rokita,S.E. and Romero-Fredes,L. (1992) Nucleic Acids Res., 20, 3069-3072. MEDLINE Abstract

47 Fasman,G. (ed.) (1975) Handbook of Biochemistry and Molecular Biology-Nucleic Acids, 3rd Edn. CRC Press, Boca Raton, FL, Vol. 1, p. 175.

48 Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

49 Maxam,A.M. and Gilbert,W. (1980) Methods Enzymol., 65, 499-560. MEDLINE Abstract


Return

*To whom correspondence should be addressed at present address: Department of Chemistry and Biochemistry, University of Maryland, College Park, MD 20742-2021, USA

+ Present address: Department of Life Science, Yongin University, Samga-ri Yongin-up, Yongin-gun, Kyonggi-do 449-714, Korea
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Print PDF (125K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Kang, H
Right arrow Articles by Rokita, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kang, H
Right arrow Articles by Rokita, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?