Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (279K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Ioannidis, P
Right arrow Articles by Trangas, T
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ioannidis, P
Right arrow Articles by Trangas, T
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 1995 Oxford University Press 4969-4977

Footnote

In vivo generation of 3' and 5' truncated species in the process of c-myc mRNA decay

In vivo generation of 3 ' and 5 ' truncated species in the process of c- myc mRNA decay Panayotis Ioannidis1,2, Maria Havredaki1, Nelly Courtis2 and Theoni Trangas2,*

1Institute of Biology, NCSR-Demokritos, Athens, Greece and 2Papanikolaou Research Center of Oncology, `St Savvas' Hospital, 171 Alexandras Avenue, 11522 Athens, Greece

Received August 12, 1996; Revised and Accepted November 8, 1996

ABSTRACT

It has been demonstrated that the half-life of c-myc mRNA is modulated in response to physiological agents. The elucidation of the decay process and the identification of the critical steps in the in vivo c-myc mRNA degradation pathway can be approached by following the fate of c-myc mRNA under the influence of such factors. IFN-[alpha] was the factor used to modulate c-myc mRNA half-life in HeLa 1C5 cells, a stable clone derived from HeLa cells. This cell line carries multiple copies of the c-myc gene, under the control of the dexamethasone inducible mouse mammary tumor virus-long terminal repeat (MMTV-LTR). Exposure of HeLa 1C5 cells to IFN-[alpha] resulted in a further 2-fold increase over the dexamethasone-induced c-myc mRNA. However, the c-myc mRNA in IFN-[alpha] treated cells was less stable than that in the control cells. RNase H mapping of the 3' untranslated region of c-myc mRNA revealed, in addition to the full length mRNA, three smaller fragments. These fragments were proven to be truncated, non-adenylated c-myc mRNA species generated in vivo. Exposure of HeLa 1C5 cells to Interferon-[alpha] before induction with dexamethasone resulted in the enhanced presence of these intermediates. RNase H analysis of c-myc mRNA after actinomycin D chase revealed that deadenylation led to the formation of a relatively more stable oligoadenylated c-myc mRNA population which did not appear to be precursor to the truncated intermediates. The detection of truncated 3' end c-myc mRNA adenylated fragments as well, implies that the c-myc mRNA degradation process may follow an alternative pathway possibly involving endonucleolytic cleavage.

INTRODUCTION

The activation of c-myc protooncogene is implicated in tumorigenesis and is attributed to such diverse mechanisms as amplification, translocation, promoter insertion or retroviral transduction. All the above result in the constitutive expression of the gene which is implicated in oncogenesis in vivo and in vitro (for reviews see 1 and 2 ). Recently it has become clear that c-myc also serves pleiotropic cellular functions. Apart from its role as a factor controlling cellular proliferation, it also plays a central role in programmed cell death (apoptosis) (3 ,4 ). MYC proteins are nuclear phosphoproteins with helix-loop-helix leucine zipper domains specifying DNA and protein-protein interactions. MYC forms heterodimers with Max protein and acts as a transcription factor (reviewed in 5 ).

A complex array of regulatory mechanisms is involved in c-myc expression, including both transcriptional and post-transcriptional processes (1 ,2 ). The rapid downregulation of the gene is made possible by the instability of the corresponding mRNA (6 ) and protein products (7 ). Alterations of the half-life of c-myc mRNA have been documented and have been proven to be pivotal for c-myc gene expression. Modulation of the half-life of c-myc mRNA provides a commonly observed mechanism of c-myc regulation, often superimposed on transcriptional control. For example, mitogen stimulation of G0 arrested fibroblasts (8 ) resulted in increased half-life of the mRNA. On the other hand, induction of differentiation of MEL (9 ) and HL-60 (10 ) cells causes a decrease in the half-life of c-myc mRNA. Primary structure alterations of c-myc mRNA which result in lengthened half-life are often responsible for the deregulated c-myc expression in tumors (reviewed in 11 ).

Given the importance of mRNA stability in the regulation of gene expression, in a number of genes which also include other oncogenes, cytokines, interferons and growth factors, understanding the mechanisms underlying the control of RNA decay is important. One approach is to define RNA domains which can destabilize mRNA and are characteristic of short-lived mRNAs. Shaw and Kamen (12 ) observed that many transiently expressed mRNAs including GM-CSF, c-fos and c-myc have (A+U)-rich sequences (AREs) in their 3' untranslated region (UTR), which often contain multiple copies of the sequence with the core motif AUUUA. Construction of chimeric mRNAs containing such sequences at the 3' end of the stable globin mRNA resulted in the rapid decay of the message. The short half-life of c-myc is attributed to 3' UTR sequences which contain two copies of the AUUUA motif. Fusion of c-myc 3' UTR to the relatively stable neo mRNA resulted in reduction of the half-life from 6 h to 45 min (13 ). It has been proposed that certain other segments in addition to AUUUA in the 3' UTR region may contribute to the rapid decay of this message (14 ). Proteins which recognize specific sequences in this region have been identified and their role in modifying mRNA stability is under investigation (15 -17 ). In addition to the instability determinant found within the 3' UTR, c-myc mRNA also contains a sequence within the region coding for 335-439 amino acids that contributes to the rapid decay of c-myc mRNA. These coding sequences transferred to chimeric constructs conferred instability, independently of the presence of the 3' UTR elements. The destabilizing role of this element depends on c-myc translation (18 ).

Mechanisms of degradation of unstable mRNAs (c-fos, c-myc) have been studied by both in vivo and in vitro approaches. The available data demonstrate a sequential pathway in which deadenylation precedes degradation of the main body of the mRNA (11 ). The removal of the poly(A) tail in unstable mRNAs is very rapid as supposedly is the removal of the final adenosine residues. In contrast, in stable mRNAs, deadenylation is delayed upon reaching the last 30-60 adenosine residues. The failure to identify intermediate products in unstable mRNAs led to the assumption that following deadenylation, the main body of mRNA is degraded very rapidly by exonucleolytic cleavage.

In order to elucidate the critical steps in the c-myc decay pathway, we used a different approach. Our goal was to detect alterations in the decay process under conditions in which the half-life of c-myc mRNA is modulated. Among the factors known to affect c-myc mRNA stability in vivo are interferons (IFNs). Several lines of evidence suggest that IFNs act as negative regulators of c-myc expression in certain cell systems. IFNs have been shown to decrease the steady state levels of c-myc mRNA in Daudi cells and in murine sarcoma virus transformed NIH 3T3 cells. In the Daudi lymphoblastoma cells, IFN-[alpha] and IFN-[beta] have been shown to decrease the levels of c-myc transcripts via a postranscriptional mechanism, i.e., by selectively increasing the rate of degradation of c-myc mRNA (19 ,20 ). Based on the available data about c-myc mRNA mechanism of degradation, it may be possible that IFNs act by either preventing the formation of long poly(A) tails or by accelerating the deadenylation process. It is also possible that IFN-[alpha] may utilize an other mechanism to exert its destabilizing action.

The system used in this study was a clone derived from HeLa cells transfected with a dexamethasone (DX) inducible c-myc expression vector. Exposure of these cells to IFN-[alpha] resulted in the overexpression of c-myc mRNA which nevertheless, decayed faster than that of the control cells. Using this system, which provided high levels of c-myc expression, we have been able to identify specific degradation intermediates of c-myc mRNA generated in vivo: (i) a distinct population of c-myc mRNA with shortened poly(A) tails derived through deadenylation and (ii) truncated c-myc mRNA species lacking 3' end sequences. The detection of adenylated truncated fragments as well, indicated that c-myc mRNA degradation may involve endonucleolytic cleavage.

MATERIALS AND METHODS

Vector construction and cell transfection

Human genomic c-myc DNA (from pHSR-1 plasmid, American Type Culture Collection) was inserted 3' to MMTV-LTR into pMSG eukaryotic expression vector (Pharmacia), in two steps. First, PvuII-XhoI c-myc DNA fragment (-353 to +66 relative to P1 promoter) was ligated to SmaI and XhoI sites into the polylinker of pMSG. Consequently, XhoI-EcoRI (ending 500 bp 3' to pA2 polyadenylation sequences) c-myc genomic DNA fragment was ligated to the above construct. This ligation resulted to the excision of the SV40 polyadenylation signal sequences of the vector so that polyadenylation of c-myc mRNA would be controlled by its own signals (Fig. 1 A). c-myc nucleotide sequences given throughout this paper refer to the sequence published by Gazin et al. (21 ).


Figure 1. (A) Schematic representation of the pMSG-myc vector. c-myc genomic sequences were cloned into the pMSG vector as described under Materials and Methods. The positions of the restriction sites used in cloning are indicated on the diagram. P1 and P2 indicate the positions of the c-myc promoters. Open and grey boxes represent non-coding and coding regions respectively. (B) Dexamethasone induction of c-myc mRNA transcription in transfected cells and downregulation of this message in the parental cell line. c-myc mRNA expression in HeLa cells and in two pools of transfected cell populations (HeLa myc-1 and HeLa myc-2) after addition of 10% FCS (lane 1) and 10% FCS plus 3 * 10-7 M DX (lane 2) for 2 h. Expression of the unregulated gene GAPDH confirmed that similar amounts of total cellular RNA were added per lane.

HeLa cells were grown in RPMI 1640 supplemented with 10% FCS. Prior to transfection, HeLa cells were cultured for three passages in DMEM containing 10 mM HEPES and 10% FCS.

Transfection of HeLa cells was performed by the calcium phosphate precipitation method. 5 * 105 cells per 25 cm2 flask were seeded and cultured overnight in DMEM with HEPES and 10% FCS. Medium was changed 4 h prior to transfection and cotransfection was performed with pMSG-myc and pSV2-neo as described by Graham et al. (22 ), without using carrier DNA. After 24 h of exposure to DNA precipitate and a further 24 h incubation in fresh medium, G418 (400 [mu]g/ml) (Gibco-BRL) selection was applied for 22 days. Individual colonies were isolated, grown in mass cultures and analysed by Southern blot hybridization.

Cell culture

HeLa 1C5 cells were cultured and maintained in RPMI 1640 with 10% FCS in the continuous presence of 300 [mu]g/ml G418. Prior to each experiment cells were cultured for 48 h in RPMI 1640 plus 10% FCS and subsequently in fresh medium with 0.25% FCS for 48 h, before the addition of fresh RPMI 1640 containing 10% FCS or 10% FCS plus 10-5 M dexamethasone (induction). Exposure to IFN-[alpha] was performed by addition of 200 U/ml, 24 h before induction.

Northern hybridization

Total RNA was isolated as described by Chomczynski and Sacchi (23 ). An aliquot of 30 [mu]g of denatured total RNA was electrophoresed in 1.2% formaldehyde-agarose gels, transferred to nylon membranes (Zetaprobe, BioRad), immobilized and hybridized according to the manufacturer's instructions.

c-myc (1.3 kb ClaI-EcoRI exon 3 fragment) and GAPDH probes were labelled by the random primer method (`prime a gene system', Promega Co.). Autoradiographic signals were quantitated by using the Image 1.44 program to analyze autoradiograms scanned at 1200 d.p.i. with a UMAX scanner (Vista-S6).

Mapping of the 3' c-myc mRNA UTR

Oligonucleotide/RNase H treatment. c-myc mRNA was annealed to a specific DNA oligonucleotide and treated with RNase H. Each specific oligonucleotide is complementary to the regions 7199-7218 (oligo 1) and 7257-7278 (oligo 2). Deoxyoligonucleotide sequences were CCTTACGCACAAAGAGTTCCG (oligo 1) and CAAGTTCATAGGTGATTGCTC (oligo 2). RNase H mapping was performed as described by Brewer and Ross (26 ) i.e. 40 [mu]g total RNA were ethanol precipitated, resuspended in 20 [mu]l 1 mM EDTA, pH 7.4, and heated at 70oC for 10 min. Oligonucleotide (0.5 [mu]g) was added, and the reaction mixture was incubated at 20oC for 15 min. One [mu]l of 4 M KCl was added and the mixture was incubated at 20oC for 15 min, followed by the addition of 20 [mu]l TM buffer (40 mM Tris-HCl, pH 7.5, 60 mM MgCl2). RNase H was added (final concentration 20 U/ml) and the digestion was performed at 37oC for 30 min. Following digestion, RNA was ethanol precipitated. High resolution Northern blotting. RNA samples were separated by size, using a denaturing 4% polyacrylamide-urea gel as described by Stoeckle and Guan (25 ) and transferred electrophoretically to a charged mebrane (Zetaprobe, BioRad) according to the manufacturer's instructions. Filters were hybridized with the end-labelled deoxyoligonucleotide GGCTAAATCTTTCAGTCTCAAGACTCAGCCAAGGTTAGGTT which is complementary to the sequence 7300-7345.

Detection of 3' c-myc mRNA fragments

Total RNA was isolated from HeLa 1C5 cells exposed to IFN-[alpha] before the induction with dexamethasone as previously described. Polyadenylated mRNA was isolated using the Oligotex mRNA kit from Qiagen. The isolated mRNA was digested with RNase H in the presence of oligo dT as described before and electrophoresed in 4% acrylamide-urea gel. The RNA was electrophoretically transferred to Zetaprobe membrane. c-myc sequences were identified using an antisense RNA probe transcribed in vitro with SP6 RNA polymerase, using the Riboprobe System SP6/T7 (Promega). The template for the reaction was the plasmid pEP 40 (26) digested with HindIII. Hybridization was carried out according to the directions supplied by the manufacturer using 1.5 * 106 c.p.m./ml and the final wash was performed with 0.1* SSC, 0.5% SDS at 60oC for 60 min.


Figure 2. Effect of exposure to IFN-[alpha] on c-myc mRNA levels. (A) HeLa 1C5 cells were treated as described in Materials and Methods before addition 10% FCS + 10-5 M DX for 1 h. Lane a, control cells; lane b, cells exposed to 200 U/ml IFN-[alpha] for 24 h before the induction. (B) A pool of transfected cells was divided in three and maintained in culture as described in Materials and Methods. Cells were induced with 10% FCS (lane a), 10% FCS + 10-7 M DX (lane b) or 10% FCS + 10-7 M DX (lane c) after exposure for 24 h to 200 U/ml of IFN-[alpha]. Exposure to IFN-[alpha] before induction results in an ~2-fold increase in the c-myc mRNA levels in transfected cells.

Materials

IFN-[alpha]2[beta] (INTRON-A) was obtained from Scherring Co., dexamethasone (Decadron) from Merck Co. Inc., RNase H from Gibco BRL, actinomycin D, cycloheximide and cordycepin from Sigma Chemical Co., and the deoxyoligonucleotides used in this study were synthesized by the Microchemistry Laboratory, Molecular Biology and Biotechnology Institute, Heraclion, Crete. The pEP 40 plasmid was a kind gift from Dr Ite Laird-Offringa.

RESULTS

Establishment and characterization of the HeLa 1C5 cell line

The study of the c-myc mRNA degradation pathways was approached by using a system in which high levels of c-myc mRNA expression could be attained and in which the rates of degradation of this mRNA could be modulated. High levels of steady state c-myc mRNA expression were achieved by adding dexamethasone to HeLa cells transfected with the eukaryotic expression vector pMSG, carrying c-myc sequences from -353 relative to P1 promoter to +500 3' of the second polyadenylation site. On the other hand, addition of dexamethasone to the parental cell line HeLa resulted in the downregulation of c-mycmRNA (Fig. 1 B). Since the SV40 polyadenylation signal of the vector was removed, the 3' end of the induced c-myc mRNA was identical to that of the endogenous normal c-myc mRNA.

Out of several clones isolated after cotransfection with pSV2-neo only one stable clone, HeLa 1C5, was found to contain intact exogenous copies of the c-myc gene. A single EcoRI fragment (Fig. 1 A) was found to hybridize to both c-myc 3' sequences and the MMTV-LTR (data not shown). HeLa 1C5 cells were continuously maintained in the presence of 300 [mu]g/ml G418. A year after the initial isolation the stability of the inserted sequences was confirmed by Southern blotting. Since transfected HeLa cells with pMSG-myc were gradually lost by apoptosis, the survival and the stability of HeLa 1C5 was attributed to the presence of a rearranged bcl-2 gene and to the expression of bcl-2 mRNA, which were detected (data not shown) (27 ). RNase H mapping of the 5' end of the c-myc mRNA induced by dexamethasone in HeLa 1C5 cells, revealed that promoter usage was identical to that of untransfected cells (data not shown). No message initiating at the MMTV-LTR promoter could be detected. This observation can be explained on the basis of previous data that a functional P2 promoter prevents transcriptional read through from upstream promoters (28 ).

Effects of IFN-[alpha] upon c-myc expression in HeLa 1C5 cells

We used IFN-[alpha] to test whether we could modulate c-myc mRNA stability in HeLa 1C5 cells. Exposure of HeLa 1C5 cells to IFN-[alpha] before dexamethasone induction resulted in a 2-fold increase in the steady state c-myc mRNA levels over the untreated cells, a finding also observed in the pools of transfected cells (Fig. 2 ) in contrast with what has been reported for the parental cell line (29 ), and in agreement with the effect observed in other cell lines such as HL-60 and U-937 (30 ). However, despite the increase, actinomycin D chase revealed that c-myc mRNA decays more rapidly in HeLa 1C5 cells exposed to IFN-[alpha] (Fig. 3 ). Therefore, the 2-fold increase in the levels of c-myc mRNA expression could not be attributed to stabilization since the c-myc mRNA isolated from cells exposed to IFN-[alpha] was relatively less stable (~1.5*) than that of the control cells. The observed effect of IFN-[alpha] upon c-myc mRNA stability in HeLa 1C5 cells was reproducible and was comparable with that observed in other cell lines (31 ,32 ). Thus, this system, which could provide high levels of rapidly degraded c-myc mRNA, was suitable for the investigation of the degradation mechanism of this mRNA and the identification of intermediate products.


Figure 3. (A) Northern blot analysis of c-myc mRNA from HeLa 1C5 cells after actinomycin D chase. Cells were treated as described under Materials and Methods before the addition of 10% FCS + 10-5 M DX. Three hours later, actinomycin D (5 [mu]g/ml final concentration) was added and RNA was isolated at the times indicated. (a) Control cells; (b) cells exposed to 200 U/ml IFN-[alpha] for 24 h. (B) Graphic representation of the results obtained by Northern blot analysis after normalization to the levels of GAPDH expression. Values are the mean of three experiments. Standard deviation is indicated by error bars. These data demonstrate that exposure to IFN-[alpha] results in a small albeit reproducible acceleration by 1.5* in the decay rate of c-myc mRNA.

Detection of c-myc mRNA truncated fragments

Previous data indicate that exposure of cells to IFN-[alpha] results in the reduction of the cytoplasmic poly(A) polymerase activity (33 ). These observations and the increased instability of the c-myc mRNA in these cells led us to investigate whether any alterations in the length of the poly(A) tail were caused by IFN-[alpha] which resulted in faster decay (34 ). In order to test whether the IFN-[alpha] action is exerted through alterations in the poly(A) status or alterations in the rate of deadenylation or by an alternative mechanism, we proceeded in RNase H mapping of the 3' end of c-myc mRNA as described in Materials and Methods. Figure 4 shows the sequences recognized by the oligonucleotides used in this study in the RNAse H reactions and the oligonucleotide used as the probe to detect the reaction products. This experimental approach was expected to yield RNA fragments extending above 269 and 411 nt derived from pA1 and pA2 polyadenylation signals respectively when oligonucleotide 2 was used, and fragments extending over 329 and 471 when oligonucleotide 1 was used (35 ). Since pA2 is the major polyadenylation signal (26 ) we expected that the majority of the reaction products would range from 411 to ~600 nt or from 471 to 670 nt depending on the oligonucleotide used in the reaction.


Figure 4. Schematic representation of the 3' UTR of the c-myc mRNA showing the positions of the sequences recognized by oligo 1 and oligo 2 used for RNase H mapping, the expected fragments and the position of the oligo used as probe.


Figure 5. RNase H mapping of the c-myc mRNA in HeLa 1C5 cells reveals a non-uniform distribution in the sizes of the poly(A) tails and the existence of truncated c-myc mRNA species. (A) HeLa 1C5 cells were treated as described in Materials and Methods before addition of 10% FCS (lane 1); 10% FCS + 10-5 M DX (lane 2); 10% FCS + 10-5 M DX after exposure to 200 U/ml IFN-[alpha] for 24 h (lane 3); 10% FCS + 10-5 M DX in the presence of 20 [mu]g/ml cordycepin (Cd) (lane 4). RNA was isolated 3 h later and RNase H mapping was performed as described under Materials and Methods, using oligo 2 for the cleavage reaction. The brackets show the distribution of the polyadenylated fragments derived from pA2 and pA1 polyadenylation sites. The arrows indicate the position of the minor fragments I, II and III and their estimated sizes. (B) Densitometric scans of the corresponding lanes. Scan of lane 4 shows that cordycepin resulted in a shift towards smaller sizes of poly(A) tails and that the oligoadenylated species mainly present were producing a peak. The same identifiable peak is present in the other lanes indicating an enhanced representation of oligoadenylated species. The c-myc mRNA species with longer poly(A) tails have a uniform distribution in lanes 1, 2 and 3. (C) Densitometric scans of the different distinct products across the lanes show the proportional relation between intact c-myc mRNA and truncated species under the conditions tested. Exposure to IFN-[alpha] caused a marked increase in the intensity of the smaller fragments with respect to the intact c-myc mRNA, while cordycepin did not have any noticeable effect.

Figure 5 includes the data obtained from RNase H mapping using oligo 2 of RNA isolated from HeLa 1C5 cells under various conditions of c-myc mRNA induction. The following observations were made. (i) Under all conditions tested the c-myc mRNA polyadenylated at the pA2 site did not have a homogeneous distribution in the lengths of poly(A) tails. A significant proportion of the message had short or no poly(A) tails and this became more evident under conditions of c-myc mRNA overexpression. (ii) The densitometric scans of autoradiograms indicated that exposure to IFN-[alpha] did not have a drastic effect upon poly(A) tail sizes (Figs 5 B and 3 ). (iii) In addition to the full length polyadenylated c-myc mRNA at the two polyadenylation sites, we observed a specific pattern of smaller products in all RNA samples (fragments I, II and III). These three smaller species were more prominent and had an altered internal distribution in mRNA from cells exposed to IFN-[alpha] (Fig. 5 C). In lane 4 the data from RNA isolated from cells treated with the polyadenylation inhibitor cordycepin are shown. The adenosine analogue cordycepin (3'dA) which mainly interferes in the formation of the poly(A) tail by preventing chain elongation (36 ) alters the distribution of the poly(A) tails of intact c-myc mRNA, synthesized in its presence, towards smaller sizes. Cordycepin addition did not have any effect on the appearance of the smaller species and furthermore, no change in the mobility of the truncated species was observed suggesting that they do not possess poly(A) tails. The absence of poly (A) tails was confirmed by the fact that the mobility of the truncated fragments was not altered after removal of the poly(A) tails with RNase H in the presence of oligo dT (data not shown).

When using a second oligo which recognizes sequences 60 nt downstream, the size of the smaller bands shifted accordingly, indicating that these were derived from truncated c-myc mRNA generated in vivo. The appearance of these specific intermediate products was dependent on the presence in the reaction of RNase H and an oligonucleotide (Fig. 6 ; lanes 3 and 4 share the same non-specific background). The estimated sizes of the fragments place the 3' ends of the in vivo intermediate products at the regions presented in Figure 6 B. The existence of identical in size minor products was also confirmed in the untrasfected HeLa cells (Fig. 7 ). The intensity of the three major bands correlated with the levels of c-myc mRNA expression characteristic of the two cell lines, HeLa 1C5 induced with dexamethasone and HeLa (lanes 1 and 2).


Figure 6. Characterization of c-myc mRNA truncated species. (A) RNase H mapping of c-myc mRNA from HeLa 1C5 cells exposed for 3 h to 10% FCS + 10-5 M DX using oligo 1 (lane 1); oligo 2 (lane 2); no oligo (lane 3); no RNase H (lane 4). M: RNA markers. The arrows on the left of the figure indicate the position and the estimated sizes of the minor products generated with oligo 1 (lane 1). Correspondingly, the arrows on the right of the figure indicate the positions and the sizes of the smaller products when using oligo 2 (lane 2). Accordingly the brackets show the distribution of the poly(A) tails derived form pA2 and pA1. (B) Relative positions of the cleavage regions on the 3' end of the c-myc mRNA. The flags indicate the positions where polyadenylation starts following the polyadenylation signals pA1 and pA2. The arrows indicate the positions of the corresponding sites.

The truncated c-myc mRNAs which we detect, could possibly represent the products of the process following the deadenylation step and they could be generated either via endonucleolytic cleavage or they became detectable due to defined pausing of an exonuclease. Alternatively, they could be generated by the activation of an independent degradation mechanism involving endonucleolytic cleavage.

The last hypothesis would predict the existence of matching 3' end fragments for the truncated intermediates of c-myc mRNA. In order to identify such intermediates, polyadenylated mRNA was isolated from HeLa 1C5 cells cultured under conditions in which the truncated species were most prominent, i.e., exposure to IFN-[alpha] before induction with dexamethasone. The poly(A) tails were removed by digestion with RNase H in the presence of oligo dT and the RNA was analyzed by high resolution Northern blotting. The 3' end c-myc mRNA sequences were recognized using a radioabeled antisense RNA probe transcribed in vitro which spans the 3' UTR and recognizes the last 369 nt (26 ). Under the conditions employed, any fragment detected other than the full length c-myc mRNA must represent 3' c-myc mRNA sequences which retain a minimal poly(A) tail, at least. The results shown in Figure 8 demonstrate apart from the full length c-myc mRNA several such distinct fragments. Among those, E, D and C could represent the matching fragments for the truncated species I, II and III (Fig. 5 ) respectively. The existence of longer fragments is also evident. The identification of the truncated intermediates I, II and III and the detection of adenylated 3' truncated fragments (Fig. 8 ) suggest that c-myc mRNA may be subjected in vivo to endonucleolytic cleavage.

It could be postulated that the process generating the above degradation intermediates is a subsequent step to the deadenylation process therefore, a precursor-product relationship should exist between the oligoadenylated c-myc mRNA and the truncated products. This would lead to the prediction that, as long as precursor RNA is available, the truncated species would be generated at a steady rate. To investigate the above possibilities we performed an actinomycin D chase under various conditions and we proceeded to RNase H mapping of the c-myc mRNA. The data in Figure 9 show that under all conditions applied (i.e., induction with serum or exposure to IFN-[alpha] before the induction) there was a gradual deadenylation process and accumulation of c-myc mRNA species having short poly(A) tails. The accumulation of short tailed c-myc mRNA did not result in the enhancement of the truncated products. On the contrary, the intensity of these products was reduced as the chase proceeded even though the intact oligoadenylated form persisted (Fig. 9 c and d). Thus, c-myc mRNA degraded through sequential deadenylation did not appear to be a precursor to the truncated species unless the process of their generation was inhibited by actinomycin D. There was, also, no indication that any of the truncated species was a precursor to a shorter one. The above observations may suggest that the truncated species are generated by an alternative endonucleolytic degradation mechanism which may not require deadenylation.

Our data are compatible with the existence of a degradation mechanism of c-myc mRNA resulting in the generation of truncated intermediates, probably through endonucleolytic cleavage at several sites. The enhanced presence of these truncated products in cells exposed to IFN-[alpha] may suggest the further activation of this mechanism.

DISCUSSION

The study of the regulation of mRNA stability has been approached in several ways. For unstable mRNAs, such as those of oncogenes, cytokines etc., in which rapid decay is a critical regulatory step of gene expression, the focus has been on cis-acting elements conferring instability, trans-acting factors controlling degradation and the sequence of events in the process of degradation. It is known that the half-life of certain mRNAs, such as that of c-myc, can be modulated by physiological stimuli. The elucidation of the changes in the mechanism of degradation under the influence of such physiological stimuli will help identify the key steps in mRNA decay and the factors affecting mRNA stability.

Removal of the poly(A) tail seems to be a prerequisite step in the degradation process of the majority of mRNAs. Differences in the stability of mRNAs are attributed to the differences in the rate of deadenylation. Since in stable mRNAs, such as globin mRNA, deadenylation stops upon reaching a minimum length of poly(A) protecting the message from exonucleolytic attack, it is believed that the instability elements present in unstable mRNAs act by enhancing the rate of deadenylation and further by promoting the complete removal of poly(A) tail (11 ,34 ,37 ). Therefore, for unstable mRNAs it is proposed that the rate of deadenylation is the critical step of degradation. For example, Laird-Offringa et al. (38 ) have shown that c-myc mRNA from HeLa cells is rapidly deadenylated before final degradation and have proposed that deadenylation is the rate limiting step in vivo. Studies using an in vitro decay system provide similar evidence (39 ). Shyu et al. (40 ) have shown that AREs from the c-fos mRNA mediate decay by first stimulating deadenylation and then by providing an element that directs the next phase of the degradation process. Nevertheless, uncoupling of the two elements was achieved by point mutations that maintained the ability to control deadenylation but abolished the ability to stimulate further decay. This observation indicates that the decay of unstable mRNAs may also involve a two step process.

Assuming that the deadenylation process of c-myc mRNA occurs at a steady rate-at all its stages-and when the mRNA becomes deadenylated it rapidly decays, then one would expect that all sizes of poly(A) tail should be equally represented at any time during this process. The data presented here show that in HeLa 1C5 cells there was no homogeneous distribution in the size of poly(A) tails. We observed an accumulation of c-myc mRNA with short or no poly(A) tails. Our experimental approach does not allow the distinction between oligoadenylated or completely deadenylated mRNA. We consider likely that it is oligoadenylated, based on the observations of Chen and Shyu (41 ) who show that deadenylation of chimeric mRNAs carrying the 3' UTR of c-myc does not lead to complete removal of the poly(A) tail. The data in Figure 9 show that the oligoadenylated c-myc mRNA species was derived by the deadenylation process and was more stable than its precursor.


Figure 7. RNase H mapping (using oligo 2) of c-myc mRNA isolated from HeLa 1C5 induced with 10% FCS + 10-5 M DX (left lane) or HeLa cells induced with 10% FCS (right lane). The arrows show the position of the smaller products. Note that their intensity correlates with total steady state c-myc mRNA levels.


Figure 8. Identification of adenylated c-myc mRNA fragments lacking 5' sequences. The following RNA samples were analyzed by high resolution Northern blotting using 32P-labelled antisense RNA spanning the 3' UTR c-myc sequences (see Materials and Methods). Lane 1, 60 [mu]g total RNA was digested with RNase H in the presence of oligo 2; lane 2, as in lane 1, in the presence of oligo dT; lane 3, 70 [mu]g polyA(-) RNA was treated as in lane 1; lane 4, poly (A)+ mRNA isolated from 400 [mu]g total RNA was digested with RNase H in the presence of oligo dT; lane 5, 60 [mu]g total RNA was digested with RNase H in the presence of oligo 1. Brackets show the distribution of poly(A) tails derived from pA2 and arrows point out the position of the deadenylated fragments derived from cleavage with RNase H in the presence of oligo 2 (left) or oligo 1 (right). The size of the deadenylated fragments is noted in the parenthesis. Removal of the poly(A) tails from poly(A)+ mRNA revealed in addition to full length c-myc mRNA five smaller bands. The letters A, B, C, D and E on the right indicate the position of the distinct c-myc mRNA fragments and F.L. the position of the full length c-myc mRNA.


Figure 9.RNase H mapping of c-myc mRNA isolated after actinomycin D chase from cells treated with (a) 10% FCS and (b) 10% FCS + 10-5 M DX after exposure to 200 U/ml IFN-[alpha] for 24 h. Actinomycin D (final concentration 5 [mu]g/ml) was added 3 h later and RNA was isolated at the times indicated. Densitometric scans of the corresponding lanes in b (c) and across the lanes in b (d) show that the truncated species decay rapidly and that they do not appear to be generated from the oligoadenylated species derived through deadenylation.

Swartwout and Kinninburgh (10 ) have estimated that non-adenylated mRNA is more stable in HL-60 cells since the half-life for poly(A)-c-myc mRNA is twice as long as that for poly(A)+. Furthermore, Chen and Shyu (41 ) suggest that the time required for deadenylation is much shorter than the time required for the overall decay. All the above observations indicate that the metabolic fate of the oligoadenylated message determines the decay rate of c-myc mRNA, provided that it reaches the oligoadenylated state.

RNase H mapping revealed the presence of smaller non- adenylated fragments hybridizing to c-myc 3' end sequences. These fragments did not represent small RNAs crossreacting with the probe, since they were absent when no RNase H or oligonucleotides were used in the reaction (Fig. 6 ). When using two different oligonucleotides which recognized sequences 60 nt apart, the products yielded by RNase H digestion showed a corresponding shift in size. This observation also excluded the possibility of inaccurate cleavage due to non-specific RNA-oligonucleotide hybrid formation. Furthermore, the internal distribution of these fragments was altered in response to IFN-[alpha] (Fig. 5 ). Thus, we concluded that they represented truncated c-myc mRNAs generated in vivo.

The presence of these intermediates which we observed can be accounted in two ways: such fragments may result through endonucleolytic cleavage or due to a defined pause in the processive action of a 3'-5'-exonuclease. The identification of adenylated fragments containing c-myc mRNA 3' sequences support the former hypothesis. The putative endonucleolytic cleavage could either follow the deadenylation process as it has been reported for human gro-[alpha] mRNA (42 ) or could occur due to the activation of an alternative degradation mechanism, independent of deadenylation. Such intermediates have been reported before. A short form of the TfR mRNA has been identified lacking at least a portion of 3' UTR (43 ). Truncated mRNAs have been reported for other eukaryotic mRNAs as well, including chick fibroblast 9E3 (44 ), chicken apo VLDL II (45 ), Xenopus Xlhbox 2b (46 ) and human histone H4 (35 ). For some of the above truncated mRNAs matching adenylated fragments have been identified which would prove the existence of an alternative degradation mechanism involving endonucleolytic cleavage. These include chicken liver apo VLDL mRNA, Xenopus oocyte Xlhbox 2b mRNA, chick fibroblast 9E3 mRNA, mouse albumin mRNA (47 ) and TfR mRNA(43 ).

A truncated mRNA encoding for c-myc has been observed before but was not identified as such (26 ). Brewer and Ross (39 ) have reported the in vitro generation of truncated c-myc mRNA species following the deadenylation process which derive from mRNA adenylated at the pA2 site and terminate between pA1 and pA2. These are not related to the three species of truncated c-myc mRNAs which we identified since they have different sizes and they arise through a different mechanism. Our experimental approach would not permit us to distinguish products terminating between pA1 and pA2 from the message adenylated at the pA1 site. The truncated products which we identified seem to arise through a process independent of deadenylation from poly(A)(+) c-myc mRNA species. When analyzing the poly(A)(+) RNA we identified several c-myc mRNA fragments lacking 5' sequences. Three of them are candidates for the matching fragments of the truncated species. The existence of larger fragments implies the existence of additional cleavage sites 5' to the sequences which we studied and which spans the last 471 nt of c-myc mRNA.

Endonucleolytic cleavage of c-myc mRNA has been demonstrated within a sequence further upstream to the area we studied. Endonucleolytic cleavage was attained by competing out, in vitro, a protective 70 kDa protein which binds to the 180 nt instability element in the coding region (48 ). Evidence for multiple endonucleolytic cleavage sites within the c-myc 3' UTR has been also provided by in vitro studies in which these sequences were cleaved by a human RNase E-like enzyme (49 ).

The loss of polyadenylated c-myc mRNA without prior deadenylation has been reported before in HL-60 cells induced for differentiation (10 ). The truncated products which we identified also seem to arise independently from poly(A)(+) c-myc mRNA. We base this assumption on the actinomycin D data demonstrating that there is no obvious precursor-product relationship between poly(A)(-) c-myc mRNA and the truncated species (Fig. 9 c and d), which indicates that the oligoadenylated message does not unconditionally become converted to truncated species. The truncated products disappear even though intact oligoadenylated c-myc mRNA is available (Fig. 9 ). This observation can be explained either by an alternative degradation mechanism which is independent of deadenylation or by the possibility that the mechanism generating truncated species is sensitive to actinomycin D. In that case the metabolic fate of deadenylated c-myc mRNA is controlled by more than one mechanisms only one of which is sensitive to this drug, since actinomycin D does not stabilize c-myc mRNA overall. The use of IFN-[alpha] in our system allowed us to conclude that the appearance of truncated c-myc mRNAs is regulated. IFN-[alpha] in HeLa 1C5 increased the steady state c-myc mRNA levels opposite to its effect upon HeLa cells (31 ). However, IFN-[alpha] maintained its destabilizing action since the rate of c-myc mRNA decay increased after exposure to IFN-[alpha]. RNase H mapping showed that the amounts of truncated species increased, as well. The question arises whether the enhanced endonucleolytic cleavage was a direct or indirect effect of IFN-[alpha] which occurred in response to high steady state levels of c-myc mRNA, as an emergency feedback mechanism, efficiently preventing translation of the surplus message.

A mechanism exists which is a likely candidate in mediating such an IFN-[alpha] induced action. IFNs induce 2'-5' oligo(A)synthetase whose product, 2'-5' oligo(A), activates in turn the latent endonuclease RNase L (50 ). The activation of RNase L may account for the enhanced endonucleolytic cleavage of c-myc mRNA. Partial abrogation of 2'-5' oligo(A) synthetase activity reverses the destabilizing effect of IFN-[alpha] upon c-myc mRNA, indicating that IFN action may be mediated through RNase L (33 ). Alternatively, IFN-[alpha] could exert its effects either by releasing sequence specific RNA binding proteins which protect c-myc mRNA from endonucleolytic attack or by inducing the binding of destabilizing proteins. These mechanisms are not mutually exclusive.

Our system will provide the opportunity to address some of these questions. It would be of interest, for example, to investigate whether blocking the 2'-5' oligo (A) synthetase pathway would inhibit the generation of c-myc mRNA truncated species. Precise mapping of the cleavage sites would confirm the mechanism of endonucleolytic cleavage and perhaps would provide information about the sequence specificity of this process.

ACKNOWLEDGEMENTS

The authors thank Drs J. Ross, M. S. Coleman and D. H. Sorscher for their critical comments on the manuscript, and Dr C.M. Tsiapalis for his suggestions. This work was supported by a grant from the Greek Ministry of Health to T.T. We would also like to thank the Greek Society for Cancer Study for financial support.

REFERENCES

1 Marcu,K.B., Bossone,S.A. and Patel,A.J. (1992) Annu. Rev. Biochem., 61, 809-860. MEDLINE Abstract

2 Spencer,C. and Groudine,M. (1991) Adv. Cancer Res. 56, 1-50. MEDLINE Abstract

3 Evan,G.I., Wyllie,A.H., Gilbert,C.S., Littlewood,T.D., Land,H., Brooks,M., Waters,C.M., Penn,L.Z. and Hancock.,D.C. (1992) Cell, 69, 111-122.

4 Shi,Y., Glynn,J.M., Guilbert,L.J., Cotter,T.G., Bissonette,R.P. and Green,D.E. (1992) Science 257, 212-214. MEDLINE Abstract

5 Meichle,A., Philipp,A. and Eilers,M. (1992) Biochim. Biophys. Acta. 1144, 129-146.

6 Dani,C., Blanchard,J.M., Piechaczyk,M., El Sabouti,S., Marty,L. and Jeanteur,P. (1984) Proc. Natl. Acad. Sci. USA 81, 7046-7050. MEDLINE Abstract

7 Ramsay,G., Evan,G.I. and Bishop,J.M. (1984) Proc. Natl. Acad Sci. USA 81, 7742-7749. MEDLINE Abstract

8 Blanchard,J.M., Piechaczyk,M., Dani,C., Chambard,J.C., Franchi,A., Pouyssegur,J. and Jeanteur,P. (1985) Nature 317, 443-445 MEDLINE Abstract

9 Mechti,P., Piechaczyk,M., Blanchard,J.M., Marty,L., Bonnieu,A., Jeanteur,P. and Lebleu,B. (1986) Nucleic Acids Res. 14, 9653-9660.

10 Swartwout,S.G. and Kinninburgh,A.J. (1989) Mol. Cell. Biol. 9, 288-295. MEDLINE Abstract

11 Schiavi,S.C., Belassco,J.G. and Greenberg,M.E. (1992) Biochim. Biophys. Acta 1114, 95-106. MEDLINE Abstract

12 Shaw,G. and Kamen,R. (1986) Cell 46, 659-667. MEDLINE Abstract

13 Jones,T.R. and Cole,M.D. (1987) Mol. Cell. Biol. 7, 4513-4521. MEDLINE Abstract

14 Bonnie,A.P., Roux,P., Marty,L., Jeanteur,P. and Piechaczyk,M. (1990) Oncogene 5, 1585-1588.

15 Alberta,J.A., Rundell,K. and Stiles,C.D. (1994) J. Biol. Chem. 269, 4532-4538. MEDLINE Abstract

16 Brewer,G. (1991) Mol. Cell. Biol. 11, 2460-2466. MEDLINE Abstract

17 Vakalopoulou,E., Shaack,J. and Shenk,T. (1991) Mol. Cell. Biol. 11, 3355-3364. MEDLINE Abstract

18 Wisdom,R. and Lee,W. (1991) Genes Dev. 5, 232-234. MEDLINE Abstract

19 Dani,C., Mechti,N., Piechaczyk,M., Lebleu,B., Jeanteur,P. and Blanchard,J.M. (1985) Proc. Natl. Acad. Sci. USA 82, 4896-4899. MEDLINE Abstract

20 Knight,E., Anton,E.D., Fahey,D., Friedland,B.K. and Jonak,G.J. (1985) Proc. Natl. Acad. Sci. USA 82, 1151-1154. MEDLINE Abstract

21 Gazin,C., Dupont de Dinechin,S., Hampe,A., Masson,J.M., Martin,P., Stehelin,D. and Galibert,F. (1984) EMBO J. 3, 383-387. MEDLINE Abstract

22 Graham,F.L., Baccheti,S., McKinnon,R., Stanners,G., Cordell,B. and Goodman,H. (1980) in Baserga,R., Croce,C. and Rivera,G. (eds), Introduction of Macromolecules into Viable Cells. Alan R. Liss. NY. pp. 3-22.

23 Chomczynski,P. and Sacchi,N. (1987) Anal. Biochem. 162, 156-159. MEDLINE Abstract

24 Brewer,G. and Ross,J. (1990) Methods Enzymol. 181, 202-209. MEDLINE Abstract

25 Stoeckle,M.Y. and Guan,L. (1993) BioTechniques 15, 230-231.

26 Laird-Offringa,I.A., Elfferich,P., Knaken,H.J., de Ruiter,J. and van der Eb,A.J. (1989) Nucleic Acids Res. 17, 6499-6514. MEDLINE Abstract

27 Bissonette,R.P., Echeverri,F., Mahboubi,A. and Green,D.R. (1992) Nature 359, 552-556.

28 Strobl,L.J., Kohlhuber,F., Mautner,J., Polack,A. and Eick,D. (1993) Oncogene 8, 1437-1447. MEDLINE Abstract

29 Kelly,J.M., Gilbert,C.S., Stark,G.R. and Kerr,I.M. (1985) Eur. J. Biochem. 153, 367-371. MEDLINE Abstract

30 Kimchi,A. (1987) Interferon 8, 85-110. MEDLINE Abstract

31 Chatterjee,D. and Savarese,T.M. (1992) Cancer Chemother. Pharmacol. 30, 12-20. MEDLINE Abstract

32 Meurs,E. and Hovanessian,A.G. (1988) EMBO, J. 7, 1689-1696.

33 Havredaki,M., Garyfallides,S. and Tsiapalis,C.M. (1992) J. Biol. Regulators and Homeostatic Agents 6, 143-144.

34 Sachs,A.B. (1993) Cell, 74, 413-421. MEDLINE Abstract

35 Ross,J., Peltz,S.W., Kobs,G. and Brewer,G. (1986) Mol. Cell. Biol. 6, 4362-4371. MEDLINE Abstract

36 Shuman,S. and Moss,B. (1988) J. Biol. Chem. 263, 8405-8412. MEDLINE Abstract

37 Laird-Offringa,I.A. (1992) BioEssays, 14, 119-124. MEDLINE Abstract

38 Laird-Offringa,I.A., De-Wit,C.L., Elfferinch,P. and Van Der Eb,A.J. (1990) Mol. Cell. Biol. 10, 6132-6140. MEDLINE Abstract

39 Brewer,G. and Ross,J. (1988) Mol. Cell. Biol. 8, 1697-1708. MEDLINE Abstract

40 Shyu,A.B., Belasco,J.G. and Greenberg,M.E. (1991) Genes Dev. 5, 221-231. MEDLINE Abstract

41 Chen,C.-Y. and Shyu,A.-B. (1994) Mol. Cell. Biol. 14, 8471-8482. MEDLINE Abstract

42 Stoeckle,M.Y. (1992) Nucleic Acids Res. 20, 1123-1127. MEDLINE Abstract

43 Binder,R., Horowitz,A.J., Basilion,J.P., Koeller,D.M., Klausner,R.D. and Harford,J.B. (1994) EMBO J. 13, 1969-1980. MEDLINE Abstract

44 Stoeckle,M. and Hanafusa,H. (1989) Mol. Cell. Biol. 9, 4738-4745. MEDLINE Abstract

45 Binder,R., Hwang,S.L., Ratnasabapathy,R. and Williams,D.L. (1989) J. Biol. Chem. 264, 16910-16918. MEDLINE Abstract

46 Brown,B.D. and Harland,R.M. (1990) Genes Dev. 4, 1125-1135.

47 Tharun,S. and Sidershmukh,R. (1995) Nucleic Acids Res. 23, 641-646. MEDLINE Abstract

48 Bernstein,P.L., Herrick,D.J., Prockipcak,R.D. and Ross,J. (1992) Genes Dev. 6, 642-654. MEDLINE Abstract

49 Wennborg,A., Sohlberg,B., Angerer,D., Klein,G. and von Gabain,A. (1995) Proc. Natl. Acad Sci. USA 92, 7322-7326. MEDLINE Abstract

50 Kerr,I.M. (1987) J. Interferon Res. 7, 505-510. MEDLINE Abstract

Return

*To whom correspondence should be addressed. Tel: +30 1 6437210/6409466; Fax: +30 1 6421022/6420146; Email: t.trangas@genet.ath.forthnet.gr
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Nucleic Acids ResHome page
E. L. van Dijk, J. S. Sussenbach, and P. E. Holthuizen
Kinetics and regulation of site-specific endonucleolytic cleavage of human IGF-II mRNAs
Nucleic Acids Res., September 1, 2001; 29(17): 3477 - 3486.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. H. Lee, P. Leeds, and J. Ross
Purification and Characterization of a Polysome-associated Endoribonuclease That Degrades c-myc mRNA in Vitro
J. Biol. Chem., September 25, 1998; 273(39): 25261 - 25271.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. J. Tierney and R. L. Medcalf
Plasminogen Activator Inhibitor Type 2 Contains mRNA Instability Elements within Exon 4 of the Coding Region. SEQUENCE HOMOLOGY TO CODING REGION INSTABILITY DETERMINANTS IN OTHER mRNAs
J. Biol. Chem., April 20, 2001; 276(17): 13675 - 13684.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (279K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Ioannidis, P
Right arrow Articles by Trangas, T
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ioannidis, P
Right arrow Articles by Trangas, T
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?