Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (456K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (291)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Boulton, S.
Right arrow Articles by Jackson, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boulton, S.
Right arrow Articles by Jackson, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 1996 Oxford University Press 4639-4648

Footnote

Identification of a Saccharomyces cerevisiae Ku80 homologue: roles in DNA double strand break rejoining and in telomeric maintenance

Identification of a Saccharomyces cerevisiae Ku80 homologue: roles in DNA double strand break rejoining and in telomeric maintenance Simon J. Boulton and Stephen P. Jackson*

Wellcome/CRC Institute and Department of Zoology, Cambridge University, Tennis Court Road, Cambridge CB2 1QR, UK

Received September 9, 1996 ; Revised and Accepted October 18, 1996

ABSTRACT

Ku is a heterodimer of polypeptides of approximately 70 and 80 kDa (Ku70 and Ku80, respectively) that binds to DNA ends. Mammalian cells lacking Ku are defective in DNA double-strand break (DSB) repair and in site- specific V(D)J recombination. Here, we describe the identification and characterisation of YKU80 , the gene for the Saccharomyces cerevisiae Ku80 homologue. Significantly, we find that YKU80 disruption enhances the radiosensitivity of rad52 mutant strains, suggesting that YKU80 functions in a DNA DSB repair pathway that does not rely on homologous recombination. Indeed, through using an in vivo plasmid rejoining assay, we find that YKU80 plays an essential role in illegitimate recombination events that result in the accurate repair of restriction enzyme generated DSBs. Interestingly, in the absence of YKU80 function, residual repair operates through an error-prone pathway that results in recombination between short direct repeat elements. This resembles closely a predominant DSB repair pathway in vertebrates. Together, our data suggest that multiple, evolutionarily conserved mechanisms for DSB repair exist in eukaryotes. Furthermore, they imply that Ku binds to DSBs in vivo and promotes repair both by enhancing accurate DNA end joining and by suppressing alternative error-prone repair pathways. Finally, we report that yku80 mutant yeasts display dramatic telomeric shortening, suggesting that, in addition to recognising DNA damage, Ku also binds to naturally occurring chromosomal ends. These findings raise the possibility that Ku protects chromosomal termini from nucleolytic attack and functions as part of a telomeric length sensing system.

INTRODUCTION

DNA repair is of the utmost importance in maintaining the integrity and stability of the genome. Without an ability to mediate DNA repair effectively, cells have a greatly elevated risk of acquiring mutations and, in multicellular organisms, this can lead ultimately to tumourigenesis. Perhaps the most dangerous type of DNA damage is the double strand break (DSB), which is generated following exposure to ionizing radiation or to radio-mimetic chemicals. Consequently, eukaryotic cells have evolved several systems to recognise and repair this form of DNA damage. Work on the budding yeast, Saccharomyces cerevisiae , has established that genes comprising the RAD52 epistasis group play important roles in DSB repair ( 1 , 2 ). Investigations into the mechanisms of DSB repair in vivo , together with structural and functional characterisation of RAD52 epistasis group gene products, has shown that these genes direct repair through homologous recombination, a process in which the damaged DNA molecule retrieves genetic information by pairing with an undamaged partner. Mammalian homologues of the yeast RAD51 and RAD52 genes have been identified ( 3 - 5 ), suggesting that the homologous recombination apparatus is highly conserved throughout the eukaryotic kingdom. Consistent with this, mammalian cells can repair DNA DSBs by homologous recombination, but this takes place much less efficiently than in yeast ( 6 ).

Although RAD52 -dependent homologous recombination is the predominant mechanism for DSB repair in S.cerevisiae , recent investigations have revealed the existence of alternative DSB repair pathways in this organism. For example, in rad52 mutant backgrounds, HO-endonuclease generated DSBs can be repaired by a single strand annealing pathway that results in homologous recombination between directly repeated elements that flank the DSB and the concurrent loss of intervening sequences ( 7 , 8 ). In addition, studies in rad52 mutant strains have identified mechanisms of DSB repair that require little or no sequence homology between the recombining DNA segments. Consequently, these mechanisms are referred to as non-homologous or illegitimate DSB repair pathways. Situations where illegitimate DSB repair has been observed in S.cerevisiae include the RAD52 independent non-homologous integration of plasmids into the yeast genome ( 9 ), and the recircularisation of linearised plasmid DNA ( 10 - 12 ). In these situations, repair occurs through either of two pathways. The first of these is illegitimate end-joining, a process whereby two DNA ends are ligated together without the loss of nucleotide sequences. The other, which we term illegitimate recombination, results in the loss of variable amounts (normally one to several hundred bp) of terminal DNA through the joining of the two DNA ends via short (usually 1-7 bp) direct repeats. In contrast to the situation in yeast, where homologous recombination normally predominates, DNA DSBs are usually repaired by illegitimate recombination pathways in vertebrate systems ( 13 ). Nevertheless, as in yeast, the two principal pathways for illegitimate DSB repair in vertebrates are direct end joining and illegitimate recombination between short direct repeat sequences. These observations therefore suggest that mechanisms of illegitimate DSB repair are highly conserved throughout evolution and raise the possibility that the identification and characterisation of components of S.cerevisiae illegitimate recombination pathways will provide valuable insights into DSB repair in mammalian systems.

Until a few years ago, very little was known about the components of the mammalian illegitimate DSB repair pathways. Recently, however, it was shown that the nuclear protein Ku is defective in the radiosensitive Hamster cell line xrs-6 , which is impaired both in DNA DSB repair and in V(D)J recombination ( 14 - 16 ). This finding established Ku as an important component of the mammalian DSB repair machinery. Ku is a heterodimer of two tightly-associated subunits of approximately 70 and 80 kDa (Ku70 and Ku80, respectively) and serves as the DNA binding component of the DNA dependent protein kinase (DNA-PK). Cells defective in the other DNA-PK component, the DNA-PK catalytic subunit (DNA-PK cs ), are also deficient in DSB repair and in V(D)J recombination, implicating the DNA-PK holoenzyme in these processes ( 17 - 19 ). Since Ku binds specifically to DNA DSBs in vitro , it is likely the DNA-PK cs /Ku complex directly senses DNA damage and is an integral component of the illegitimate DSB repair apparatus.

Feldmann and Winnacker ( 20 ) identified a heterodimeric DNA end-binding factor in S.cerevisiae and showed that the gene for the 70 kDa subunit of this factor encodes a polypeptide with homology to Ku70. Given the importance of Ku in mammalian systems, we and others have tested for an involvement of this putative yeast Ku70 homologue, which we refer to as Yku70p, in DSB repair ( 21 - 23 ). Consistent with the dominance of RAD52 -dependent homologous recombination in yeast, disruption of YKU70 does not result in marked hypersensitisation to ionizing radiation. However, when the homologous recombination system is rendered inactive by mutations in RAD52 , yku70 mutations significantly enhance the radiosensitivity of yeast strains. These results reveal that YKu70p is involved in the RAD52 -independent repair of ionising radiation-induced DNA damage and are consistent with the existence of a Ku-dependent illegitimate DSB repair apparatus in S.cerevisiae .

Since mammalian Ku70 is complexed with Ku80 and in light of the fact that Yku70p co-purifies with a polypeptide of ~80 kDa ( 20 ), we have searched for an S.cerevisiae Ku80 homologue. In this manuscript we describe the identification of a yeast gene, termed YKU80 , that encodes a protein that is related to mammalian Ku80. Consistent with this gene encoding a bona fide Ku80 homologue, disruption of YKU80 hypersensitises yeast rad52 mutant strains to ionising radiation and to the radio-mimetic drug methyl methanesulphonate (MMS). Moreover, through using an in vivo plasmid repair assay, we demonstrate that Yku80p plays an important role in illegitimate DNA end joining and suppresses error-prone illegitimate recombination. Finally, we demonstrate that inactivation of YKU80 leads to telomeric shortening. These results reveal that the Ku-dependent DSB repair pathway is highly conserved from yeast to man and indicate that Yku80p plays important roles in maintaining chromosomal integrity both under normal growth conditions and in response to exogenous mutagenic agents.

MATERIALS AND METHODS

Protein sequence analyses

Protein sequence alignments were performed using the PILEUP package (Genetics Computer Group, Wisconsin). The resulting pileup was edited in GCG using the LINEUP facility and was further edited in SEP-APP. The edited pileup was then used in the Boxshade program which identifies conserved and semi-conserved amino acids.

Yeast media and growth conditions

Yeast strains are given in Table 1 and yeast media were as described by Sherman et al. ( 24 ). MMS sensitivity was measured as described by Milne and Weaver ( 25 ). Briefly, yeast colonies were suspended into dH 2 O, and diluted six times by 10-fold serial dilution. Aliquots (15 [mu]l ) of each dilution were then spotted in duplicate onto YPED plates with and without MMS (0.005%), and were incubated at 30oC for 3-4 days. Temperature sensitivity was determined by spotting 15 [mu]l aliquots of serially diluted cultures in duplicate onto non-selective media which were then incubated at 30oC or 37oC for 3-4 days.

Table 1 Saccharomyces cerevisiae strains
Strain

Genotype

Source

W303-1A

Mat [alpha] ade2 his3 leu2 trp1 ura3 can1-100

ref. 20

W303-1B

Mat a ade2 his3 leu2 trp1 ura3 can1-100

ref. 20

GY1

Mat [alpha] ade2 leu2 ura3 trp1 CAN1

J. Murray

yku70[alpha]

W303-1A yku70::URA3

ref. 20

yku70a

W303-1B yku70::LEU2

ref. 20

yku80[alpha]

W303-1A yku80::URA3

This study

yku80a

W303-1B yku80::URA3

This study

GW

W303-1B * GY1

This study

GW80

yku80 [alpha] * yku80a

This study

DWY85

Mat [alpha] ho::LYS2 leu2::hisG rad52::URA3

D. Weaver

DWY86

Mat a l ho::LYS2 leu2::hisG rad52::URA3

D. Weaver

DWY91

Mat [alpha] arg4 .RV leu2-3-112 cyhR trp1-289

D. Weaver

rad52::URA3

DWY176

Mat a his3 cyhS ade2 ura3-52 trp1-289

D. Weaver

rad52::URA3

rh7a

Mat a arg4.RV leu2.3-112 trp1 ade2 his3

This study

yku70::LEU2 rad52::URA3

rh8b

Mat a ade2 his3 trp1 ura3 can1-100

This study

yku70::LEU2 rad52::URA3

rh10b

Mat [alpha] ade2 his3 trp1 ura3 can1-100

This study

yku70::LEU2 rad52::URA3

rh12a

Mat a ade2 trp1 his3 yku70::LEU2

This study

rad52::URA3

rh16b

Mat [alpha] ade2 trp1 his3 yku70::LEU2

This study

rad52::URA3

r80-1[alpha]

Mat [alpha] ade2 trp1 his3 yku80::URA3

This study

rad52::TRP1

r80-1a

Mat a ade2 trp1 his3 yku80::URA3

This study

rad52::TRP1

ku-1

Mat a ade2 trp1 his3 yku80::URA3

This study

yku70::LEU2

rku-1

Mat [alpha] ade2 his3 yku70::LEU2

This study

yku80::URA3 rad52::TRP1

Primers

yku70-3 GAGATTTCTATGCTCGAGGAGAACTTC yku70-5 GGGACCCACAAAGGATTCTCAGGAAGTGG rad52-1 TATTGGGAATAAATGCCAATGCCAGTTC rad52-2 TAATGATCTATTGTTTTTCCGAGTTGCC yku80-1 GGAAATGCTCGAGTATGAGACCTTGAACCAG yku80-2 CAGCGGATCCCCGGATGTAGTTGTTCG

yku80-3 GAATGTACCGTCAACCAAAGATTAGCAGTTG yku80-4 GGCAGCAGCGTGTGTTGAGATTAGGAACCGC His3-3 GATTGTCTGCGAGGCAAGAATGAT Ura3-1 GGCGGATAATGCCTTTAGCGGC Ura3-2 GGAGAATATACTAAGGGTACTG Trp1 GTGCACTTGCCTGCAGGCC

Plasmids and vectors

All yeast- E.coli shuttle vectors used have centromeric and ARS sequences for stable maintenance in yeast, an auxotrophic yeast selectable marker, an OriC for high copy number propagation in E.coli and a [beta]-lactamase gene for ampicillin selection in E.coli . p70FL ( 21 ) consists of YKU70 and flanking regions cloned into pRS413 (Stratagene). p80FL was generated as follows: a 2.5 kb region of yeast genomic DNA containing the full length YKU80 gene and flanking regions was amplified by PCR using oligonucleotide primers yku80-3 and yku80-4 by employing the Bio-X-act proof reading DNA polymerase (Bioline). After first cloning into pGEM-T (Promega), this fragment was cloned into the yeast- E.coli shuttle plasmid pRS414 (Stratagene) to generate p80FL. The p80FL insert was sequenced fully by automated sequencing (Applied Biosystems) to verify that no PCR or cloning errors had taken place. pBTM116 (Fig. 3 A) contains a TRP1 selectable marker. pRS413 and pRS414 (Stratagene) contain HIS3 and TRP1 selectable markers, respectively.

Gene disruptions

The YKU80 disruption construct was generated by PCR cloning of a 2.1 kb fragment of the YKU80 gene into pGEM-T, using primers yku80-1 and yku80-2. This fragment was then subcloned into pBluescript-SK+ using the unique restriction sites, Xho I and Bam HI, and the ORF was disrupted by inserting a URA3 marker into Eco RI/ Sph I sites, unique within the resulting vector. The disruption fragment was then excised using Bam HI and Xho I and was used to transform the appropriate strains. Transformants were selected on minimal media lacking uracil, and the presence of a disrupted YKU80 gene was verified by the use of yku80 and URA3 primers in PCR studies. Two RAD52 disruption constructs were provided by D. Weaver and have TRP1 and URA3 selection, respectively. Strains disrupted in RAD52 were checked by PCR using RAD52 / TRP1 or RAD52 / URA3 primers, as appropriate.

X-ray cell survival assays

A yeast colony was inoculated into 10 ml YPED and was grown overnight at 30oC. The culture was then diluted in dH 2 O to an OD 600nm value equivalent to 1 * 10 7 cells/ml and 1 ml aliquots were irradiated using a 137 Cs source at a dose of 0.18 kRad/min. Irradiated samples and an unirradiated control were than serially diluted in dH 2 O and were plated in duplicate on YPED followed by incubation at 30oC for 3-4 days.

Plasmid repair assays

Plasmid DNA (5 [mu]g) was digested with restriction enzyme to completion as determined by gel electrophoresis followed by ethidium bromide staining and Southern blotting, and the restriction enzyme was inactivated by treatment at 65oC for 20 min. This linearised DNA was then used to transform yeast by the lithium acetate method as described by Schiestl and Gietz ( 26 )-parallel transformations were performed with an equivalent amount of uncut plasmid to enable normalisation for minor differences in transformation efficiencies between strains and between experiments. Serial dilutions were plated and colonies arising on selective media after 3-4 days were counted.

Yeast DNA extraction and analyses of telomeric DNA

Genomic DNA and plasmid DNA from S.cerevisiae was isolated as described previously ( 27 ). Briefly, cells were grown to saturation, then were harvested, washed, and suspended in lysis buffer (2% Triton X-100, 1% SDS, 100 mM NaCl, 10 mM Tris-HCl, 1 mM EDTA). Next, glass beads and phenol/chloroform/isoamyl alcohol (50:49:1) was added followed by 3 min of high speed vortexing. TE buffer was added and the organic and aqueous phases were separated by centrifugation. The aqueous phase was transferred to a fresh tube and DNA was precipitated with 100% ethanol. After dissolving the DNA in TE buffer, RNA was removed by treating with RNase A at 37oC. For telomere analysis, 1 [mu]g genomic DNA was digested overnight with 10 U Xho I (Boehringer Mannheim). The digested DNA was then run on a 0.8% agarose gel and was transferred to nitrocellulose as described previously ( 27 ). The DNA used for hybridisation to telomere sequences was a poly(GT) 20 oligonucleotide that was 32 P end-labelled by polynucleotide kinase (Boehringer Mannheim). Telomere blots were hybridised in Church buffer (7% SDS, 1% BSA, 0.25 M Na 2 HPO 4 , 1 mM EDTA) overnight at 60oC and were washed in 0.2* SSC, 0.1% SDS at room temperature for 20 min before exposing to X-ray film.

RESULTS

Identification of putative Ku80 homologues in Caenorhabditis elegans and in S.cerevisiae

Initial attempts to identify a YKU80 homologue in the S.cerevisiae genome were unsuccessful, despite the use of several database search facilities. During the course of these investigations, however, we identified a C.elegans open reading frame (ORF) capable of encoding a protein of predicted molecular mass of 82 kDa that is ~20% identical in sequence to human Ku80 (Fig. 1 ). Although the sequence alignment between the two proteins is weak, it spans the whole length of the polypeptides, suggesting that the C.elegans ORF indeed encodes a Ku80 homologue. Interestingly, we noted that a central portion of the C.elegans sequence, spanning amino acid residues 386 to 482, is ~36% identical to human Ku80, implying that this region corresponds to a particularly important domain of the protein. Given this, we reasoned that a putative yeast Ku80 homologue would also display highest similarity in this region. Indeed, when the central conserved portion of human Ku80 was used in database searches using the blastp facility, we identified an S.cerevisiae open reading frame (ORF) from 26387-28326 in the reverse complement of accession number Z49702 as a significant hit. This sequence resides on Chromosome XIII. Subsequent analyses revealed that this ORF has the potential to encode a polypeptide of 646 amino acid residues that is ~15% identical in sequence to the mammalian and C.elegans Ku80 proteins (Fig. 1 ). Although the homology is not striking, it spans the entire length of the yeast sequence and, encouragingly, the regions that are most conserved tend to correspond to regions that are most similar between the human and C.elegans sequences. We therefore tentatively concluded that the yeast ORF encodes a Ku80 homologue and named the corresponding gene YKU80 .


Figure 1 . Identification of C.elegans and S.cerevisiae Ku80 homologues. Shown is an alignment between human Ku80 (hKu80) and ORFs corresponding to the putative Ku80 homologues of C.elegans (ceKu80) and S.cerevisiae (yKu80). We have tentatively identified the first amino acid residues of ceKu80 and yKu80 to be the first Met residues of the ORFs. Identical residues are indicated by reverse shading and similar residues are shaded in grey. Database accession numbers for the sequences are as follows: hKu80, M30938; ceKu80, Z32683; yKu80, Z49702.

Disruption of YKU80 results in a temperature-sensitive growth defect

As an approach to address whether YKU80 indeed encodes a functional yeast Ku80 homologue, we inactivated this gene in the haploid yeast strains W3031B and GY1 by one-step gene disruption ( 28 ). This involved the PCR cloning of a 2.0 kb genomic fragment spanning the YKU80 locus and the disruption of the ORF at amino acid residue 74 by the introduction of a URA3 cassette. Since disruption of YKU70 results in an inability to grow at 37oC ( 20 , 21 , 23 ), we initially tested YKU80 disrupted strains for temperature sensitivity. As shown in Figure 2 A, like yku70 mutant yeasts, strains disrupted for YKU80 are unable to form colonies on solid media when incubated at 37oC. Consistent with the temperature-sensitive growth defect being attributable directly to mutations in yku80 , this phenotype is observed in several independently derived yku80 mutants. Moreover, the growth defect at 37oC is complemented by plasmid p80FL that contains the full length wild-type KU80 gene, but is not complemented by the parental plasmid pRS414. Although we have so far been unable to determine the precise reason for the growth arrest of yku80 mutant strains at 37oC, FACS analyses reveal that most cells arrest in the G2 phase of the cell cycle, suggesting an inability to enter into mitosis.


Figure 2 . Phenotypic effects of disrupting YKU80 . ( A ) Disruption of YKU80 function leads to temperature-sensitivity. Aliquots (15 [mu]l) of serial 10-fold dilutions of mid-log phase yeast cultures were spotted onto YEPD plates and were grown for 36 h at 30 or 37oC, as indicated. Strain abbreviations: Wt, wild-type YKU80 strain W303-1a; yku80, mutant yku80 strain yku80a; yku70mut, yku70 mutant strain yku70a. To ensure that the temperature-sensitive phenotype of the yku80 mutant strain is indeed due to the YKU80 gene disruption, the complementing plasmid p80FL was introduced and was found to restore an ability to grow at 37oC (data not shown). ( B ) YKU80 disruption hypersensitises yeast to ionising radiation only in rad52 mutant backgrounds. Yeast cultures were subject to increasing doses of ionising radiation and cell viability was assessed by growth on YPED plates as described in Materials and Methods. Strain abbreviations are as follows: Wt, wild-type strain W303-1b; yku80 strain, yku80[alpha]; rad52 strain, DWY176; rad52/yku70 strain, rh10b; rad52/yku80 strain, r80-1a; rad52/70/80 strain, rku-1. A B


Figure 3 . Plasmid DNA DSB repair assays reveal deficiencies in DSB rejoining in yku80 mutant strains. ( A ) Map of plasmid pBTM116 showing the locations of the yeast selectable marker TRP1 , the [beta]-lactamase gene, and the restriction enzyme cleavage sites relevant to the DSB repair assays. ( B ) Disruption of YKU80 results in dramatic decreases in the ability of yeast strains to repair cohesive DNA DSBs, both in the presence or absence of functional RAD52 . Competent cells for yeast strains of the indicated genotype were transformed in parallel with supercoiled pBTM116 and with pBTM116 that had been cleaved with Eco RI. Strain abbreviations are as in Figure 2. For each experiment, the value plotted is the number of transformants obtained with Eco RI linearised vector expressed as a percentage of the number obtained with supercoiled vector. Strains and transformant numbers (number for linearised plasmid/supercoiled plasmid) are as follows: Wt (wild-type), (104233/77132); yku80 ( yku80 mutant), (89382/2458); yku70 ( yku70 mutant), (94518/3024); rad52 ( rad52 mutant), (92211/37806); rad52/yku80 ( rad52 , yku80 double mutant), (88631/797); rad52/yku70 ( rad52 , yku70 double mutant), (85758/728). ( C ) Complementation of the plasmid repair defect of yku80 mutant strains with an episomal vector bearing the YKU80 gene. Assays were performed as in (B) using wild-type strain W303-1a (Wt), yku80 mutant strain yku80a (yku80), yku80 mutant strain yku80a containing plasmid p80FL that contains the full-length wild-type YKU80 gene, or yku80 mutant strain yku80a containing the parental vector pRS414. ( D ) YKU80 and YKU70 appear to function on the same DNA DSB repair pathway. Assays were conducted as in (B) using yku70 mutant strain yku70a (yku70); the yku80 mutant strain yku80a (yku80); or the yku70 , yku80 double mutant strain ku-1. The experiment was repeated at least three times for each strain and the error bars represent the range of values obtained from these experiments.

yku80 mutations lead to enhanced sensitivity to ionising radiation and MMS in rad52 mutant backgrounds

Since mammalian cell lines defective in Ku80 display heightened sensitivity towards agents that generate DNA strand breaks ( 14 , 15 ), we tested the sensitivity of yku80 mutant strains towards ionising radiation and towards the radiomimetic drug MMS. As measured by the ability of yeast cells to form colonies on solid media after treatment with ionising radiation or MMS, we were unable to detect statistically significant differences in rates of cell killing between yku80 mutant strains and their parents (Fig. 2 B and data not shown). However, in the course of these studies, we noted that MMS impairs the growth rate of yku80 mutant strains considerably more than that of parental yeasts and this is evident both in reduced colony size and survival on solid media, and in increased cell doubling times in liquid cultures. This suggests that mutations in YKU80 impair the ability of S.cerevisiae to cope with MMS-induced cellular damage.

Yeasts employ homologous recombination to repair DSBs under most circumstances. Consistent with this, loss of Yku70p activity significantly hypersensitises yeast strains to ionising radiation only when the homologous recombination apparatus is debilitated. To see whether this is also the case for the putative yeast Ku80 homologue, we assessed the effect of disrupting YKU80 in rad52 mutant backgrounds. Notably, as shown in Figure 2 B, mutations in YKU80 enhance substantially the radiosensitivity of rad52 mutant strains and this hypersensitisation is observed at all radiation doses tested. Similarly, the MMS sensitivity of rad52 mutant strains is elevated significantly when YKU80 is inactivated. By contrast, inactivation of YKU80 does not result in detectable increases in sensitivity towards agents such as ultraviolet light, which do not generate DNA DSBs as the principal lethal lesion (data not shown). Together, these results reveal that YKU80 is involved in the repair of ionising radiation-induced or MMS- induced DNA strand breaks by a RAD52 -independent pathway, and are consistent with YKU80 encoding a functional homologue of mammalian Ku80.

The phenotypes of yku80 mutant strains described above are very similar to those reported for strains disrupted in YKU70 ( 20 - 23 ). Although this is consistent with Yku70p and Yku80p functioning in the same pathway, an alternative explanation is that YKU70 and YKU80 define two distinct RAD52 -independent DNA DSB repair systems. To distinguish between these possibilities, we determined whether mutations in YKU70 and YKU80 synergistically affect the sensitivity of rad52 mutant yeasts towards DNA damaging agents. Importantly, rad52 mutant strains defective in both YKU70 and YKU80 are not more sensitive towards ionising radiation or towards MMS than are rad52 strains mutant for YKU70 or YKU80 alone (Fig. 2 B and data not shown). These data therefore imply that YKU70 and YKU80 operate in the same DNA repair pathway, and are consistent with a model in which Yku70p and Yku80p function in a heterodimeric complex, as is the case for their mammalian counterparts.

yku80 mutant strains are defective in plasmid rejoining in vivo

Previous studies have revealed that mammalian cells impaired in Ku function are deficient in the rejoining of radiation-induced DSBs of chromosomal DNA ( 29 , 30 ). To determine whether S.cerevisiae Ku also functions in DSB repair, we utilised a transformation-based plasmid rejoining assay that measures the ability of yeast cells to repair restriction enzyme generated DSBs in vivo . In this assay, a S.cerevisiae strain is transformed with a yeast- E.coli shuttle plasmid that has been linearised by treatment with a restriction enzyme. To normalise for differences in transformation efficiency between strains and between repeats of the same experiment, a supercoiled version of the same plasmid is transformed into the yeast strain, in parallel. Since the plasmid must be recircularised in order to be propagated, the number of transformants obtained with the linear plasmid normalised to the number obtained with the supercoiled plasmid provides a quantitation of the ability of the yeast strain to mediate repair of the restriction enzyme-generated DSB. Figure 3 A is a representation of the plasmid, pBTM116, which is used in these experiments-to prevent the DSBs from becoming repaired by homologous recombination with the yeast genome, the sites for restriction enzyme cleavage of pBTM116 are within regions that are not homologous to chromosomal sequences.

Initially, we analysed the repair of linearised plasmid molecules bearing cohesive 5' overhanging termini that were generated by the restriction endonuclease, Eco RI. As shown in Figure 3 B, this type of DSB is repaired with high efficiency in wild-type yeast strains in that transformant yields with Eco RI linearised pBTM116 are over 70% of the values obtained with supercoiled plasmid. Consistent with RAD52 -dependent homologous recombination mechanisms playing only a minor role in DSB repair under these experimental circumstances, transformant yields with Eco RI linearised pBTM116 are decreased <2-fold in rad52 mutant strains (Fig. 3 B). In marked contrast, strains mutated in YKU80 show a dramatic 40-100-fold decrease in transformant recoveries with linearised DNA, and these effects are observed in both the presence or absence of functional RAD52 (Fig. 3 B). Demonstrating that this phenotype is not specific to Eco RI-generated DNA ends, very similar results are obtained with 5' overhanging ends created by Xho I cleavage and with 3' overhanging ends generated by the enzyme Pst I (data not shown). Furthermore, similar dramatic effects are observed with several independently derived yku80 mutant strains and with various other plasmids. As a further verification that the deficiency in plasmid repair in yku80 mutant strains is a direct consequence of mutations in YKU80 , this defect is complemented fully by p80FL, which directs the expression of full-length wild-type Yku80p, but is not complemented by the parental plasmid pRS414 (Fig. 3 C). Since transformation efficiencies with supercoiled plasmid DNA are unaffected by mutations in YKU80 (see Fig. 3 legend), these data imply that YKU80 is required for the efficient repair of cohesive DNA termini by a RAD52 -independent mechanism. Mutations in YKU70 and YKU80 have very similar effects in the plasmid repair assay (Fig. 3 A and B). Moreover, strains mutant in both YKU70 and YKU80 are no more impaired in plasmid repair than strains mutated for either YKU70 or YKU80 alone (Fig. 3 D). These data therefore support a model in which YKU70 and YKU80 function in the same DNA DSB repair pathway.

In the absence of functional YKU80 , plasmid repair operates through an error-prone pathway

To analyse the type(s) of DNA repair that requires Yku80p, repaired plasmids were recovered from rad52 mutant strains that either possessed or lacked functional YKU80 . These plasmids were shuttled into E.coli and were then analysed by restriction enzyme digestion and by DNA sequencing. Strikingly, of over 100 plasmids recovered from YKU80 strains, all had been repaired by the simple religation of the cohesive DNA termini. In stark contrast, every plasmid that was recovered from yku80 mutant strains had suffered deletion of terminal sequences and had been joined at sites corresponding to short direct repeat elements of 2-16 bp (Fig. 4 ). In some cases, plasmid repair products retrieved from yku80 mutant strains also possessed small insertions at the sites of joining. Together, these results reveal that Yku80p plays a crucial role in an illegitimate DSB repair pathway that is capable of rejoining cohesive DNA ends with very high efficiency and fidelity. Furthermore, they show that, in the absence of functional YKU80 , cohesive DNA ends cannot be repaired by simple end-joining. Instead, they are repaired by a relatively inefficient error-prone illegitimate recombination pathway that results in the deletion of terminal DNA sequences and the joining of the two DNA ends via short direct repeat motifs.


Figure 4 . In the absence of functional YKU80 , cohesive DNA termini are repaired by an inefficient error-prone DNA repair pathway that results in deletion of terminal sequences and the joining of two DNA ends via short direct repeat sequences. ( A ) Schematic representation of the relevant region of pBTM116 showing the relative locations of the multiple cloning site (MCS) bearing the Eco RI site, the two flanking Hin dIII sites, and the regions containing the ADH1 or TRP1 sequences (numbers alongside the Eco RI and Hin dIII sites are the distances of these elements from the left hand Hin dIII site). ( B ) Depiction of repair products generated upon the transformation of yku80 mutant strain yku80a with Eco RI-linearised pBTM116. Black bars represent sequences retained and gaps represent deleted sequences. In each case, joining had taken place at sites corresponding to short direct repeat elements in the DNA, which are shown on the right. Also indicated are the number of base pairs deleted from the left hand DNA terminus (5'), the right-hand DNA terminus (3') and the total length of the deletion (the right hand and left-hand orientations in regard to the Eco RI cleavage site are as depicted in the map of pBTM116 in Fig. 3A).


Figure 5 . Blunt ended DNA molecules are repaired inefficiently and YKU80 suppresses this type of repair process. ( A ) Repair of blunt-ended plasmid molecules is very inefficient in yeast cells. Plasmid repair assays were conducted as described in Figure 3 using wild-type (Wt) strain W303-1a and Sma I-linearised pBTM116. ( B ) Inactivation of YKU80 leads to enhanced repair of blunt-ended plasmid molecules. Plasmid repair assays were performed as in (A) using wild-type strain W303-1a or yku80 mutant strain yku80a, as indicated. The error bars represent the range of values obtained for each strain from at least three separate experiments. Analysis of the repaired plasmids derived from the wild-type and the yku80 mutant strain revealed that essentially all have acquired deletions similar to those that are generated from Eco RI cut pBTM116 in yku80 mutant strains.

Next, we turned our attentions to study the repair of pBTM116 that had been treated with the restriction enzyme Sma I, which yields blunt, non-cohesive, DNA termini. Notably, even in wild-type strains, this type of DNA end is repaired very inefficiently (Fig. 5 A). Significantly, however, and in dramatic contrast to the results obtained with cohesive DNA ends, the inactivation of YKU80 actually leads to a 5-10-fold increase in transformant yields with Sma I linearised pBTM116 (Fig. 5 B). Furthermore, this increase is observed both in the presence or absence of functional RAD52 (Fig. 5 B). That this increase in plasmid repair is a direct consequence of YKU80 disruption is evidenced by the effect being observed with several independently-derived yku80 mutant strains. Moreover, the phenotype is reversed when yku80 mutant strains are complemented by p80FL that expresses full-length wild-type Yku80p. When the repaired products of Sma I cleaved plasmid DNA were retrieved from YKU80 and yku80 strains, every one was found to have sustained terminal deletions and had been joined through short direct repeat sequences. These results therefore imply that, unlike linear plasmids bearing cohesive termini, blunt ended pBTM116 molecules generated by Sma I cleavage cannot be repaired efficiently by YKU80 -dependent direct end joining. Instead, these molecules can only be joined by the relatively inefficient YKU80 -independent error-prone DNA repair pathway. Furthermore, the fact that the repair of Sma I cleaved plasmid DNA is increased significantly in yku80 mutant strains implies that one function for Yku80p is to suppress this alternative mechanism of DSB repair (see Discussion).

Disruption of YKU80 leads to telomeric attrition

Recently, Porter et al. ( 31 ) have reported that inactivation of YKU70 leads to telomeric shortening. We therefore wished to determine whether telomeric length is altered as a consequence of YKU80 disruption. To address this question, genomic DNA was isolated from newly sporulated yku80 mutant strains, then this DNA was digested with the restriction enzyme Xho I and was subjected to Southern blot-hybridisation analysis using the radiolabelled oligonucleotide poly(dG-dT) 20 that hybridises to the telomeric repeat elements (consensus C 1-3 A; Fig. 6 A). Xho I cleaves within the sub-telomeric Y' region that is found in many S.cerevisiae telomeres (`Y'-type telomeres') and, in wild-type strains, generates a predominant terminal chromosomal fragment of ~1.3 kb that hybridises to poly(G-T) 20 ( 32 ; Fig. 6 A and B). In addition, several larger poly(G-T) 20 hybridising fragments are observed, which correspond to telomeric ends from the subset of telomeres (`X-type telomeres') that lack Y' regions (Fig. 6 B). Significantly, yeasts disrupted for YKU80 or YKU70 contain dramatically shortened telomeres (Fig. 6 B). Indeed, we estimate that the predominant telomeric product in Figure 6 B becomes reduced in size by ~300 bp, corresponding to a decrease of ~65-70% in the length of the region bearing the terminal repetitive elements. Consistent with this, the hybridisation intensity of poly(GT) 20 to the predominant telomeric fragment is reduced ~5-fold in yku80 mutant strains. In addition, a decrease is observed in both the hybridisation intensity and the length of several of the larger DNA fragments that hybridise to poly(GT) 20 , indicating that shortening also occurs at X-type telomeres. Similar reductions in telomeric length are observed in numerous independently-derived yku80 mutant strains (Fig. 6 B). Furthermore, the telomeric shortening phenotype is complemented fully when yku80 mutant yeasts are transformed with the plasmid p80FL, which contains the full-length, wild-type YKU80 gene (Fig. 6 C). Together, these data indicate that inactivation of Ku function in yeast leads to a dramatic decrease in telomeric length.

Over recent years, several S.cerevisiae genes have been identified that regulate telomere length. In many cases, the inactivation of such genes leads to progressive telomere shortening, and the full expression of the mutant phenotype generally requires sub-culturing for over 100 generations ( 33 , 34 , 35 ). To see whether this is the case for strains mutant in YKU80 , we measured telomeric lengths of newly-sporulated wild-type and yku80 mutant strains after they had been subcultured for 25, 50, 75 or 100 generations (Fig. 6 D). Significantly, these studies revealed that, upon inactivation of YKU80 , the reduction in size and hybridisation intensity of the predominant Y' band telomeric ends is complete after 25 cell division cycles. Similarly, the reduction in length and hybridisation intensity of X-type telomeric ends is also manifest fully after just 25 generations. These results indicate that, when YKU80 is inactivated, telomeric attrition occurs relatively rapidly until telomeres have been reduced to a certain size and that, after such a size has been reached, a new equilibrium is established such that telomere ends do not shorten further. Having analysed the kinetics of telomere shortening after YKU80 inactivation, we next assessed the rate of telomere lengthening when yku80 mutant strains are complemented by the wild-type YKU80 gene. Notably, full restoration of telomeric length to wild-type levels is attained after just 25 generations and, after this, no further telomeric lengthening is evident (Fig. 6 D). These data reveal that changes in yeast Ku activity lead to relatively rapid alterations in telomeric length.

DISCUSSION

In this paper, we have described the identification of sequences in the genomes of C.elegans and S.cerevisiae which encode for polypeptides that are related to mammalian Ku80. Furthermore, we have shown that the yeast gene is involved in illegitimate recombination and, therefore, appears to correspond to a bona fide Ku80 homologue. Our data are in line with those published very recently by Milne et al. ( 36 ). Together with recent work showing that the Ku70 homologues of S.cerevisiae and Drosophila melanogaster ( 37 ) are involved in DNA DSB repair, these data imply that the Ku-dependent illegitimate DSB repair apparatus is conserved throughout the eukaryotic kingdom. Consistent with homologous recombination playing a dominant role in DSB repair in yeasts, disruption YKU80 only leads to significantly elevated radiosensitivity in genetic backgrounds where homologous recombination is rendered inoperative. Nevertheless, through using a plasmid repair assay, we show that YKU80 plays a crucial role in illegitimate recombination reactions that result in the accurate rejoining of cohesive DNA termini. Furthermore, we are able to complement the plasmid repair defects of yku80 mutant strains with a plasmid bearing wild-type YKU80 . The establishment of a simple yet highly sensitive and reproducible complementation assay for Yku80p should greatly facilitate mutational studies directed at defining functionally important domains of this protein. In this regard, it will be of particular interest to examine the effects of mutating the regions of Ku80 which we have identified as being particularly highly conserved from yeast to man.


Figure 6 . Disruption of YKU80 leads to telomeric shortening. ( A ) Schematic representation of a yeast chromosomal arm, showing the locations of the centromeric and telomeric regions, and the relative positions of the (C 1-3 A) repeats, and the X and Y' elements. The restriction enzyme Xho I cleaves in the conserved Y' region that is present in most yeast telomeres, generating a series of chromosomal terminal fragments of around 1.3 kb in wild-type yeast strains. This fragment includes ~400 bp of repeating (C 1-3 A) sequences. ( B ) Disruption of YKU80 leads to a reduction in length of both Y'-type and X-type telomeres. Genomic DNA was isolated from wild-type (Wt), yku70 mutant (yku70), or four independently-derived yku80 mutant (yku80) strains that had been freshly sporulated and grown up in YPED media to saturation. Next, the DNA was digested with Xho I, electrophoresed on a 0.8% agarose gel, transferred to nitrocellulose, then hybridised to an [[alpha]- 32 P]poly(GT) 20 probe (see Methods). After removal of unbound probe, the locations of telomeric sequences were identified by autoradiography. Indicated are the locations of DNA size markers and of the Xho I-telomeric fragments derived from X-type and Y'-type chromosomal ends. ( C ) Complementation of the telomeric shortening phenotype of yku80 mutant strains by an episomal plasmid containing the full-length wild-type YKU80 gene. Assays were performed as in (B) using wild-type strain W303-1a (Wt), yku80 mutant strain yku80[alpha] (yku80), or yku80 mutant strain yku80[alpha] that had been transformed with p80FL. ( D ) Activation or inactivation of YKU80 results in relatively rapid changes in telomeric length. Assays were conducted as in (B) with genomic DNA that had been derived from the following yeast strains that had been grown for the indicated number of generations: a freshly sporulated wild-type YKU80 strain, a freshly-sporulated yku80 mutant strain, or a yku80 mutant strain that had been newly transformed with p80FL.

Through analysing the repair of restriction enzyme-generated DNA DSBs in yeast strains that possess or lack functional YKU80 , we have obtained evidence for at least two distinct illegitimate DSB repair pathways in S.cerevisiae . The first of these mediates the efficient and accurate rejoining of cohesive DNA termini. Although one might imagine that such events could be performed by ligase enzymes alone, our data indicate an absolute requirement for YKU80 . There are several possible mechanisms by which Ku could function in this type of repair. One possibility is that Ku binds to the two DNA ends and, either alone or in combination with other proteins, holds them in juxtaposition to facilitate their efficient ligation. Another is that Ku aids the recruitment of a DNA ligase by interacting directly or indirectly with this enzyme. A third possibility is that Ku prevents cohesive ends from being rendered non-cohesive by the action of exonucleases.

Perhaps surprisingly, we have found that Yku80p does not play a positive role in the rejoining of plasmid molecules bearing Sma I-generated blunt termini. Instead, the repair of these ends operates through an apparently distinct second pathway that is relatively inefficient and which results in illegitimate recombination between short direct repeats and the deletion of variable amounts of DNA. Repair products of this type are observed frequently in vertebrate systems ( 13 , 38 ), suggesting that a Ku-independent `error-prone' DNA repair apparatus is conserved highly throughout the eukaryotic lineage. Similar types of repair product have been observed previously in yeast, and it has been proposed that they may be generated through a single-strand annealing pathway ( 7 , 8 ). In this pathway, homologous base pairing between single-stranded regions, which are generated by exonuclease action, results in homologous recombination between repeated elements and the consequent loss of intervening DNA. Notably, abrogation of YKU80 function leads to higher levels of repair of Sma I-cleaved plasmid molecules via the error-prone pathway, and cohesive DNA ends are repaired by the error-prone pathway only in the absence of Yku80p. This suggests that, in addition to functioning positively in promoting accurate DSB repair, the binding of Ku to DNA termini also serves to suppress error-prone DNA repair. In light of this, it will be of great interest to determine whether abrogation of Ku function leads to higher rates of spontaneous and/or radiation-induced mutagenesis in S.cerevisiae .

In mammalian systems, Ku associates with DNA-PK cs , to form a protein kinase which is activated by DNA DSBs ( 39 , 40 ). As with Ku-deficient cells, mammalian cells defective in DNA-PK cs are hypersensitive to ionising radiation and are impaired in DNA DSB rejoining. Because of the conservation of Ku from yeast to man, it may be that yeast Ku interacts with an S.cerevisiae DNA-PK cs homologue. However, despite the entire S.cerevisiae genome having been sequenced, we have been unable to identify an ORF that appears to encode for a DNA-PK cs homologue. One explanation for this is that Ku potentiates DSB repair in mammalian systems by multiple mechanisms-some DNA-PK cs dependent, some DNA-PK cs independent-and only those functions that do not require associations with DNA-PK cs have been conserved in yeast. Alternatively, it is possible that Ku does function fully analogously in yeast and mammalian systems but that the roles performed by DNA-PK cs have become assumed by other molecules. In this regard, it is noteworthy that S.cerevisiae possesses several proteins that are related to DNA-PK cs and two of these, Mec1p and Tel1p, have been implicated in DNA repair and DNA damage sensing pathways ( 41 - 43 ).

Significantly, we find that yku80 mutant yeasts display dramatic telomeric attrition, showing that Ku plays a crucial role in telomeric maintenance. Although other mechanisms cannot be excluded, the ability of Ku to interact with DNA DSBs and with other discontinuities in the DNA double-helix suggests strongly that it functions by binding directly to telomeric DNA. Once positioned on a telomere, there are several, not necessarily mutually exclusive, mechanisms by which Ku could function. One attractive scenario is that Ku serves as a cofactor for telomerase. Although we feel it unlikely that Ku is an essential subunit of this enzyme, it is possible that Ku helps telomerase to gain access to the chromosomal termini. For example, Ku might enhance telomerase recruitment by interacting directly or indirectly with this enzyme. Alternatively, Ku could prevent other DNA-binding proteins from binding to telomeric ends and rendering these sequences inaccessible to telomerase. Another way that Ku might function is by binding to chromosomal ends and protecting them from nuclease attack. This model is particularly appealing in light of the fact that Yku80p suppresses the deletion of terminal sequences in plasmid repair assays. An additional possibility is that Ku recruits other proteins to telomeric DNA, and it is the action of these proteins that results in telomere stabilisation. In this regard, it is notable that inactivation of the DNA-PK cs relative Tel1p results in telomeric shortening. Furthermore, premature telomeric shortening is observed in cells from human patients with the neurodegenerative and cancer predisposition syndrome ataxia-telangiectasia, which is caused by a deficiency in the human Tel1p/Mec1p homologue, ATM ( 44 , 45 ). In light of these observations, it will be interesting to determine whether yeast Ku interacts with Mec1p or Tel1p. If such complexes correspond to telomeric DNA-activated protein kinases, then they could provide a simple yet effective system for sensing telomeric length. Finally, it is of interest to note that the binding of Ku to DNA DSBs, either alone or in association with DNA-PK cs , can lead to repression of transcription from adjacent sequences ( 46 , 47 ). Since it is well established that telomeres exert strong negative influences on transcription ( 48 - 52 ), it is possible that part of this repression might occur through Ku-dependent mechanisms.

ACKNOWLEDGEMENTS

We thank J. Murray for yeast strain GY1, D. Weaver for RAD52 -disrupted yeast strains, A. Bannister for pEG202fos, H. Feldmann and E. L. Winnacker for Yku70p-deficient yeast strains, and S. Fields for pBTM116. Thanks also to members of the SPJ laboratory for their advice and critical comments on this work and especially to Graeme Smith and David Gell for help with the protein sequence alignment. SJB is supported by a studentship from the Cancer Research Campaign. The research described in this manuscript was made possible by a grant from the Kay Kendall Leukaemia Fund and by grants SP2143/0101, SP2143/0201 and SP2143/0401 from the Cancer Research Campaign.

REFERENCES

1 Friedberg,E.C., Walker,G.C. and Siede,W. (1995) DNA Repair and Mutagenesis. Washington, DC, American Society for Microbiology, pp. 662-669.

2 Shinohara,A. and Ogawa,T. (1995) Trends Biochem. Sci. 20, 387-391. MEDLINE Abstract

3 Shinohara,A., Ogawa,H., Matsuda,Y., Ushio,N., Ikeo,K. and Ogawa,T. (1993) Nature Genet. 4, 239-243. MEDLINE Abstract

4 Benson,F.E., Stasiak,A. and West,S.C. (1994) EMBO J. 13, 5764-5771. MEDLINE Abstract

5 Park,M.S. (1995) J. Biol. Chem. 270, 15467-15470. MEDLINE Abstract

6 Deng,C. and Capecchi,M.R. (1992) Mol. Cell. Biol. 12, 3365-3371. MEDLINE Abstract

7 Fishman-Lobell,J., Rudin,N. and Haber,J.E. (1992) Mol. Cell Biol. 12, 1292-1303.

8 Ivanov,E.L., Sugawara,N., Fishman-Lobell,J. and Haber,J.E. (1996) Genetics 142, 693-704. MEDLINE Abstract

9 Schiestl,R.H., Zhu,J. and Petes,T.D. (1994) Mol. Cell Biol. 14, 4493-4500. MEDLINE Abstract

10 Orr-Weaver,T.L. and Szostak,J.W. (1983) Proc. Natl. Acad. Sci. USA. 80, 4417-4421.

11 Kramer,K.M., Brock,J.A., Bloom,K., Moore,K. and Haber,J.E. (1994) Mol. Cell Biol. 14, 1293-1301. MEDLINE Abstract

12 Mezard,C. and Nicolas,A. (1994) Mol. Cell. Biol. 14, 1278-1292. MEDLINE Abstract

13 Roth,D.B. and Wilson,J.H. (1986) Mol. Cell Biol. 6, 4295-4304. MEDLINE Abstract

14 Jackson,S.P. and Jeggo,P.A. (1995) Trends Biochem. Sci. 20, 412-415. MEDLINE Abstract

15 Jeggo,P.A., Taccioli,G.E. and Jackson,S.P. (1995) BioEssays 17, 949-957. MEDLINE Abstract

16 Roth,D.B., Lindahl,T. and Gellert,M. (1995) Curr. Biol. 5, 496-499. MEDLINE Abstract

17 Blunt,T., Finnie,N.J., Taccioli,G.E., Smith,G.C.M., Demengeot,J., Gottlieb,T.M., Mizuta,R., Varghese,A.J., Alt,F.W., Jeggo,P.A. and Jackson,S.P. (1995) Cell 80, 813-823. MEDLINE Abstract

18 Kirchgessner,C.U., Patil,C.K., Evans,J.W., Carter,T. and Brown,J.M. (1995) Science 267, 1178-1182. MEDLINE Abstract

19 Peterson,S.R., Kurimasa,A., Oshimura,M., Dynan,W.S., Bradbury,E.M. and Chen,D.J. (1995) Proc. Natl. Acad. Sci. USA. 92, 3171-3174. MEDLINE Abstract

20 Feldmann,H. and Winnacker,E.L. (1993) J. Biol. Chem. 268, 12895-12900. MEDLINE Abstract

21 Boulton,S.J. and Jackson,S.P. (1996) EMBO J. 15, 5093-5103. MEDLINE Abstract

22 Mages,G.J., Feldmann,H.M. and Winnacker,E.-L. (1996) J. Biol. Chem 271, 7910-7915. MEDLINE Abstract

23 Siede,W., Friedl,A.A., Dianova,I., Eckardt-Schpp,F. and Friedberg,E.C. (1996) Genetics 142, 91-102. MEDLINE Abstract

24 Sherman,F., Fink,G.R. and Laurence,C. (1979) Methods in Yeast Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.

25 Milne,G.T. and Weaver,D.T. (1993) Genes Dev. 7, 1755-1765. MEDLINE Abstract

26 Schiestl,R.H. and Gietz,R.D. (1989) Curr. Genet. 16, 339-346. MEDLINE Abstract

27 Ausubel,F.M., Brent,R., Kingston,R.E., Moore,D.D., Seidman,J.G., Smith,J.A. and Struhl,K. (1991). Current Protocols in Molecular Biology. J. Wiley & Sons.

28 Rothstein,R. (1991) Meth. Enzymol. 194, 281-301. MEDLINE Abstract

29 Kemp,L.M., Sedgwick,S.G. and Jeggo,P.A. (1984) Mut. Res. 132, 189-196.

30 Weibezahn,K.F., Lohrer,H. and Herrlich,P. (1985) Mut. Res. 145, 177-183.

31 Porter,S.E., Greenwell,P.W., Ritchie,K.B. and Petes,T.D. (1996) Nucleic Acids Res. 24, 582-585. MEDLINE Abstract

32 Chan,C.S.M. and Tye,B.-K. (1983) Cell 33, 563-573.

33 Lustig,A.J. and Petes,T.D. (1986) Proc. Natl. Acad. Sci. USA. 83, 1398-1402. MEDLINE Abstract

34 Lundblad,V. and Szostak,J.W. (1989) Cell 57, 633-643. MEDLINE Abstract

35 Liu,Z., Lee,A. and Gilbert,W. (1995) Proc. Natl. Acad. Sci. USA 92, 6002-6006. MEDLINE Abstract

36 Beall,E.L. and Rio,D.C. (1996). Genes Dev. 10, 921-933.

37 Milne,G.T., Jin,S., Shannon,K.B. and Weaver,D.T. (1996). Mol. Cell. Biol., 16, 4189-4198.

38 Thacker,J., Chalk,J., Ganesh,A. and North,P. (1992) Nucleic Acids Res. 20, 6183-6188. MEDLINE Abstract

39 Dvir,A., Stein,L.Y., Calore,B.L. and Dynan,W.S. (1993) J. Biol. Chem. 268, 10440-10447. MEDLINE Abstract

40 Gottlieb,T.M. and Jackson,S.P. (1993) Cell 72, 131-142. MEDLINE Abstract

41 Jackson,S.P. (1995) Curr. Biol. 5, 1210-1212. MEDLINE Abstract

42 Keith,C.T. and Schreiber,S.L. (1995) Science 270, 50-51. MEDLINE Abstract

43 Zakian,V.A. (1995) Cell 82, 685-687. MEDLINE Abstract

44 Pandita,T.K., Pathak,S. and Geard,C.R. (1995) Cytogenet. Cell Genet. 71, 86-93. MEDLINE Abstract

45 Metcalfe,J.A., Parkhill,J., Campbell,L., Stacey,M., Biggs,P., Byrd,P. J. and Taylor,M.R. (1996) Nature Genet. 13, 350-352. MEDLINE Abstract

46 Kuhn,A., Gottlieb,T.M., Jackson,S.P. and Grummt,I. (1995) Genes Dev. 9, 193-203. MEDLINE Abstract

47 Labhart,P. (1995) Proc. Natl. Acad. Sci. USA. 92.

48 Gottschling,D.E., Aparicio,O.M., Billington,B.L. and Zakian,V.A. (1990) Cell 63, 751-762. MEDLINE Abstract

49 Kyrion,G., Liu,K., Liu,C. and Lustig,A.J. (1993) Genes Dev. 7, 1146-1159. MEDLINE Abstract

50 Renauld,H., Aparicio,O.M., Zierath,P.D., Billington,B.L., Chhablani,S.K. and Gottschling,D.E. (1993) Genes Dev. 7, 1133-1145. MEDLINE Abstract

51 Buck,S.W. and Shore,D. (1995) Genes Dev. 9, 370-384. MEDLINE Abstract

52 Hecht,A., Laroche,T., Strahl-Bolsinger,S., Gasser,S.M. and Grunstein,M. (1995) Cell 80, 583-592. MEDLINE Abstract


Return

*To whom correspondence should be addressed. Tel: +44 1223 334 102; Fax: +44 1223 334 089; Email: spj13@mole.bio.cam.ac.uk
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
GeneticsHome page
M. Chang, B. Luke, C. Kraft, Z. Li, M. Peter, J. Lingner, and R. Rothstein
Telomerase Is Essential to Alleviate Pif1-Induced Replication Stress at Telomeres
Genetics, November 1, 2009; 183(3): 779 - 791.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. Xu, R. C. Petreaca, H. J. Gasparyan, S. Vu, and C. I. Nugent
TEN1 Is Essential for CDC13-Mediated Telomere Capping
Genetics, November 1, 2009; 183(3): 793 - 810.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T.-J. Wu, Y.-H. Chiang, Y.-C. Lin, C.-R. Tsai, T.-Y. Yu, M.-T. Sung, Y.-H. W. Lee, and J.-J. Lin
Sequential Loading of Saccharomyces cerevisiae Ku and Cdc13p to Telomeres
J. Biol. Chem., May 8, 2009; 284(19): 12801 - 12808.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
L. L. Rosas-Hernandez, A. Juarez-Reyes, O. E. Arroyo-Helguera, A. De Las Penas, S.-J. Pan, B. P. Cormack, and I. Castano
yKu70/yKu80 and Rif1 Regulate Silencing Differentially at Telomeres in Candida glabrata
Eukaryot. Cell, December 1, 2008; 7(12): 2168 - 2178.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
J. Franke, J. Gehlen, and A. E. Ehrenhofer-Murray
Hypermethylation of yeast telomerase RNA by the snRNA and snoRNA methyltransferase Tgs1
J. Cell Sci., November 1, 2008; 121(21): 3553 - 3560.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. R. Lowden, B. Meier, T. W.-s. Lee, J. Hall, and S. Ahmed
End Joining at Caenorhabditis elegans Telomeres
Genetics, October 1, 2008; 180(2): 741 - 754.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
F. Conde and P. A. San-Segundo
Role of Dot1 in the Response to Alkylating DNA Damage in Saccharomyces cerevisiae: Regulation of DNA Damage Tolerance by the Error-Prone Polymerases Pol{zeta}/Rev1
Genetics, July 1, 2008; 179(3): 1197 - 1210.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. A. Mondoux, J. G. Scaife, and V. A. Zakian
Differential Nuclear Localization Does Not Determine the Silencing Status of Saccharomyces cerevisiae Telomeres
Genetics, December 1, 2007; 177(4): 2019 - 2029.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
D. S. Wei and Y. S. Rong
A Genetic Screen For DNA Double-Strand Break Repair Mutations in Drosophila
Genetics, September 1, 2007; 177(1): 63 - 77.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
N. C. Stephanou, F. Gao, P. Bongiorno, S. Ehrt, D. Schnappinger, S. Shuman, and M. S. Glickman
Mycobacterial Nonhomologous End Joining Mediates Mutagenic Repair of Chromosomal Double-Strand DNA Breaks
J. Bacteriol., July 15, 2007; 189(14): 5237 - 5246.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
K. Ueno, J. Uno, H. Nakayama, K. Sasamoto, Y. Mikami, and H. Chibana
Development of a Highly Efficient Gene Targeting System Induced by Transient Repression of YKU80 Expression in Candida glabrata
Eukaryot. Cell, July 1, 2007; 6(7): 1239 - 1247.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
R. S. Maser, K.-K. Wong, E. Sahin, H. Xia, M. Naylor, H. M. Hedberg, S. E. Artandi, and R. A. DePinho
DNA-Dependent Protein Kinase Catalytic Subunit Is Not Required for Dysfunctional Telomere Fusion and Checkpoint Response in the Telomerase-Deficient Mouse
Mol. Cell. Biol., March 15, 2007; 27(6): 2253 - 2265.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. Valencia-Burton, M. Oki, J. Johnson, T. A. Seier, R. Kamakaka, and J. E. Haber
Different Mating-Type-Regulated Genes Affect the DNA Repair Defects of Saccharomyces RAD51, RAD52 and RAD55 Mutants
Genetics, September 1, 2006; 174(1): 41 - 55.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
J. C. Game, M. S. Williamson, T. Spicakova, and J. M. Brown
The RAD6/BRE1 Histone Modification Pathway in Saccharomyces Confers Radiation Resistance Through a RAD51-Dependent Process That Is Independent of RAD18
Genetics, August 1, 2006; 173(4): 1951 - 1968.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
M. Malik, K. C. Nitiss, V. Enriquez-Rios, and J. L. Nitiss
Roles of nonhomologous end-joining pathways in surviving topoisomerase II-mediated DNA damage.
Mol. Cancer Ther., June 1, 2006; 5(6): 1405 - 1414.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. Kegel, P. Martinez, S. D. Carter, and S. U. Astrom
Genome wide distribution of illegitimate recombination events in Kluyveromyces lactis
Nucleic Acids Res., March 20, 2006; 34(5): 1633 - 1645.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. L. Palmbos, J. M. Daley, and T. E. Wilson
Mutations of the Yku80 C Terminus and Xrs2 FHA Domain Specifically Block Yeast Nonhomologous End Joining
Mol. Cell. Biol., December 15, 2005; 25(24): 10782 - 10790.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. Corda, S. E. Lee, S. Guillot, A. Walther, J. Sollier, A. Arbel-Eden, J. E. Haber, and V. Geli
Inactivation of Ku-Mediated End Joining Suppresses mec1{Delta} Lethality by Depleting the Ribonucleotide Reductase Inhibitor Sml1 through a Pathway Controlled by Tel1 Kinase and the Mre11 Complex
Mol. Cell. Biol., December 1, 2005; 25(23): 10652 - 10664.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Tanaka, M. S. Mendonca, P. S. Bradshaw, D. J. Hoelz, L. H. Malkas, M. S. Meyn, and D. Gilley
DNA damage-induced phosphorylation of the human telomere-associated protein TRF2
PNAS, October 25, 2005; 102(43): 15539 - 15544.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Liang, L. Deng, Y. Chen, G. C. Li, C. Shao, and J. A. Tischfield
Modulation of DNA End Joining by Nuclear Proteins
J. Biol. Chem., September 9, 2005; 280(36): 31442 - 31449.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-B. Chen, C.-P. Yang, R.-X. Li, R. Zeng, and J.-Q. Zhou
Def1p Is Involved in Telomere Maintenance in Budding Yeast
J. Biol. Chem., July 1, 2005; 280(26): 24784 - 24791.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
E. Y. Shim, J.-L. Ma, J.-H. Oum, Y. Yanez, and S. E. Lee
The Yeast Chromatin Remodeler RSC Complex Facilitates End Joining Repair of DNA Double-Strand Breaks
Mol. Cell. Biol., May 15, 2005; 25(10): 3934 - 3944.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. Melnikova, H. Biessmann, and P. Georgiev
The Ku Protein Complex Is Involved in Length Regulation of Drosophila Telomeres
Genetics, May 1, 2005; 170(1): 221 - 235.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
L. J. Barber, T. A. Ward, J. A. Hartley, and P. J. McHugh
DNA Interstrand Cross-Link Repair in the Saccharomyces cerevisiae Cell Cycle: Overlapping Roles for PSO2 (SNM1) with MutS Factors and EXO1 during S Phase
Mol. Cell. Biol., March 15, 2005; 25(6): 2297 - 2309.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. M. Daley and T. E. Wilson
Rejoining of DNA Double-Strand Breaks as a Function of Overhang Length
Mol. Cell. Biol., February 1, 2005; 25(3): 896 - 906.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
R. J. Romeijn, M. M. Gorski, M. A. van Schie, J. N. Noordermeer, L. H. Mullenders, W. Ferro, and A. Pastink
Lig4 and Rad54 Are Required for Repair of DNA Double-Strand Breaks Induced by P-Element Excision in Drosophila
Genetics, February 1, 2005; 169(2): 795 - 806.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Chen, K. M. Trujillo, S. Van Komen, D. H. Roh, L. Krejci, L. K. Lewis, M. A. Resnick, P. Sung, and A. E. Tomkinson
Effect of Amino Acid Substitutions in the Rad50 ATP Binding Domain on DNA Double Strand Break Repair in Yeast
J. Biol. Chem., January 28, 2005; 280(4): 2620 - 2627.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
C. J. Janzen, F. Lander, O. Dreesen, and G. A. M. Cross
Telomere length regulation and transcriptional silencing in KU80-deficient Trypanosoma brucei
Nucleic Acids Res., December 15, 2004; 32(22): 6575 - 6584.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. McVey, D. Radut, and J. J. Sekelsky
End-Joining Repair of Double-Strand Breaks in Drosophila melanogaster Is Largely DNA Ligase IV Independent
Genetics, December 1, 2004; 168(4): 2067 - 2076.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. N. Karamysheva, Y. V. Surovtseva, L. Vespa, E. V. Shakirov, and D. E. Shippen
A C-terminal Myb Extension Domain Defines a Novel Family of Double-strand Telomeric DNA-binding Proteins in Arabidopsis
J. Biol. Chem., November 12, 2004; 279(46): 47799 - 47807.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L.-Y. Hao, M. A. Strong, and C. W. Greider
Phosphorylation of H2AX at Short Telomeres in T Cells and Fibroblasts
J. Biol. Chem., October 22, 2004; 279(43): 45148 - 45154.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
F. d'Adda di Fagagna, S.-H. Teo, and S. P. Jackson
Functional links between telomeres and proteins of the DNA-damage response
Genes & Dev., August 1, 2004; 18(15): 1781 - 1799.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Seluanov, D. Mittelman, O. M. Pereira-Smith, J. H. Wilson, and V. Gorbunova
DNA end joining becomes less efficient and more error-prone during cellular senescence
PNAS, May 18, 2004; 101(20): 7624 - 7629.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
T. D. McKnight and D. E. Shippen
Plant Telomere Biology
PLANT CELL, April 1, 2004; 16(4): 794 - 803.
[Full Text] [PDF]


Home page
GeneticsHome page
A. A. Bertuch and V. Lundblad
EXO1 Contributes to Telomere Maintenance in Both Telomerase-Proficient and Telomerase-Deficient Saccharomyces cerevisiae
Genetics, April 1, 2004; 166(4): 1651 - 1659.
[Abstract] [Full Text] [PDF]


Home page
MutagenesisHome page
P.A. Cahill, A.W. Knight, N. Billinton, M.G. Barker, L. Walsh, P.O. Keenan, C.V. Williams, D.J. Tweats, and R.M. Walmsley
The GreenScreen(R) genotoxicity assay: a screening validation programme
Mutagenesis, March 1, 2004; 19(2): 105 - 119.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Jazayeri, A. D. McAinsh, and S. P. Jackson
Saccharomyces cerevisiae Sin3p facilitates DNA double-strand break repair
PNAS, February 10, 2004; 101(6): 1644 - 1649.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Smolikov, Y. Mazor, and A. Krauskopf
ELG1, a regulator of genome stability, has a role in telomere length regulation and in silencing
PNAS, February 10, 2004; 101(6): 1656 - 1661.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Yu, K. Marshall, M. Yamaguchi, J. E. Haber, and C. F. Weil
Microhomology-Dependent End Joining and Repair of Transposon-Induced DNA Hairpins by Host Factors in Saccharomyces cerevisiae
Mol. Cell. Biol., February 1, 2004; 24(3): 1351 - 1364.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
X. Yu and A. Gabriel
Reciprocal Translocations in Saccharomyces cerevisiae Formed by Nonhomologous End Joining
Genetics, February 1, 2004; 166(2): 741 - 751.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Roy, B. Meier, A. D. McAinsh, H. M. Feldmann, and S. P. Jackson
Separation-of-function Mutants of Yeast Ku80 Reveal a Yku80p-Sir4p Interaction Involved in Telomeric Silencing
J. Biol. Chem., January 2, 2004; 279(1): 86 - 94.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J.-L. Ma, E. M. Kim, J. E. Haber, and S. E. Lee
Yeast Mre11 and Rad1 Proteins Define a Ku-Independent Mechanism To Repair Double-Strand Breaks Lacking Overlapping End Sequences
Mol. Cell. Biol., December 1, 2003; 23(23): 8820 - 8828.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. M. Gorski, J. C. J. Eeken, A. W. M. de Jong, I. Klink, M. Loos, R. J. Romeijn, B. L. van Veen, L. H. Mullenders, W. Ferro, and A. Pastink
The Drosophila melanogaster DNA Ligase IV Gene Plays a Crucial Role in the Repair of Radiation-Induced DNA Double-Strand Breaks and Acts Synergistically With Rad54
Genetics, December 1, 2003; 165(4): 1929 - 1941.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. A. Bertuch and V. Lundblad
The Ku Heterodimer Performs Separable Activities at Double-Strand Breaks and Chromosome Termini
Mol. Cell. Biol., November 15, 2003; 23(22): 8202 - 8215.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
A. A. Bertuch and V. Lundblad
Which end: dissecting Ku's function at telomeres and double-strand breaks
Genes & Dev., October 1, 2003; 17(19): 2347 - 2350.
[Full Text] [PDF]


Home page
Genes Dev.Home page
A. E. Stellwagen, Z. W. Haimberger, J. R. Veatch, and D. E. Gottschling
Ku interacts with telomerase RNA to promote telomere addition at native and broken chromosome ends
Genes & Dev., October 1, 2003; 17(19): 2384 - 2395.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
H. Wang, A. R. Perrault, Y. Takeda, W. Qin, H. Wang, and G. Iliakis
Biochemical evidence for Ku-independent backup pathways of NHEJ
Nucleic Acids Res., September 15, 2003; 31(18): 5377 - 5388.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
T. Kibe, K. Tomita, A. Matsuura, D. Izawa, T. Kodaira, T. Ushimaru, M. Uritani, and M. Ueno
Fission yeast Rhp51 is required for the maintenance of telomere structure in the absence of the Ku heterodimer
Nucleic Acids Res., September 1, 2003; 31(17): 5054 - 5063.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
V. Viscardi, E. Baroni, M. Romano, G. Lucchini, and M. P. Longhese
Sudden Telomere Lengthening Triggers a Rad53-dependent Checkpoint in Saccharomyces cerevisiae
Mol. Biol. Cell, August 1, 2003; 14(8): 3126 - 3143.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
H. van Attikum, P. Bundock, R. M. Overmeer, L.-Y. Lee, S. B. Gelvin, and P. J. J. Hooykaas
The Arabidopsis AtLIG4 gene is required for the repair of DNA damage, but not for the integration of Agrobacterium T-DNA
Nucleic Acids Res., July 15, 2003; 31(14): 4247 - 4255.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Lucero, D. Gae, and G. E. Taccioli
Novel Localization of the DNA-PK Complex in Lipid Rafts: A PUTATIVE ROLE IN THE SIGNAL TRANSDUCTION PATHWAY OF THE IONIZING RADIATION RESPONSE
J. Biol. Chem., June 6, 2003; 278(24): 22136 - 22143.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. Smith, E. Riballo, B. Kysela, C. Baldeyron, K. Manolis, C. Masson, M. R. Lieber, D. Papadopoulo, and P. Jeggo
Impact of DNA ligase IV on the fidelity of end joining in human cells
Nucleic Acids Res., April 15, 2003; 31(8): 2157 - 2167.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
X. Yu and A. Gabriel
Ku-Dependent and Ku-Independent End-Joining Pathways Lead to Chromosomal Rearrangements During Double-Strand Break Repair in Saccharomyces cerevisiae
Genetics, March 1, 2003; 163(3): 843 - 856.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
M. E. Gallego, N. Jalut, and C. I. White
Telomerase Dependence of Telomere Lengthening in ku80 Mutant Arabidopsis
PLANT CELL, March 1, 2003; 15(3): 782 - 789.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Miyoshi, M. Sadaie, J. Kanoh, and F. Ishikawa
Telomeric DNA Ends Are Essential for the Localization of Ku at Telomeres in Fission Yeast
J. Biol. Chem., January 10, 2003; 278(3): 1924 - 1931.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
D. Matheos, O. Novac, G. B. Price, and M. Zannis-Hadjopoulos
Analysis of the DNA replication competence of the xrs-5 mutant cells defective in Ku86
J. Cell Sci., January 1, 2003; 116(1): 111 - 124.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Chai, L. P. Ford, L. Lenertz, W. E. Wright, and J. W. Shay
Human Ku70/80 Associates Physically with Telomerase through Interaction with hTERT
J. Biol. Chem., November 27, 2002; 277(49): 47242 - 47247.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-M. Tseng and A. E. Tomkinson
A Physical and Functional Interaction between Yeast Pol4 and Dnl4-Lif1 Links DNA Synthesis and Ligation in Nonhomologous End Joining
J. Biol. Chem., November 15, 2002; 277(47): 45630 - 45637.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. K. Mauldin, R. C. Getts, W. Liu, and T. D. Stamato
DNA-PK-dependent binding of DNA ends to plasmids containing nuclear matrix attachment region DNA sequences: evidence for assembly of a repair complex
Nucleic Acids Res., September 15, 2002; 30(18): 4075 - 4087.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y.-L. Tsai, S.-F. Tseng, S.-H. Chang, C.-C. Lin, and S.-C. Teng
Involvement of Replicative Polymerases, Tel1p, Mec1p, Cdc13p, and the Ku Complex in Telomere-Telomere Recombination
Mol. Cell. Biol., August 15, 2002; 22(16): 5679 - 5687.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
F. Delacote, M. Han, T. D. Stamato, M. Jasin, and B. S. Lopez
An xrcc4 defect or Wortmannin stimulates homologous recombination specifically induced by double-strand breaks in mammalian cells
Nucleic Acids Res., August 1, 2002; 30(15): 3454 - 3463.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
L. Maringele and D. Lydall
EXO1-dependent single-stranded DNA at telomeres activates subsets of DNA damage and spindle checkpoint pathways in budding yeast yku70Delta mutants
Genes & Dev., August 1, 2002; 16(15): 1919 - 1933.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
C. Wei, R. Skopp, M. Takata, S. Takeda, and C. M. Price
Effects of double-strand break repair proteins on vertebrate telomere structure
Nucleic Acids Res., July 1, 2002; 30(13): 2862 - 2870.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. L. DuBois, Z. W. Haimberger, M. W. McIntosh, and D. E. Gottschling
A Quantitative Assay for Telomere Protection in Saccharomyces cerevisiae
Genetics, July 1, 2002; 161(3): 995 - 1013.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
S. P. Jackson
Sensing and repairing DNA double-strand breaks
Carcinogenesis, May 1, 2002; 23(5): 687 - 696.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Gravel and R. J. Wellinger
Maintenance of Double-Stranded Telomeric Repeats as the Critical Determinant for Cell Viability in Yeast Cells Lacking Ku
Mol. Cell. Biol., April 1, 2002; 22(7): 2182 - 2193.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
P. Grandi, M. Eltsov, I. Nielsen, and I. Raska
DNA double-strand breaks induce formation of RP-A/Ku foci on in vitro reconstituted Xenopus sperm nuclei
J. Cell Sci., March 11, 2002; 114(18): 3345 - 3357.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. Huang and W. S. Dynan
Reconstitution of the mammalian DNA double-strand break end-joining reaction reveals a requirement for an Mre11/Rad50/NBS1-containing fraction
Nucleic Acids Res., February 1, 2002; 30(3): 667 - 674.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
C. K. Raymond, E. H. Sims, and M. V. Olson
Linker-Mediated Recombinational Subcloning of Large DNA Fragments Using Yeast
Genome Res., January 1, 2002; 12(1): 190 - 197.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
M. Frank-Vaillant and S. Marcand
NHEJ regulation by mating type is exercised through a novel protein, Lif2p, essential to the Ligase IV pathway
Genes & Dev., November 15, 2001; 15(22): 3005 - 3012.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
D. A. Thrower and K. Bloom
Dicentric Chromosome Stretching during Anaphase Reveals Roles of Sir2/Ku in Chromatin Compaction in Budding Yeast
Mol. Biol. Cell, September 1, 2001; 12(9): 2800 - 2812.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. B. Bennett, J. R. Snipe, J. W. Westmoreland, and M. A. Resnick
SIR Functions Are Required for the Toleration of an Unrepaired Double-Strand Break in a Dispensable Yeast Chromosome
Mol. Cell. Biol., August 15, 2001; 21(16): 5359 - 5373.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
E. Samper, F. A. Goytisolo, J. M.-d. Murcia, E. Gonzalez-Suarez, J. C. Cigudosa, G. de Murcia, and M. A. Blasco
Normal telomere length and chromosomal end capping in poly(ADP-ribose) polymerase-deficient mice and primary cells despite increased chromosomal instability
J. Cell Biol., July 9, 2001; 154(1): 49 - 60.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
B. Meier, L. Driller, S. Jaklin, and H. M. Feldmann
New Function of CDC13 in Positive Telomere Length Regulation
Mol. Cell. Biol., July 1, 2001; 21(13): 4233 - 4245.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
F. A. Goytisolo, E. Samper, S. Edmonson, G. E. Taccioli, and M. A. Blasco
The Absence of the DNA-Dependent Protein Kinase Catalytic Subunit in Mice Results in Anaphase Bridges and in Increased Telomeric Fusions with Normal Telomere Length and G-Strand Overhang
Mol. Cell. Biol., June 1, 2001; 21(11): 3642 - 3651.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. E. Gallego and C. I. White
RAD50 function is essential for telomere maintenance in Arabidopsis
PNAS, February 13, 2001; 98(4): 1711 - 1716.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. McIlrath, S. D. Bouffler, E. Samper, A. Cuthbert, A. Wojcik, I. Szumiel, P. E. Bryant, A. C. Riches, A. Thompson, M. A. Blasco, et al.
Telomere Length Abnormalities in Mammalian Radiosensitive Cells
Cancer Res., February 1, 2001; 61(3): 912 - 915.
[Abstract] [Full Text]


Home page
GeneticsHome page
J. A. Clikeman, G. J. Khalsa, S. L. Barton, and J. A. Nickoloff
Homologous Recombinational Repair of Double-Strand Breaks in Yeast Is Enhanced by MAT Heterozygosity Through yKU-Dependent and -Independent Mechanisms
Genetics, February 1, 2001; 157(2): 579 - 589.
[Abstract] [Full Text]


Home page
J. Cell Sci.Home page
J Bertinato, C Schild-Poulter, and R. Hache
Nuclear localization of Ku antigen is promoted independently by basic motifs in the Ku70 and Ku80 subunits
J. Cell Sci., January 1, 2001; 114(1): 89 - 99.
[Abstract] [PDF]


Home page
Mol. Cell. Biol.Home page
N. Grandin, C. Damon, and M. Charbonneau
Cdc13 Cooperates with the Yeast Ku Proteins and Stn1 To Regulate Telomerase Recruitment
Mol. Cell. Biol., November 15, 2000; 20(22): 8397 - 8408.
[Abstract] [Full Text]


Home page
Genes Dev.Home page
H.-L. Hsu, D. Gilley, S. A. Galande, M. P. Hande, B. Allen, S.-H. Kim, G. C. Li, J. Campisi, T. Kohwi-Shigematsu, and D. J. Chen
Ku acts in a unique way at the mammalian telomere to prevent end joining
Genes & Dev., November 15, 2000; 14(22): 2807 - 2812.
[Abstract] [Full Text]


Home page
Mol. Biol. CellHome page
P. Baumann and T. R. Cech
Protection of Telomeres by the Ku Protein in Fission Yeast
Mol. Biol. Cell, October 1, 2000; 11(10): 3265 - 3275.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
M. Takata, M. S. Sasaki, E. Sonoda, T. Fukushima, C. Morrison, J. S. Albala, S. M. A. Swagemakers, R. Kanaar, L. H. Thompson, and S. Takeda
The Rad51 Paralog Rad51B Promotes Homologous Recombinational Repair
Mol. Cell. Biol., September 1, 2000; 20(17): 6476 - 6482.
[Abstract] [Full Text]


Home page
Nucleic Acids ResHome page
E. Feldmann, V. Schmiemann, W. Goedecke, S. Reichenberger, and P. Pfeiffer
DNA double-strand break repair in cell-free extracts from Ku80-deficient cells: implications for Ku serving as an alignment factor in non-homologous DNA end joining
Nucleic Acids Res., July 1, 2000; 28(13): 2585 - 2596.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
H. Tsubouchi and H. Ogawa
Exo1 Roles for Repair of DNA Double-Strand Breaks and Meiotic Crossing Over in Saccharomyces cerevisiae
Mol. Biol. Cell, July 1, 2000; 11(7): 2221 - 2233.
[Abstract] [Full Text]


Home page
ScienceHome page
S. M. Gasser
A Sense of the End
Science, May 26, 2000; 288(5470): 1377 - 1379.
[Abstract] [Full Text]


Home page
Genes Dev.Home page
L. Guarente
Sir2 links chromatin silencing, metabolism, and aging
Genes & Dev., May 1, 2000; 14(9): 1021 - 1026.
[Full Text]


Home page
Mol. Cell. Biol.Home page
J. C. Prescott and E. H. Blackburn
Telomerase RNA Template Mutations Reveal Sequence-Specific Requirements for the Activation and Repression of Telomerase Action at Telomeres
Mol. Cell. Biol., April 15, 2000; 20(8): 2941 - 2948.
[Abstract] [Full Text]


Home page
Nucleic Acids ResHome page
L. Lacroix, H. Lienard, E. Labourier, M. Djavaheri-Mergny, J. Lacoste, H. Leffers, J. Tazi, C. Helene, and J.-L. Mergny
Identification of two human nuclear proteins that recognise the cytosine-rich strand of human telomeres in vitro
Nucleic Acids Res., April 1, 2000; 28(7): 1564 - 1575.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. J. DiBiase, Z.-C. Zeng, R. Chen, T. Hyslop, W. J. Curran Jr., and G. Iliakis
DNA-dependent Protein Kinase Stimulates an Independently Active, Nonhomologous, End-Joining Apparatus
Cancer Res., March 1, 2000; 60(5): 1245 - 1253.
[Abstract] [Full Text]


Home page
GeneticsHome page
B. Fellerhoff, F. Eckardt-Schupp, and A. A. Friedl
Subtelomeric Repeat Amplification Is Associated With Growth at Elevated Temperature in yku70 Mutants of Saccharomyces cerevisiae
Genetics, March 1, 2000; 154(3): 1039 - 1051.
[Abstract] [Full Text]


Home page
J. Cell Sci.Home page
S. Evans and V Lundblad
Positive and negative regulation of telomerase access to the telomere
J. Cell Sci., January 10, 2000; 113(19): 3357 - 3364.
[Abstract] [PDF]


Home page
Cold Spring Harb Symp Quant BiolHome page
M.L. DUBOIS, S.J. DIEDE, A.E. STELLWAGEN, and D.E. GOTTSCHLING
All Things Must End: Telomere Dynamics in Yeast
Cold Spring Harb Symp Quant Biol, January 1, 2000; 65(0): 281 - 296.
[Abstract] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. M. Bailey, J. Meyne, D. J. Chen, A. Kurimasa, G. C. Li, B. E. Lehnert, and E. H. Goodwin
DNA double-strand break repair proteins are required to cap the ends of mammalian chromosomes
PNAS, December 21, 1999; 96(26): 14899 - 14904.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Wang, M. A. Bogue, A. P. Nguyen, and D. B. Roth
Irradiation-Induced Rescue of Thymocyte Differentiation and V(D)J Recombination in Mice Lacking the Catalytic Subunit of DNA-Dependent Protein Kinase
J. Immunol., December 1, 1999; 163(11): 6065 - 6071.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H.-L. Hsu, D. Gilley, E. H. Blackburn, and D. J. Chen
Ku is associated with the telomere in mammals
PNAS, October 26, 1999; 96(22): 12454 - 12458.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
M. Kaeberlein, M. McVey, and L. Guarente
The SIR2/3/4 complex and SIR2 alone promote longevity in Saccharomyces cerevisiae by two different mechanisms
Genes & Dev., October 1, 1999; 13(19): 2570 - 2580.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
J. A. Downs and S. P. Jackson
Involvement of DNA End-Binding Protein Ku in Ty Element Retrotransposition
Mol. Cell. Biol., September 1, 1999; 19(9): 6260 - 6268.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
R. Kooistra, A. Pastink, J. B. M. Zonneveld, P. H. M. Lohman, and J. C. J. Eeken
The Drosophila melanogaster DmRAD54 Gene Plays a Crucial Role in Double-Strand Break Repair after P-Element Excision and Acts Synergistically with Ku70 in the Repair of X-Ray Damage
Mol. Cell. Biol., September 1, 1999; 19(9): 6269 - 6275.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
R. J. Craven and T. D. Petes
Dependence of the Regulation of Telomere Length on the Type of Subtelomeric Repeat in the Yeast Saccharomyces cerevisiae
Genetics, August 1, 1999; 152(4): 1531 - 1541.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (456K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (291)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Boulton, S.
Right arrow Articles by Jackson, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Boulton, S.
Right arrow Articles by Jackson, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?