Skip Navigation

This Article
Right arrow Extract Freely available
Right arrow Print PDF (38K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Citing Articles
Right arrowScopus Links
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Al-Qahtani, A
Right arrow Articles by Mensa-Wilmot, K
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Al-Qahtani, A
Right arrow Articles by Mensa-Wilmot, K
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 1996 Oxford University Press 1173-1174

Footnote

A 5 ' untranslated region which directs accurate and robust translation by prokaryotic and mammalian ribosomes

A 5 ' untranslated region which directs accurate and robust translation by prokaryotic and mammalian ribosomes Ahmed Al-Qahtani and Kojo Mensa-Wilmot*

Department of Cellular Biology, The University of Georgia, 724 BioSciences, Athens , GA 30602, USA

Received January 2, 1996; Accepted January 26, 1996

Initiation of protein synthesis is regulated by sequence and structure of a mRNA [reviewed in ( 1 )]. In prokaryotes, a ribosome binding site (RBS) (AGGAGG) suitably positioned at the 5'-end of the mRNA directs efficient translation. Activity of a RBS may be influenced by the length and nucleotide composition of the spacer which separates the RBS and the initiator (AUG) ( 2 ). In vertebrates, a Kozak sequence GCCG/ACCAUGC juxtaposed to the initiator promotes efficient and accurate translation on a mRNA with a short 5' untranslated region (5' UTR) ( 1 ). A mRNA which lacks the Kozak consensus may be translated efficiently if it possesses a moderately long 5' UTR that lacks stable secondary structures ( 3 ).

Frequently, it is desirable for investigators to be able to express a single protein both in prokaryotes and eukaryotes. However, efficient translation of proteins in these two systems dictates the use of two different 5' UTRs, as discussed above, to fulfill the requirements of the prokaryotic and eukaryotic translational machineries. To circumvent this problem, we tested the hypothesis that a single upstream element which combines some features of both eukaryote and prokaryote 5' UTRs may function with both prokaryotic and mammalian ribosomes. A RBS and spacer (AGGAGGGTTTTTA) of the Ner gene from bacteriophage Mu has been used for high level expression of proteins in Escherichia coli and Streptomyces ( 4 , 5 ). Herein, we demonstrate that a variant of this Ner RBS-spacer which was altered to incorporate two nucleotides (CC) next to the initiator ATG, termed Ner RBS-hybrid-spacer ACC , can sponsor very efficient translation of proteins in a vertebrate (rabbit reticulocyte) system. A control RBS-spacer from the LacZ gene of E.coli was ineffective in this cross-species translational stimulation function exhibited by the Ner RBS-spacer.

By high fidelity PCR-mediated mutagenesis ( 6 ), the Ner RBS-hybrid-spacer ACC (AGGAGGGTTTTTACC) was linked to the 5' region of two test coding sequences, alkaline phosphatase of E.coli ( 7 ), and a glycosyl phosphatidylinositol phospholipase C (GPI-PLC) from the protozoan parasite Trypanosoma brucei ( 8 ). Primers and templates used were as follows. Alkaline phosphatase [Delta]2-22: Template, pAD135 ( 7 ); 5' primer, (F1 AP[Delta]2-22, TAAGGATCCTTAACTTAGGAGGGTTTTTACCATGACACCAGAAATGCCTGTTCTGG); reverse primer (R446-BG2-AP, GATCGGATCCTTAAGATCTGCCCCAGAGCGGCTTTCATGG). For GPI-PLC mutagenesis, the template was pDH4 ( 8 ), the 5' primer was KCR10 (TAAGGATCCTTAACACAGGAGG G TTTTTACCATGTTTGGTGGT) and the reverse primer was KCR5 (TATGTGGATCCTTATGACCTTGCGGTTTGGTT). All PCR primers contained a Bam HI site for subcloning purposes. PCR products were digested with Bam HI and cloned into pBluescriptII (SK) (+) (Stratagene) under transcriptional regulation of the phage T7 promoter therein. A GPI-PLC plasmid (pKMW2) ( 9 ) containing the RBS (AGGAGG) and spacer (CAGCTA) from the LacZ gene of E.coli was used as control for the in vitro translation experiments. All other sequences in the primers were identical to those used in the construction of the Ner RBS-spacer clone. Identical amounts of plasmids purified by anion exchange chromatography (Qiagen tip-20, Qiagen) were transcribed with purified T7 RNA polymerase and translated in the same reaction mixture using rabbit reticulocyte lysate (TNT T7 coupled transcription/translation reticulocyte lysate system, Promega) containing [ 35 S]methionine as directed by the manufacturer. Translation products were resolved by SDS-PAGE and detected by fluorography. To assess the efficiency of translation of the GPI-PLC containing the Ner RBS-spacer CC , the quantity of product was compared with that produced from a GPI-PLC cDNA clone with the authentic eukaryotic 5' UTR [pDH4 ( 8 )]. Because the cDNA was cloned downstream of the T7 promoter in pBluescript (Stratagene), identical reagents used for analysis of the constructs with the E.coli 5' UTRs could be used for the experiments involving expression of the cDNA. The nine bases preceding the initiator ATG in this cDNA are ATCATTGTA.

Transcripts from GPI-PLC constructs which contained the RBS-hybrid-spacer ACC from Ner were robustly translated by the rabbit reticulocyte lysates (Fig. 1 B, lanes 1 and 2, representing two clones of this construct), producing a full-length 39 kDa product. Indeed, translation from the Ner RBS-hybrid-spacer ACC construct was just as prolific as that obtained with the authentic 5' UTR of the trypanosome gene (Fig. 1 B, compare lane 3 with lanes 1 and 2). More importantly, translation initiated from the correct AUG codon, since a 39 kDa GPI-PLC was produced; a protein of identical size is generated when a cDNA of GPI-PLC is transcribed with the identical RNA polymerase and translated in the reticulocyte lysate (Fig. 1 B, compare lanes 1 and 2 with lane 3). To test the possibility that downstream (coding sequences) might be influencing the translation of GPI-PLC mRNA from the Ner RBS-hybrid-spacer ACC plasmids, the coding sequence of E.coli alkaline phosphatase [Delta]2-22 which has no protein sequence similarity with GPI-PLC was placed downstream of Ner RBS-hybrid-spacer ACC . This alkaline phosphatase construct was translated very efficiently to produce the expected 47 kDa protein (Fig. 1 B, lanes 5 and 6; two representative clones), indicating that the Ner RBS-hybrid-spacer ACC was solely responsible for the efficient translation of coding sequences positioned 3' to it.


Figure 1 . (A ) Sequences of 5' UTRs used in this study. The initiation (atg) codon is indicated. ( B) A microgram of purified plasmid was transcribed/translated in a TNT rabbit reticulocyte lysate (Promega) and analyzed by SDS-PAGE (10% minigel)/fluorography as described in the text. Dried gels were exposed to Hyperfilm TM (Amersham) for 1 h at -70oC.

On the contrary, transcripts from GPI-PLC clones which had a LacZ RBS-spacer were inefficiently translated by the rabbit reticulocyte lysate, in comparison with the extent of translation obtained with the Ner RBS-hybrid-spacer ACC (Fig. 1 B, compare lane 4 with lanes 1 and 2). The full-length GPI-PLC product was not detectable, and what little translation occurred appeared to have initiated predominantly from an internal AUG, generating a truncated 34 kDa protein (marked with asterisk in Fig. 1 B). Incidentally, the GPI-PLC gene bearing the RBS-spacer of LacZ had previously been used to express full-length enzymatically active GPI-PLC in E.coli BL21(DE3) from the T7 promoter ( 9 ). Hence the gene and the translational control elements in this construct are functional in E.coli, but not in a rabbit reticulocyte lysate.

Together, these data demonstrate that the Ner RBS-hybrid-spacer ACC is recognized efficiently by rabbit reticulocyte ribosomes. Thus, this RBS-spacer combination functions across species and may be used for efficient expression of genes in both prokaryotic and vertebrate systems. The availability of a bifunctional 5' UTR circumvents the usual requirement for separate translational control elements when one wishes to a express a protein both in E.coli and in a mammalian system. For this reason this Ner RBS-spacer is likely to find general use in the protein expression field.

It is remarkable that the Ner RBS-hybrid-spacer ACC which promotes efficient expression of proteins in E.coli ( 4 , 5 ) also directs robust translation by ribosomes from a mammal. One cannot rule out the possibility that the effectiveness of this Ner RBS-spacer ACC across species is conferred by different sequences within this 5' UTR. However, we note that Ner RBS-hybrid-spacer ACC contains the sequence ACC at the -1 to -3 positions (i.e . , relative to the initiator AUG) (Fig. 1 A) which, especially the purine at the -3 position, stimulates vertebrate protein synthesis ( 10 ). Similarly, the GPI-PLC cDNA, which was also translated very well, contains a purine at the -3 position. In contrast, the LacZ RBS-spacer which was essentially nonfunctional in the rabbit reticulocyte lysate has a pyrimidine at the -3 position.

ACKNOWLEDGEMENTS

This work was supported by National Institutes of Health grant AI-33383 and by a Burroughs Wellcome Fund New Investigator Award in Molecular Parasitology to K.M.-W. A.A.-Q. is supported by the government of Saudi Arabia. We thank Professor J. Beckwith (Harvard University) for pAD135.

REFERENCES

1 Kozak,M. (1994) Biochimie, 76, 815-821. MEDLINE Abstract

2 Chen,H., Bjerknes,M., Kumar,R. and Jay,E. (1994) Nucleic Acids Res., 22, 4953-4957. MEDLINE Abstract

3 Kozak,M. (1994) J. Mol. Biol., 235, 95-110. MEDLINE Abstract

4 Buell,G., Schulz,M-F., Selzer,G., Chollet,A., Movva,N.R., Semon,D., Escanez,S. and Kawashima,E. (1985) Nucleic Acids Res, 13, 1923-1938. MEDLINE Abstract

5 Gray,G., Selzer,G., Buell,G., Shaw,P., Escanez,S., Hofer,S., Voegeli,P. and Thompson,C.J. (1984) Gene, 32, 21-30. MEDLINE Abstract

6 Innis,M.A., Myambo,K.B., Gelfand,D.H. and Brow,M.D. (1988) Proc. Natl Acad. Sci. USA, 85, 9436-9440. MEDLINE Abstract

7 Derman,A.I., Puziss,J.W., Bassford,P.J. and Beckwith,J. (1993) EMBO J., 12, 879-888. MEDLINE Abstract

8 Hereld,D., Hart,G.W. and Englund,P.T. (1988) Proc. Natl Acad. Sci. USA, 85, 8914-8918. MEDLINE Abstract

9 Mensa-Wilmot,K., Morris,J.C., Al-Qahtani,A. and Englund,P.T. (1995) Methods Enzymol., 250, 641-655.

10 Kozak,M. (1987) J. Mol. Biol., 196, 947-950. MEDLINE Abstract


Return

* To whom correspondence should be addressed
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
Z. Zheng, K. D. Butler, R. K. Tweten, and K. Mensa-Wilmot
Endosomes, Glycosomes, and Glycosylphosphatidylinositol Catabolism in Leishmania major
J. Biol. Chem., October 1, 2004; 279(40): 42106 - 42113.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Extract Freely available
Right arrow Print PDF (38K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (7)
Right arrowRequest Permissions
Right arrowScopus Links
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Al-Qahtani, A
Right arrow Articles by Mensa-Wilmot, K
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Al-Qahtani, A
Right arrow Articles by Mensa-Wilmot, K
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?