Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (150K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (30)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Wang, X
Right arrow Articles by Hickson, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, X
Right arrow Articles by Hickson, I.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 1996 Oxford University Press 4791-4797

Footnote

Pat1: a topoisomerase II-associated protein required for faithful chromosome transmission in Saccharomyces cerevisiae

Pat1: a topoisomerase II-associated protein required for faithful chromosome transmission in Saccharomyces cerevisiae Xiaoqi Wang , Paul M. Watt + , Edward J. Louis 1 , Rhona H. Borts 1 and Ian D. Hickson*

Imperial Cancer Research Fund and 1 Yeast Genetics, Institute of Molecular Medicine, John Radcliffe Hospital, Oxford OX3 9DU, UK

Received July 23, 1996; Revised and Accepted October 25, 1996

ABSTRACT

Saccharomyces cerevisiae top2 mutants deficient in topoisomerase II activity are defective in chromosome segregation during both mitotic and meiotic cell divisions. To identify proteins that act in concert with topoisomerase II during chromosome segregation in S.cerevisiae , we have used a two-hybrid cloning approach. We report the isolation of the PAT1 gene (for protein associated with topoisomerase II), which encodes a novel 90 kDa proline- and glutamine-rich protein that interacts with a highly conserved, leucine-rich region of topoisomerase II in vivo . Strains lacking Pat1p exhibit a slow growth rate and a phenotype reminiscent of conditional top2 mutants grown at the semi-permissive temperature; most notably, a reduced fidelity of chromosome segregation during both mitosis and meiosis. These findings indicate that the PAT1 gene is necessary for accurate chromosome transmission during cell division in eukaryotic cells and suggest that the interaction of Pat1p and topoisomerase II is an important component of this function.

INTRODUCTION

Each cell division cycle in eukaryotes consists of two key phases during which the genome is first precisely replicated and then evenly segregated between the daughter cells. There are several threats to the integrity of the genome from exogenous damaging agents, such as ionizing and ultraviolet radiation, but one of the major sources of genomic instability are the processes of DNA metabolism. Errors incurred either during DNA replication and recombination, or during the segregation of chromosomes at mitosis, can lead to many different forms of chromosomal aberrations, including deletions and unequal exchanges between homologous sequences (for reviews see 1 - 4 ).

Topoisomerase II is an important component of the cellular armoury that counteracts threats to the structural integrity of chromosomes. Conditional mutants of budding and fission yeast lacking topoisomerase II activity at the restrictive temperature die in the course of an abortive mitosis in which chromosomal breakage results from an attempt to segregate sister-chromatids that have not been disentangled following DNA replication ( 5 - 8 ). Mutants lacking a functional TOP2 gene also fail to proceed through meiosis, although in this case the cells arrest at the pachytene stage of meiosis I without a loss of viability ( 9 , 10 ). In addition to this essential function in cell division, topoisomerase II is required both for the relief of torsional stress that can build up during DNA transcription and replication, and for the structural maintenance of chromosomal loci comprising repetitive DNA elements (reviewed in 11 - 13 ). This latter role is particularly highlighted in the case of the tandemly duplicated rDNA locus, which is highly unstable in top2 mutants ( 14 ). This `suppression' of DNA repeat instability by topoisomerase II is apparently a function shared with topoisomerase I, since impairment of the function of both of these classes of topoisomerases causes a synergistic effect on rDNA locus recombination, and leads to the excision of rDNA elements in the form of extrachromosomal DNA rings ( 15 ).

In order to identify gene products that either cooperate with, or regulate the functions of, topoisomerase II during different aspects of DNA metabolism in Saccharomyces cerevisiae, we have used a two-hybrid cloning approach. We have previously described the isolation of the SGS1 gene encoding a putative DNA helicase homologous to the Escherichia coli RecQ, and human BLM (Bloom's syndrome) and WRN (Werner's syndrome) proteins, which interacts with topoisomerase II in vivo ( 16 ). Strains lacking functional Sgs1p show a defect in chromosome segregation and an elevated frequency of recombination ( 16 , 17 ). Here, we report the identification of the S.cerevisiae PAT1 gene product via its ability to interact with a leucine-rich region of the topoisomerase II protein. We show that the phenotype of [Delta] pat1 strains is very similar to that of top2 ts mutants grown at the semi-permissive temperature ( 11 - 13 ); most notably a reduction in cell viability and a decrease in the fidelity of chromosome segregation during mitosis and meiosis.

MATERIALS AND METHODS

Saccharomyces cerevisiae strains

The genotypes of strains used in this work are listed in Table 1 . Strain EGY48 ( 23 ) was obtained from Dr R. Brent. Strain YPH277 ( 18 ) was obtained from Dr P. Heiter. All of the remaining strains are based on the YP1 ( 19 ) and Y55 ( 20 ) backgrounds. Strains PW30, PW40 and PW50 have been described previously ( 16 , 17 ). Strain XQ2 was generated by crossing strains Y55-2372 and PW30 [Delta] pat1 and selecting segregants after tetrad dissection that were either Leu + Trp + can r (for a [Delta] pat1 segregant) or Leu - Trp + can r (for a wild-type control). To generate the homozygous [Delta] pat1 diploid (XQD20) for meiosis missegregation studies, XQ2 [Delta] pat1 was crossed with PW40 [Delta] pat1 selecting for Trp + Ura + . The appropriate wild-type control diploid was generated by crossing XQ2 with PW40. XQD30 was generated by crossing strains YPH277 and PW50. The XQD40 diploid, and a derivative containing a homozygous deletion of PAT1 , were generated by crossing strains EJL374-8A and PW50, or their respective [Delta] pat1 derivatives.

Isogenic deletions of the PAT1 gene in the above strains were made by transforming ( 21 ) with pXQ101 (containing LEU2 inserted into a partially deleted PAT1 coding region; see below), which had been digested with Xba I and Bgl II. Diploid strains were constructed by mating, followed by appropriate selection, as well as by confirmation of a non-mating phenotype.

Growth of micro-organisms/DNA manipulation

Growth of E.coli and yeast and standard recombinant DNA techniques were as described by Ausubel et al . ( 21 ) and Sherman ( 22 ). Nucleotide sequencing was performed using the dideoxy chain termination method and Sequenase (US Biochemicals).

Plasmids

The plasmid pJG45 ( 23 ), in which the activation library was constructed ( 16 ), together with the LexA-fusion DNA binding domain vector (pEG202) and the lacZ reporter plasmid (pSH1834), were kindly provided by Dr R. Brent. pLexTopDT was constructed by cloning an Ssp I fragment of TOP2 (representing residues 1118-1429), in frame with lexA into pEG202. pLexTopD and pLexTopT constructs (which contain residues 1109-1163 and 1168-1429, respectively) were made similarly, except that in the construction of pLexTopT, an octameric Eco RI linker was inserted into the Eco RV site of TOP2 , to create the in-frame 5' cloning junction. The non-specific LexA fusion plasmids; pLexA-Max ( 24 ) and pHM12 (a kind gift from Drs R. Finley and R. Brent), contain the entire coding region of the human Max protein and 295 residues of Drosophila Cdc2 kinase, respectively.

To generate pXQ101 for targeted disruption of PAT1 , the full 2391 bp coding region of PAT1 was amplified from genomic S.cerevisiae DNA (S288C, ATCC#26108) by PCR using the following primers (both written 5' -> 3') and the product was cloned into pCR-Script TM SK(+), using a kit supplied by the manufacturer (Stratagene).

5' primer: GAAGCACTAGCAATGTCCTTCTTTGGG

3' primer: CTTTAGTTCTGATATTTCAGC

The resulting construct was then digested with Xba I and Bgl II (deleting 1068 bp of the PAT1 coding sequence), prior to the insertion of a 2230 bp fragment containing the LEU2 gene to generate pXQ101.

A PAT1 clone was also isolated using standard techniques ( 21 ) from an S.cerevisiae genomic DNA library (kindly supplied by Dr J. Diffley), using the pActPat1 insert as the probe. To generate pXQ102 for expression of Pat1p in S.cerevisiae , the full length PAT1 coding region was excised from pCR-Script (see above) and inserted into the Xho I site of pYES (Invitrogen).

Activator fusion library construction

A library of S.cerevisiae genomic DNA comprising 3-5 * 10 6 primary transformants was constructed as described by Watt et al . ( 16 ). Plasmid DNA was prepared directly from the pooled, unamplified E.coli transformants.

Two-hybrid screen

The two-hybrid screen was performed essentially as described by Gyuris et al . ( 23 ) and Zervos et al . ( 24 ). The yeast activation domain library described above was transformed into the reporter strain EGY48, which had previously been transformed with pLexTopDT and pSH1834. Plasmids were isolated from yeast which survived selection for leucine prototrophy and were blue on plates containing X-gal only when the medium was supplemented with galactose (to induce expression from the Gal1 promoter in pActPat1).

Immunoprecipitations

Strain EGY48 was transformed with plasmids pActPat1 (encoding HA-tagged Pat1p) and pTopoII-myc (encoding myc-tagged topo II; ref. 25 ). Yeast were lysed and extracts were separated on SDS-polyacrylamide gels using the discontinuous system of Laemmli ( 26 ). Immunoprecipitations were carried out using either anti-myc (9E10) antibody, anti-HA (12CA5) antibody or an anti-ICAM1 control antibody of the same subclass (IgG1). Western blots were probed with either the 9E10 anti-myc antibody or the 12CA5 anti-HA antibody, using standard techniques ( 21 ).

Mitotic missegregation

Control strain YPH277, and a derivative with a deletion of the PAT1 gene, contain a chromosomal fragment marked with the URA3 gene. Following selection of colonies on SC medium lacking uracil, to ensure maintenance of the chromosomal fragment, the cells were streaked onto nonselective medium. Entire single colonies from these plates were then picked and re-plated on both SC medium containing 5-fluoroorotic acid (5-FOA) at 1 mg/ml, and on SC medium alone. Fluctuation analyses were performed as described by Lea and Coulson ( 27 ) using the method of the median. CHEF gel analysis of DNA from selected 5-FOA resistant colonies was performed using standard techniques ( 21 ).

Meiosis I missegregation

Diploids were selected on SC medium (-Trp -Ura) and single colonies were used to prepare patches on a non-selective YPD plate. Yeast were replica-plated onto sporulation medium and the plates were incubated at 20oC for 5 days. Gluculase (NEN) treated spores were sonicated briefly, before plating dilutions both on SC medium and on SC (-Ura -Trp), in each case containing canavanine at 0.004%. The frequency of meiosis I missegregation was calculated as the ratio of total (Trp + Ura + can r ) spores to total can r spores.

Table 1 Saccharomyces cerevisiae strains
Strain

Genotype

EGY48

MAT a , his3, trp1, ura3-52, lex(leu2)3a

PW50

MAT [alpha], ura3-52, leu2 [Delta] , ade2-101, lys2, cyh2

YPH277

MAT a , ura3-52, lys2-801, ade2-101, trp1 [Delta] 1, leu2 [Delta] 1, CRVII

(RAD2.d.YPH277) URA3 SUP11

PW30

MAT [alpha], ura3-n, leu2 [Delta] , met13-2, cyh2

PW40

MAT a , ura3-n, leu2 [Delta] , met14-1, his6-1, lys9-1, trp1::URA3

Y55-2372

MAT a , ura3-n, leu2 [Delta] , trp1-b, can1

EJL374-8A

MAT a , ura3-52, ade2-101, lys2, leu2 [Delta] , his4-12, can1

XQ2

MAT [alpha], ura3-n, leu2 [Delta] , can1

XQD30

MAT a , ura3-52, lys2-801, ade2-101, trp1 [Delta] 1, leu2 [Delta] 1, CRVII

( RAD2.d.YPH277) URA3 SUP11

MAT [alpha], ura3-52, leu2 [Delta] , ade2-101, lys2, cyh2

XQD20

MAT [alpha] ura3-n, leu2 [Delta] , can1

MAT a , ura3-n, leu2 [Delta] , met14-1, his6-1, lys9-1, trp1::URA3

XQD40

MAT a , ura3-52, ade2-101, lys2, leu2 [Delta] , his4-12, can1

MAT [alpha], ura3-52, leu2 [Delta] , ade2-101, lys2, cyh2

RESULTS

Cloning of the PAT1 gene

To identify proteins that interact with topoisomerase II in S.cerevisiae , we used the two-hybrid cloning system developed by Fields and Song ( 28 ) and adapted by Zervos et al . ( 24 ). The DNA binding domain fusion (`bait') comprised residues 1118-1429 of yeast topoisomerase II fused to E.coli LexA protein (construct pLexTopDT; ref. 16 ), while a library of yeast proteins fused to the B42 transcriptional activator represented the `prey'.

Strain EGY48 (Table 1 ), harbouring the `bait' construct was transformed with the transcriptional activation domain library, yielding 3 * 10 6 independent colonies. Of these, 10 displayed both leucine prototrophy and a blue coloration on plates containing X-gal. Five clones represented the SGS1 gene and have been discussed elsewhere ( 16 ). Two identical clones, which were distinct from SGS1 , contained a single long open reading frame identical to a sequence present on chromosome III that had been identified as part of the yeast genome sequencing project and designated YCR077c. Based upon the data presented in this paper, we propose that this gene be renamed PAT1 (for protein associated with topoisomerase II).

The nucleotide sequence of the full length PAT1 gene was generated using clones derived both by PCR amplification of yeast genomic DNA and by screening a yeast genomic DNA library. Our nucleotide sequence for PAT1 did not differ from that available in the DDBJ/EMBL/GenBank database (accession no. S53590). The region of Pat1p expressed by the transcriptional activation domain construct (designated pActPat1) is between amino acids 84 and 494. The predicted Pat1 protein sequence is unusually rich in proline and glutamine residues (overall 6.8 and 7.5%, respectively), and in a 154 amino acid stretch beginning at residue 90, the Pat1 protein contains 34 proline and 20 glutamine residues (22 and 13%, respectively). However, the Pat1 amino acid sequence lacks any readily-identifiable motifs that could give a direct clue to function.

Comparison of the predicted Pat1p amino acid sequence with protein sequences in the Swissprot database revealed some similarity with several proline and/or glutamine-rich proteins, including the Xenopus oocyte-specific p100 protein ( 29 ), and a domain within CBP, the CREB-binding protein from human and mouse cells ( 30 - 32 ) (Fig. 2 ). However, the significance of these sequence similarities is as yet unclear.

Functional yeast topoisomerase II interacts with Pat1p via a leucine-rich domain

To assess the specificity of the interaction between Pat1p and topoisomerase II, and to identify the region of yeast topoisomerase II with which Pat1p interacts, we tested whether constructs comprising residues 1109-1429, 1109-1163 or 1168-1429 (pLexTopDT, pLexTopD and pLexTopT, respectively; see ref. 16 ) of topoisomerase II could activate transcription in the presence of the pActPat1 construct. As controls, the non-specific LexA fusion proteins pLexMAX and pHAP1 were tested similarly. Yeast expressing the pLexTopDT construct (Fig. 1 ) and the pLexTopD construct (data not shown) showed leucine prototrophy upon induction of the Gal1 promoter in pActPat1, while no significant activation (lack of leucine prototrophy) was seen in the case of either pLexTopT or the non-specific fusion proteins, pLexMAX and pHAP1 (Fig. 1 ). These results indicate both that Pat1p interacts with the highly conserved, leucine-rich domain of topoisomerase II between residues 1109 and 1163, and that this interaction is apparently specific.


Figure 1 . Analysis of leucine prototrophy in strain EGY48 containing pActPat1 together with pLexTopDT (column 1), pLexTopT (column 2), pLexMAX (column 3) or pHAP1 (column 4). Four yeast colonies in each case were analysed. Yeast in the upper panel were grown in the presence of galactose (Gal) to induce expression of the Pat1 activator fusion protein, and yeast in the lower panel were grown in the presence of glucose (Glu), where Pat1 expression would be repressed.


Figure 2 . Co-immunoprecipitation of topoisomerase II and Pat1p. Lanes 1-3 show an autoradiograph of a Western blot with the 12CA5 anti-HA antibody of proteins immunoprecipitated using the 9E10 anti-myc antibody (lanes 1 and 2) or the negative control anti-ICAM1 antibody (lane 3). Lanes 1 and 2 show extracts from EGY48 containing pActPat1 and pLexTopDT grown in the absence and presence, respectively, of 2% galactose to induce expression of pActPat1 from the Gal1 promoter. The pActPat1 fusion protein runs at 75 kDa and is indicated on the right. Lane 4 shows a Western blot performed as per lane 2, with the exception that the EGY48 contained the pActPat1 construct only. Lane 5 shows an autoradiogram of a Western blot with the 9E10 anti-myc antibody of proteins precipitated using the 12CA5 anti-HA antibody. The extract was derived from EGY48 cells containing pActPat1 and pTopo II-myc grown in the presence of galactose. The position of the 150 kDa Topo II-myc protein is indicated on the right. The position of the 50 kDa immunoglobulin heavy chain, which serves as a loading control, is also indicated.

To confirm the above data, and to provide an alternative line of evidence that Pat1p and topoisomerase II associate in vivo , we tested whether Pat1p and topoisomerase II could be co-immunoprecipitated from yeast cell extracts. To do this, myc-tagged topoisomerase II ( 25 ) was co-expressed in EGY48 with the haemagglutinin (HA)-tagged Pat1p fragment encoded by the pActPat1 construct. The HA-tagged Pat1p was co-immunoprecipitated with topoisomerase II, while a non-specific mouse antibody of the same subclass failed to immunoprecipitate the Pat1p fragment from the same yeast extract (Fig. 2 , lanes 1-3). In contrast, HA-tagged Pat1p could not be immunoprecipitated with 9E10 from yeast that did not express the myc-tagged topoisomerase II (Fig. 2 , lane 4), indicting that Pat1p does not contaminate all immunoprecipitates made with the 9E10 antibody. As an additional specificity control, we showed that myc-tagged topoisomerase II was present in the precipitate when HA-tagged Pat1p was immunoprecipitated with the 12CA5 anti-HA antibody (Fig. 2 , lane 5). Thus, we conclude that Pat1p and topoisomerase II form a complex in yeast cells.

Deletion of the PAT1 gene affects cell growth, viability and morphology

To study the function(s) of Pat1p, we generated targeted deletions of the PAT1 gene in a variety of genetic backgrounds. This was achieved by insertion of the LEU2 gene after codon 100 of PAT1 with the concomitant deletion of 1068 bp of the PAT1 coding region. The presence of termination codons in the LEU2 gene fragment precludes the possibility that a Leu2-Pat1 fusion protein could be synthesized in vivo . The truncated polypeptide that might be produced in the [Delta] pat1 strains would contain only 100 residues of Pat1p (and would lack the topoisomerase II-interaction domain) and it is highly unlikely, therefore, that this truncated Pat1p would be functional.

Although some minor degree of inter-strain variability was observed, all haploid [Delta] pat1 strains grew much more slowly than their isogenic parental controls. To confirm that deletion of PAT1 conferred a slow growth phenotype, a diploid heterozygous for the PAT1 gene was constructed from the isogenic haploid strains, EJL374-8A and PW50, the latter of which contained a deletion of PAT1 . Figure 3 shows that tetrads obtained from sporulation of this heterozygous diploid strain generated two fast growing and two slow growing segregants when dissected onto YPD medium. The LEU2 marker used to disrupt PAT1 in all cases segregated with the slow growth phenotype.


Figure 3 . (a ) Tetrad analysis of a genetic cross between a PAT1 and a [Delta] pat1 strain. Dissected tetrads were grown on YPD agar. Note the presence of two large and two small colonies in each of the nine tetrads dissected (numbered above). ( b ) The relevant genotype of the spore colonies. Note that leucine prototrophy, which is indicative of the PAT1 gene disruption, segregates with small colony size.

The reduced growth rate of [Delta] pat1 strains was associated with a reduction in cell viability, as revealed both by the measurement of plating efficiency on YPD agar (data not shown) and by pedigree analysis. In this latter analysis, the viability of [Delta] pat1 cells was determined by microdissecting unbudded cells, which were apparently morphologically normal, onto a defined location on an agar plate. Of the 24 PW50 [Delta] pat1 cells screened that went on to form buds, 13 (54%) died within the first two generations after microdissection, while cells from the wild-type PW50 control showed >95% viability under these conditions. Loss of viability in the [Delta] pat1 strain occurred at an approximately equal frequency in the mother and daughter cells.

Because of their reduced growth rate and viability, the [Delta] pat1 strains were examined by fluorescence microscopy to assess whether they exhibited a normal cell and nuclear morphology. In all cases examined, the mutant cells exhibited a number of morphological abnormalities, including an overall increase in the size of mother cells and buds, and an increased frequency of chromosomal fragmentation (Fig. 4 ). Indeed, a proportion (~5-10%) of the [Delta] pat1 cells apparently lacked any nuclear DNA (or at least a normal complement of DNA), despite the presence of visible mitochondrial DNA staining in the cytoplasm.


Figure 4 . Cellular and nuclear morphology of pat1 strains. The wild-type PW50 ( a ) and an [Delta] pat1 derivative of PW50 ( b ) were fixed and stained with DAPI. The white arrows in (b) denote yeast apparently devoid of a normal complement of nuclear DNA.

Table 2 Spore viability
Strain

Spore class

Spore viability (%)

XQD30

4

90

3

8

2

2

1

0

0

0

Overall

97

XQD30 [Delta] pat1

4

38.4

3

13.0

2

22.6

1

11.6

0

14.4

Overall

62

Homozygous [Delta] pat1 diploid strains have a reduced ability to generate viable spores

Dissection of >500 tetrads derived from sporulation of the diploid XQD30 strain carrying a homozygous deletion of PAT1 revealed that both sporulation frequency and spore viability were decreased compared with the isogenic wild-type control diploid (Table 2 ). The overall spore viability for the [Delta] pat1 diploid was reduced to 62% (compared with 97% for the control strain), and a large excess of tetrads was observed that contained two or fewer viable spores (Table 2 ).

The slow growth phenotype of [Delta] pat1 strains can be reversed by expression of recombinant Pat1p

To confirm that the slow growth and poor viability of [Delta] pat1 strains was a direct result of a loss of PAT1 gene function, we cloned the full length PAT1 coding region downstream of the GAL1 promoter in the yeast expression vector pYES2 (to generate pXQ102; see Materials and Methods) and expressed Pat1p in the PW50 [Delta] pat1 strain. The presence of pXQ102 harbouring the PAT1 gene had no influence on the growth rate of PW50 [Delta] pat1 cells on YPD plates, where the activity of the GAL1 promoter would be repressed by the presence of glucose in the medium. However, near wild-type levels of growth were seen on plates containing 2% galactose, which would lead to an induction of Pat1p expression (data not shown). Consistent with this result, the viability and rate of growth of [Delta] pat1 spore colonies (scored as Leu + ) that retained the pXQ102 (scored as Ura + ) was enhanced, in comparison with vector-only controls, after dissection of tetrads derived from sporulation of the XQD40 diploid containing a homozygous deletion of PAT1 onto plates containing 2% galactose (Fig. 5 ).


Figure 5 . Complementation of the slow growth phenotype of a [Delta] pat1 strain by expression of a plasmid-borne copy of the PAT1 gene. Eight tetrads derived form sporulation of the isogenic XQD40 diploid containing a homozygous deletion of PAT1 were dissected onto minimal agar containing 2% galactose (to induce expression from the Gal1 promoter in pYES). The upper and lower panels indicate segregants containing the pYES vector alone and pYES encoding PAT1 , respectively. The overall spore viability was somewhat lower than normal because dissected tetrads germinate poorly on plates containing galactose as sole carbon source and the pYES-based vector is lost from ~50% of the segregants during meiosis.

[Delta] pat1 strains show an increased incidence of chromosome missegregation during both mitotic and meiotic cell divisions

Since [Delta] pat1 strains showed nuclear abnormalities and poor sporulation efficiency, and Pat1p had been shown to interact with a protein required to effect faithful chromosome transmission during cell division, we analyzed whether [Delta] pat1 strains showed an altered fidelity of chromosome segregation at mitosis and/or meiosis. To quantify the frequency of mitotic missegregation in [Delta] pat1 strains, the PAT1 gene was deleted in YPH277, a strain that carries a chromosomal fragment marked with the URA3 gene ( 18 ). Cells lacking this fragment, as a result of either chromosomal loss or nondisjunction during mitotic division, become resistant to 5-FOA. Table 3 shows that deletion of PAT1 caused an average 5.8-fold increase in the rate of chromosome missegregation per cell generation compared with that seen in the wild-type YPH277 strain. CHEF gel analysis was used to confirm that 5-FOA resistance had arisen due to loss of the chromosomal fragment and not via a gene conversion event involving the chromosomal ura3-52 allele (data not shown).

Table 3 Mitotic missegregation in [Delta] pat1 strains
Experiment no.

Missegregation (rate per cell generation) (* 10 4 )

YPH277

YPH277 [Delta] pat1

1

0.13

1.23 (9.5 a )

2

0.14

1.13 (8.1)

3

0.55

1.31 (2.4)

4

1.40

4.18 (3.0)

a Figures in parentheses represent the fold increase in the rate of mitotic missegregation in the YPH277 [Delta] pat1 strain for each experimental determination. Mean rates for YPH277 and YPH277 [Delta] pat1 in each case are significantly different ( P < 0.01).

To analyse meiotic chromosome missegregation, a homozygous deletion of PAT1 was generated in strain XQD20, which is genetically marked for monitoring missegregation that occurs specifically during meiosis I. This strain is isogenic with PWD70 used previously for such analyses ( 16 ), with the exception that the can1 allele replaced the cyh2 allele. One of the haploid parents of XQD20 has a URA3 disruption of the TRP1 gene near the centromere on chromosome IV, while the other has an intact TRP1 gene at the same chromosomal location. Both parents carry a ura3n mutation elsewhere with genome. Missegregation of chromosome IV in XQD20 (either via chromosome nondisjunction or precocious sister segregation) can be monitored by measuring the frequency of Ura + Trp + progeny that have successfully sporulated (assessed by following the recessive can1 mutation, conferring resistance to canavanine). In contrast, normal Mendelian segregation would give rise to Ura + Trp - and Ura - Trp + progeny in equal numbers, but not to Ura + Trp + progeny. Table 4 shows that deletion of PAT1 caused an ~4-fold increase in the frequency of meiosis I missegregation of chromosome IV. The frequency of missegregation seen in the XQD20 wild-type control was very similar to that reported previously for the near isogenic PWD70 strain ( 16 ).

Table 4 Meiosis I missegregation
Strain

Can r

Can r colony

Frequency

Ura + Trp +

forming units

Ura + Trp +

Prototrophs

(%)

XQD20

2.4 * 10 1

7.3 * 10 4

0.03

XQD20

1.5 * 10 2

2.5 * 10 5

0.06

XQD20

1.1 * 10 2

1.4 * 10 5

0.08

XQD20

1.0 * 10 2

1.3 * 10 5

0.08

Mean (fold-increase)

0.062 a (1)

XQD20 [Delta] pat1

4.9 * 10 1

2.7 * 10 4

0.18

XQD20 [Delta] pat1

2.5 * 10 1

1.5 * 10 4

0.17

XQD20 [Delta] pat1

2.5 * 10 2

4.6 * 10 4

0.54

XQD20 [Delta] pat1

1.2 * 10 2

1.3 * 10 5

0.14

XQD20 [Delta] pat1

8.0 * 10 1

6.3 * 10 4

0.18

Mean (fold-increase)

0.24 b (3.9)

a Mean of four independent experiments. b Mean of five independent experiments. Mean frequencies for XQD20 and XQD20 [Delta] pat1 are significantly different ( P < 0.01).

DISCUSSION

We have shown that the PAT1 gene of S.cerevisiae encodes a topoisomerase II-associated protein that is required for the maintenance of genome integrity. Yeast lacking functional Pat1p exhibit a number of phenotypic abnormalities, including a reduced growth rate, reduced viability and reduced ability to undergo productive nuclear division. Based upon the observations that Pat1p interacts with topoisomerase II, and that pat1 mutants display a reduced fidelity of chromosome segregation, we suggest that Pat1p is a component of the cellular machinery that ensures error-free chromosome segregation occurs during cell division. However, Pat1p is not an essential gene and it would appear, therefore, that Pat1p either performs a non-essential role during chromosome segregation, or that other proteins can substitute in the absence of Pat1p.

Since the failed segregation of essential chromosomes cannot be studied directly, assays of mitotic missegregation generally utilise non-essential chromosomal fragments ( 18 ). Similarly, the assay of meiosis I missegregation described here relies on an ability to monitor viable progeny from tetrads that may contain up to three non-viable spores. Moreover, these assays monitor the segregation of only one of the S.cerevisiae chromosomes. Thus, the frequency of missegregation revealed by the available assays may not reflect the true extent to which the segregation process is aberrant in a particular mutant, since it is clearly impossible to `score' non-viable progeny. In those cases where chromosome segregation still occurs in a mutant strain, albeit with reduced efficiency, but is associated with an increase in the rate of cell death, the available missegregation assays may give a substantial underestimate of the true extent to which the segregation process is defective. Based upon the high frequency of apparently aploid cells seen in cultures of strains lacking functional PAT1 , and the high percentage of dissected [Delta] pat1 tetrads that contained two or fewer viable spores, we suggest that this is likely to be the case for [Delta] pat1 strains.

The predicted Pat1 protein sequence shows some similarity with the sequences of proline- and glutamine-rich proteins from other eukaryotic species. The Xenopus oocyte-specific p100 protein has not been characterized in detail, but has been shown to be a single-stranded DNA binding protein ( 29 ). In contrast, the CBP factor from human and mouse cells has been well characterised biochemically as a CREB binding protein, and is known to mediate cAMP-dependent transcriptional activation of those genes that contain the cAMP response element in their promoters ( 30 , 31 ). The region of greatest homology between Pat1p and CBP is within a glutamine-rich domain of CBP that could be involved in directing protein-protein interactions ( 30 ). Together with data suggesting that glutamine-rich domains in other proteins are important for directing interactions with protein partners, it is tempting to speculate that Pat1p acts (perhaps not exclusively) as an adapter protein. Further two-hybrid screens using Pat1p as the `bait', might serve as a means to identify other factors important for chromosome segregation and/or maintenance of the stability of the rDNA locus. It may also be of significance that one of the two human topoisomerase II enzymes, the 170 kDa [alpha] isoform, has been shown to bind to CREB ( 33 ). Whether topoisomerase II, CREB, CBP and the homologue of Pat1p form a multienzyme complex in human cells will require further analyses.

The PAT1 gene has previously been assigned the name YCR077c as a result of its identification as an open reading frame in the fully sequenced chromosome III of S.cerevisiae . As part of the yeast genome analysis, Rodriguez-Cousino et al . ( 34 ) also created a strain in which YCR077c was disrupted by insertion of the URA3 gene. They reported that little, if any, gross phenotypic changes were evident in the disruptant, apart from a small effect on the rate of cell growth. Indeed, they indicated that a homozygous mutant diploid strain sporulated normally. We have generated targeted deletions of PAT1 in six different genetic backgrounds (this and unpublished studies) and in each case a moderate to severe slow growth phenotype was observed. The difference in growth rate of [Delta] pat1 spore colonies compared with that of PAT1 spore colonies from the same tetrads reported here, is typical of the effects that we have observed consistently. The reason for the apparent discrepancy between our data and those of Rodriguez-Cousino et al . ( 34 ) is not apparent at this stage, but might possibly relate to the fact that Rodriguez-Cousino et al. ( 34 ) generated a very small deletion within the PAT1 gene, which might have caused retention of some residual Pat1p protein function. Alternatively, it could be that a slow growth suppressor mutation had developed in the pat1 strain studied by Rodriguez-Cousino et al . ( 34 ), which masked the strong phenotypic effects of the pat1 mutation. Indeed, it is clear that such slow growth suppressors arise at a high frequency, since we have identifed two independent suppressors which restore near wild-type growth to the LS375 [Delta] pat1 strain (unpublished data).

In summary, we have identified the Pat1 protein as a cellular partner for topoisomerase II and we have shown that strains lacking functional Pat1p display phenotypic similarities to conditional topoisomerase II-deficient mutants. Although several genes have been identified in eukaryotes that affect chromosome segregation and general genome stability, very few of them are known to be involved in the pathway that deals with the resolution of topological problems that occur during different aspects of DNA metabolism. Further analysis of [Delta] pat1 strains should shed more light on the precise reasons why the functions of topoisomerase II and Pat1p are apparently coordinated in DNA metabolism.

ACKNOWLEDGEMENTS

We thank Drs G. Fink, P. Hieter, R. Brent and R. Finley for yeast strains and plasmids, and Dr J. Diffley for the yeast genomic DNA library. We also thank Dr C. Norbury for critical reading of the manuscript and Mrs E. Clemson for typing the manuscript. X.W., P.M.W. and I.D.H. are supported by the Imperial Cancer Research Fund. E.J.L. and R.H.B. are supported by the Wellcome Trust.

REFERENCES

1 German,J. (1974) In Chromosomes and Cancer. John Wiley and Sons, NY.

2 Murray,A.W. and Szostak,J.W. (1985) Annu. Rev. Cell. Biol., 1, 289-315. MEDLINE Abstract

3 Holm,C. (1994) Cell, 77, 955-957. MEDLINE Abstract

4 Bierne,H. and Michel,B. (1994) Mol. Cell. Biol., 12, 4988-4993.

5 DiNardo,S., Voelkel,K. and Sternglanz,R. (1984) Proc. Natl. Acad. Sci. USA, 81, 2616-2620. MEDLINE Abstract

6 Holm,C., Goto,T., Wang,J.C. and Botstein,D. (1985) Cell, 41, 553-563. MEDLINE Abstract

7 Holm,C., Stearns,T. and Botstein,D. (1989) Mol. Cell. Biol., 9, 159-68. MEDLINE Abstract

8 Uemura,T., Ohkura,H., Adachi,Y., Morino,K., Shiozaki,K. and Yanagida,M. (1987) Cell, 50, 917-925. MEDLINE Abstract

9 Rose,D., Thomas,W. and Holm,C. (1990) Cell, 60, 1009-1017. MEDLINE Abstract

10 Rose,D. and Holm,C. (1993) Mol. Cell. Biol., 13, 3445-3455. MEDLINE Abstract

11 Wang,J.C. (1995) Annu. Rev. Biochem., 54, 665-697.

12 Wang,J.C. (1991) J. Biol. Chem., 266, 6659-6662. MEDLINE Abstract

13 Watt,P. and Hickson,I.D. (1994) Biochem. J., 303, 681-695. MEDLINE Abstract

14 Christman,M.F., Dietrich,F.S. and Fink,G.R. (1988) Cell, 55, 413-425. MEDLINE Abstract

15 Kim,R.A. and Wang,J.C. (1989) Cell, 57, 975-985. MEDLINE Abstract

16 Watt,P.W., Louis,E.J., Borts,R.H. and Hickson,I.D. (1995) Cell, 81, 253-260.

17 Watt,P.M., Hickson,I.D., Borts,R.H. and Louis,E.J. (1996) Genetics, in press.

18 Spencer,F., Gerring,S.L., Connelly,C. and Hieter,P. (1990) Genetics, 124, 237-249. MEDLINE Abstract

19 Louis,E.J. and Haber,J.E. (1989) Genetics, 123, 81-95. MEDLINE Abstract

20 McCusker,J.H. and Haber,J.E. (1988) Genetics, 119, 303-315. MEDLINE Abstract

21 Ausubel,F.M., Brent,R., Kingston,R., Moore,D., Seidman,J.J., Smith,J. and Struhl,K. (1994), John Wiley & Sons, NY.

22 Sherman,F. (1991) Methods Enzymol., 194, 3-20. MEDLINE Abstract

23 Gyuris,J., Golemis,E., Chertkov,H. and Brent,R. (1993) Cell, 75, 791-803. MEDLINE Abstract

24 Zervos,A.S., Gyuris,J. and Brent,R. (1993) Cell, 72, 223-232. MEDLINE Abstract

25 Lindsley,J.E. and Wang,J.C. (1991) Proc. Natl. Acad. Sci. USA, 88, 10485-10489. MEDLINE Abstract

26 Laemmli,U.K. (1970) Nature, 227, 680-685. MEDLINE Abstract

27 Lea,D.E. and Coulson,C.A. (1949) J. Genet., 49, 264-285.

28 Fields,S. and Song,O. (1989) Nature, 340, 245-246. MEDLINE Abstract

29 Rother,R.P., Frank,M.B. and Thomas,P.S. (1992) Eur. J. Biochem., 206, 673-683. MEDLINE Abstract

30 Chrivia,J.C., Kwok,R.P.S., Lamb,N., Hagiwara,M., Montminy,M.R. and Goodman,R.H. (1993) Nature, 365, 855-859. MEDLINE Abstract

31 Kwok,R.P.S., Lundblad,J.R., Chrivia,J.C., Richards,J.P., Bachinger,H.P., Brennan,R.G., Roberts,S.G.E., Green,M.R. and Goodman,R.H. (1994) Nature, 370, 223-225.

32 D'Arcangelo,G. and Curran,T. (1995) Nature, 376, 292-376.

33 Kroll,D.J., Sullivan,D.M., Gutierrez-Hartmann,A. and Hoeffler,J.P. (1993) Mol. Endocrinol., 7, 305-318. MEDLINE Abstract

34 Rodriguez-Cousino,N., Lill,R., Neupert,W. and Court,D.A. (1995) Yeast, 11, 581-585.


Return

*To whom correspondence should be addressed. Tel: +44 1865 222417; Fax: +44 1865 222431; Email: hickson@icrf.icnet.uk

+ Present address: Institute for Child Health Research, University of Western Australia, Perth 6008, Australia
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
MutagenesisHome page
F. Cortes and N. Pastor
Induction of endoreduplication by topoisomerase II catalytic inhibitors
Mutagenesis, March 1, 2003; 18(2): 105 - 112.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
W. He and R. Parker
The Yeast Cytoplasmic LsmI/Pat1p Complex Protects mRNA 3' Termini From Partial Degradation
Genetics, August 1, 2001; 158(4): 1445 - 1455.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. Bonnerot, R. Boeck, and B. Lapeyre
The Two Proteins Pat1p (Mrt1p) and Spb8p Interact In Vivo, Are Required for mRNA Decay, and Are Functionally Linked to Pab1p
Mol. Cell. Biol., August 15, 2000; 20(16): 5939 - 5946.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
F. Wyers, M. Minet, M. E. Dufour, L. T. A. Vo, and F. Lacroute
Deletion of the PAT1 Gene Affects Translation Initiation and Suppresses a PAB1 Gene Deletion in Yeast
Mol. Cell. Biol., May 15, 2000; 20(10): 3538 - 3549.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
E. U. Kurz, K. B. Leader, D. J. Kroll, M. Clark, and F. Gieseler
Modulation of Human DNA Topoisomerase IIalpha Function by Interaction with 14-3-3epsilon
J. Biol. Chem., April 28, 2000; 275(18): 13948 - 13954.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Bjergbak, S. Jensen, O. Westergaard, and A. H. Andersen
Using a Biochemical Approach to Identify the Primary Dimerization Regions in Human DNA Topoisomerase IIalpha
J. Biol. Chem., September 10, 1999; 274(37): 26529 - 26536.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (150K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (30)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Wang, X
Right arrow Articles by Hickson, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, X
Right arrow Articles by Hickson, I.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?