Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (92K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (39)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Xu, Q
Right arrow Articles by Barany, G
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xu, Q
Right arrow Articles by Barany, G
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 1996 Oxford University Press 1602-1607

Footnote

Use of 1,2,4-dithiazolidine-3,5-dione (DtsNH) and 3-ethoxy-1,2,4-dithiazoline-5-one (EDITH) for synthesis of phosphorothioate-containing oligodeoxyribonucleotides

Use of 1,2,4-dithiazolidine-3,5-dione (DtsNH) and 3-ethoxy-1,2,4-dithiazoline-5-one (EDITH) for synthesis of phosphorothioate-containing oligodeoxyribonucleotides Qinghong Xu , Karin Musier-Forsyth , Robert P. Hammer 1 and George Barany*

Department of Chemistry, University of Minnesota, 207 Pleasant Street S.E., Minneapolis , MN 55455-0431, USA and 1 Department of Chemistry, Louisiana State University, 232 Choppin Hall, Baton Rouge , LA 70803-1804, USA

Received February 13, 1996; Accepted March 18, 1996

ABSTRACT

Previous methods for the preparation of phosphorothioate-containing oligodeoxyribonucleotides rely on the reaction of phosphite triesters with sulfurizing reagents such as tetraethylthiuram disulfide (TETD) and 3 H -1,2-benzodithiol-3-one 1,1-dioxide (Beaucage reagent). However, these and other sulfurizing reagents suffer from several disadvantages, and there is great impetus for the development of improved methods for sulfur transfer that are fully compatible with standard automated DNA synthesis. The present report describes the use of 1,2,4-dithiazolidine-3,5-dione (DtsNH) and 3-ethoxy-1,2,4-dithiazoline-5-one (EDITH) as effective sulfurizing reagents that meet these needs. Both reagents are easily prepared, and are stable upon prolonged room temperature storage in acetonitrile solution. The reagents are used at low concentrations (0.05 M) and for short reaction times (30 s). The methodology has been proven for the automated synthesis on 0.2-1.0 [mu]mol scales of oligodeoxyribonucleotides, of length 6-20 bases, containing the phosphorothioate substitution at either a single site or at all positions.

INTRODUCTION

Phosphorothioate analogues of the phosphate moiety are of considerable interest in nucleic acid research ( 1 - 3 ). For example, phosphorothioate-containing antisense oligonucleotides have been used in vitro and in vivo as inhibitors of gene expression ( 4 - 7 ). Site-specific attachment of reporter groups onto the DNA or RNA backbone is facilitated by the incorporation of single phosphorothioate moieties ( 8 , 9 ). Phosphorothioates have also been introduced into oligonucleotides for mechanistic studies on DNA-protein ( 10 ) and RNA-protein ( 11 ) interactions, as well as catalytic RNAs ( 12 ).

Introduction of phosphorothioate moieties into oligonucleotides, assembled by solid-phase synthesis, can be achieved readily in two ways. The H-phosphonate approach involves a single sulfur transfer step, carried out after the desired sequence has been assembled, to convert all of the internucleotide linkages to phosphorothioates ( 13 - 15 ). Alternatively, the phosphoramidite approach features a choice at each synthetic cycle: a standard oxidation provides the normal phosphodiester internucleotide linkage, whereas a sulfurization step introduces a phosphorothioate at that specific position in the sequence ( 16 , 17 ). An advantage of using phosphoramidite chemistry, therefore, is the capability to control the state of each linkage [P=O versus P=S] in a site-specific manner. The earliest studies to create phosphorothioates used elemental sulfur ( 17 ), but the success of the phosphoramidite approach is dependent on the availability and application of more efficient, more soluble sulfur transfer reagents that are compatible with automated DNA synthesis.

With these goals in mind, a number of reagents have been designed and tested in recent years. These include 3 H -1,2-benzodithiol-3-one 1,1-dioxide (Beaucage reagent; 18 ), tetraethylthiuram disulfide (TETD; 19 ), phenylacetyl disulfide ( 20 ), dibenzoyl tetrasulfide ( 21 ), bis( O , O -diisopropoxy phosphinothioyl) disulfide (S-Tetra; 22 ), benzyltriethylammonium tetrathiomolybdate (BTTM; 23 ) and bis(4-methoxybenzenesulfonyl) disulfide and related aryl derivatives ( 24 ). Of the listed compounds, the Beaucage reagent has been used widely due to its commercial availability and favorable kinetics and effectiveness. However, the synthetic accessibility, solubility properties and stability of the Beaucage reagent are not optimal, and its suitability for large-scale oligonucleotide preparation has been questioned ( 22 , 24 ). This paper describes 1,2,4-dithiazolidine-3,5-dione (DtsNH) and 3-ethoxy-1,2,4-dithiazoline-5-one (EDITH), both known compounds [ 25 - 28 ; see Scheme 1 for structures and method of preparation], in a novel application to create phosphorothioates. These new reagents appear to have an optimal combination of properties that suggest they will be advantageous alternatives to existing sulfurizing reagents.


Scheme 1 Preparation of EDITH and DtsNH.


MATERIALS AND METHODS

General

TETD was from Applied Biosystems (Foster City, CA), and the Beaucage reagent was from Glen Research (Sterling, VA). EDITH, m.p. 49-51oC, and DtsNH, m.p. 141-142oC, were both white needles prepared by procedures that are described in detail elsewhere ( 28 ); direct reaction of O -ethylthiocarbamate and (chlorocarbonyl)sulfenyl chloride gives EDITH in 63% yield, and treatment of EDITH with concentrated aqueous hydrochloric acid gives DtsNH in overall 47% yield for two steps. Before use, acetonitrile solutions of DtsNH, EDITH, TETD or the Beaucage reagent were placed over activated 4 Å molecular sieves for 12 h. Eluents for chromatography were prepared using deionized water, solvents and salts of the highest available grade. Reversed-phase high performance liquid chromatography (RP-HPLC) analyses of fully deprotected, crude synthetic oligodeoxyribonucleotides containing single phosphorothioate linkages were performed using a Vydac analytical C 18 reversed-phase column (218TP54; 5 [mu]m, 300 Å; 0.46 * 25 cm; 29 ) on a Beckman system monitored at 260 nm. Separation of crude oligodeoxyribonucleotides that were fully sulfurized was achieved by ion-exchange HPLC using a Dionex NucleoPac PA-100 column (0.4 * 25 cm; 30 - 32 ). A PE-Sciex API III triple quadrupole mass spectrometer was used for electrospray mass spectrometry (ESMS; 33 , 34 ) to analyze oligonucleotides either directly after synthesis, or after HPLC fractionation. 31 P Nuclear magnetic resonance (NMR) spectroscopy was used to analyze further phosphorothioate-containing oligodeoxyribonucleotides: fully deprotected material from 1.0 [mu]mol scale syntheses was dissolved in 0.6 ml of H 2 O, and spectra were recorded on a Varian VXR 300 MHz NMR spectrometer operating at 121.4 MHz, and referenced to external 85% phosphoric acid. 13 C NMR spectra were recorded on the same Varian instrument operating at 75 MHz.


Scheme 2 Proposed mechanisms of sulfurization of oligodeoxyribonucleotides, as promoted by DtsNH (top) and EDITH (bottom).


Solid-phase synthesis of phosphorothioate-containing oligodeoxyribonucleotides

A Pharmacia Gene Assembler Special DNA Synthesizer was operated on either a 0.2 or 1.0 [mu]mol scale, starting with controlled pore-glass (500 Å) supports loaded with the 3'-end deoxyA residue attached to the supports via a long chain alkylamino linker (dA-lcaa-CPG), and using [beta]-cyanoethyl deoxyribonucleoside phosphoramidites and other standard solvents and reagents, all from Glen Research. Conditions used for sulfurization are described in the Tables. The typical sulfurizing reagent volume used per cycle was 1.25 ml, regardless of the synthesis scale chosen. However, identical results were achieved with 0.5 ml. The sulfurizing reagent was recycled through the column at a flow rate of 2.5 ml/min during the reaction times indicated in the Tables. The capping step in the synthesis cycle was performed after the sulfurization reaction, in order to avoid premature oxidation of the phosphite linkage ( 18 ). The remaining steps in the synthesis cycle were performed according to standard methods (Pharmacia). Upon completion of solid-phase steps, the oligodeoxyribonucleotides were released from the support and deblocked with 30% ammonium hydroxide (15 h, 55oC), desalted on C 18 Sep-Pak cartridges (Millipore), lyophilized, and analyzed by reversed-phase and/or ion-exchange HPLC, polyacrylamide gel electrophoresis, ESMS and 31 P NMR.

RESULTS AND DISCUSSION

Sulfurizations by DtsNH or EDITH

DtsNH (structure in Scheme 1 ) is the simplest member (i.e., no substituent on nitrogen) of a family of disulfide-containing five-membered heterocycles ( 25 , 27 ) that have been adapted for amino group protection ( 27 , 35 - 40 ). Dts is an acronym for dithiasuccinoyl, which emphasizes how the heterocycle is viewed as an amine masked with two molecules of carbonyl sulfide (COS). The parent amine is released when the heterocyclic disulfide is reduced by a variety of agents including thiols and borohydrides ( 27 , 35 - 40 ). Dts-amines can also be viewed as masked isocyanates, a dissection that gives rise to one molecule of COS as well as monomeric `sulfur' ( 27 , 35 - 40 ). A likely driving force for the various reactions of Dts-amines is the relief of strain in the five-membered heterocycle, as well as relief from the unfavorable repulsion of unshared electron pairs of adjacent sulfurs ( 37 , 38 , 38 ).

The reaction of Dts-amines with simple trialkyl- and triarylphosphines is of particular interest: in the presence of water, the disulfide is reduced, the amine forms, and the co-product is the corresponding phosphine oxide ( 36 ), whereas under anhydrous conditions, the isocyanate forms with the phosphine sulfide as co-product ( 39 - 41 ). The present work shows how the latter chemistry can be `inverted', and used to sulfurize the trivalent phosphorus [P(III)] intermediates that arise in the phosphoramidite method of oligonucleotide synthesis (Scheme 2 , top). One point of focus of the current work is on DtsNH; other Dts derivatives were also examined and the results of those studies will be reported elsewhere. As a second point of focus, we have examined another disulfide-containing five-membered heterocycle, EDITH, which is the synthetic precursor to DtsNH (Scheme 1) and is similarly a planar molecule with the disulfide constrained to the least favorable dihedral angle, i.e., 0oC ( 28 ). EDITH also reacts with the trivalent phosphorus intermediates to effect sulfurization, providing COS and O -ethyl cyanate as co-products (Scheme 2, bottom). Finally, studies were carried out comparing DtsNH and EDITH with two commercially available reagents, TETD and the Beaucage reagent.

Synthesis of a model oligodeoxyribonucleotide hexamer containing a single internal phosphorothioate linkage


Figure 1 . Reversed-phase HPLC of the oligodeoxyribonucleotide hexamer 5'-d(TTT s TTA)-3' synthesized on a 0.2 [mu]mol scale, with the single phosphorothioate linkage established by 30 s reaction with 0.05 M DtsNH in CH 3 CN. Chromatograms were developed at 1.2 ml/min with 0.1 M aqueous triethyl- ammonium acetate (TEAA) pH 7.0 buffer: a gradient starting from 92% buffer and 8% CH 3 CN was increased over 20 min by 0.4% CH 3 CN/min. Peak 2 is the R P diastereomer (t R = 16.4 min), and peak 3 is the S P diastereomer (t R = 17.6 min); these assignments are based on precedents reported by Stec et al. (16) and Wyrzykiewicz and Cole (29). See also Table 1.DtsNH and EDITH are effective sulfurizing reagents that at low concentrations and over short reaction times can transfer sulfur to a phosphorus (III) center. The product phosphorothioates are formed as a mixture of two stereoisomers (e.g., Fig. 1 , see peaks 2 and 3). In addition, there is the possibility of forming an undesired by-product containing a phosphodiester linkage-due to incomplete sulfurization and/or some side reaction related to the reagent used (e.g., Fig. 1 , see peak 1). Sulfurization yields for the singly-sulfurized species were determined by elution of crude oligomers on RP-HPLC. Excellent yields (>98%) of the desired phosphorothioate triesters were observed when 0.05 M DtsNH (Fig. 1 ; Table 1 , lines 1 and 2) or 0.05 M EDITH (Table 1 , line 5) were applied for 30-60 s. The Beaucage reagent was also effective under the same conditions (Table 1 , lines 6 and 7). However, at the lower concentration of 0.01 M, 5 min reaction times were needed for both the DtsNH and Beaucage reagents to achieve the same sulfurization yields (Table 1 , lines 3 and 8 versus lines 4 and 9). In contrast, the maximum sulfurization achievable by TETD (~96%) required 0.5 M concentration and a 15 min reaction time (Table 1 , line 10).


Figure 2 . 31 P NMR of the oligodeoxyribonucleotide hexamer 5'-d(T s T s- T s T s T s A)-3' synthesized on a 1.0 [mu]mol scale, with the five phosphorothioates established by 30 s reactions with 0.05 M DtsNH in CH 3 CN at each cycle of chain elongation. A single peak was observed at [delta] 55.9 p.p.m. If present, a phosphodiester resonance is expected at [delta] ~0 p.p.m., based on other studies (16).


Figure 3 . ( A ) 31 P NMR [single peak at [delta] 57 p.p.m.] of the oligodeoxyribonucleotide S-d(T 19 A) synthesized on a 1.0 [mu]mol scale, with multiple phosphorothioate linkages established by 30 s reactions with 0.05 M EDITH in CH 3 CN. ( B ) Polyacrylamide gel (16%) showing crude product oligodeoxyribonucleotide 20mers, synthesized on a 1.0 [mu]mol scale, and viewed by UV-shadowing (254 nm). Lanes 1 and 2: S-d(CCTCTTCGCTATTACGCCAA) synthesized on a 1.0 [mu]mol scale using EDITH at 0.05 M and 30 s reaction time (lane 1) and the Beaucage reagent at 0.05 M and 30 s reaction time (lane 2); lanes 3-5: S-d(T 19 A) synthesized on a 1.0 [mu]mol scale using EDITH at 0.05 M and 30 s reaction time (lane 3), DtsNH at 0.2 M, 5 min reaction time (lane 4), and the Beaucage reagent at 0.05 M and 30 s reaction time (lane 5); lane 6: d-(T 19 A) made by standard techniques in a parallel synthesis [iodine oxidations after all coupling cycles; sulfurizations not carried out]. B A

Syntheses of model oligodeoxyribonucleotide hexamers containing multiple phosphorothioate linkages

Oligodeoxyribonucleotide hexamers (two different sequences) were prepared containing a phosphorothioate diester at every position. This was achieved by carrying out the sulfurization reactions after each of the coupling cycles during automated chain assembly (Table 2 ). 31 P NMR analysis revealed that, within the resolution of the technique, all three reagents-DtsNH, EDITH and the Beaucage reagent-are effective for sulfurization. When the concentration of sulfurizing reagent was 0.05 M, no phosphodiester linkage could be detected by 31 P NMR (e.g., Fig. 2 ).

Syntheses of model oligodeoxyribonucleotide 20mers containing multiple phosphorothioate linkages

The suitability of these reagents for the automated solid-phase synthesis of longer phosphorothioate-containing oligodeoxyribonucleotide analogues was evaluated next. Two sets of oligodeoxyribonucleotide 20mers containing a phosphorothioate diester at every position were prepared. 31 P NMR analysis of S-d(T 19 A) prepared using 0.05 M of the Beaucage reagent or EDITH (e.g., Fig. 3 A) and 30 s reaction times indicated that on average >99% sulfur transfer efficiency was achieved at each step. A comparison of the crude products obtained with these two reagents was carried out using polyacrylamide gel electrophoresis (Fig. 3 B, lanes 3 and 5). Comparable ratios of full-length to truncated product oligomers were obtained. DtsNH, on the other hand was not as effective for sulfurization of these longer sequences. However, at higher concentrations of reagent (0.2 M) and longer reaction times (5 min), >99% sulfur transfer efficiency was achieved as revealed by 31 P NMR analysis (data not shown). Gel analyses showed that the percentage of full-length product oligomers obtained when DtsNH was used, was similar to that from syntheses carried out with EDITH or the Beaucage reagent (Fig. 3 B, lane 4).

One can readily calculate that for the synthesis of a 20mer, even if only 1% of phosphite precursors were oxygenated instead of sulfurized, 16.5% of the products would be expected to contain one phosphodiester linkage ( 32 ). To determine the percentage of crude product that was not the desired fully-sulfurized oligomer, we adapted a literature procedure whereby strong anion-exchange HPLC separates fully sulfurized phosphorothioate oligonucleotides from incompletely sulfurized species ( 30 - 32 ). Crude product oligomers of S-d(T 19 A), sulfurized with EDITH and the Beaucage reagent, were chromatographed by this technique (Fig. 4 ). The major peaks correspond to the fully sulfurized product, and the small shoulder peaks were confirmed to be the singly-oxidized species by co-injection of the analogous 20mer prepared with a single phosphodiester linkage (data not shown). Thus, the product distribution observed by anion-exchange chromatography shows that the sulfur transfer efficiency is indeed >99% at each step, and confirms the NMR results.

Table 1 . Sulfur-transfer efficiency of various reagents for synthesis of the hexamer 5'-d(TTT s TTA)-3'
Sulfurizing

Concentration

Reaction

Distribution (%)

reagent

in CH 3 CN (M)

time (min)

P=O

P=S( R )

P=S( S )

DtsNH

0.05

1.0

<2

56

42

DtsNH

0.05

0.5

<2

56

42

DtsNH

0.01

5.0

<2

56

42

DtsNH

0.01

1.0

7

53

40

EDITH

0.05

0.5

<2

56

42

Beaucage

0.05

1.0

<2

56

42

Beaucage

0.05

0.5

<2

55

44

Beaucage

0.01

5.0

<2

55

42

Beaucage

0.01

1.0

19

44

36

TETD

0.50

15.0

4

52

44

Hexamers were synthesized on a 0.2 [mu]mol scale, and relative amounts reported were determined by HPLC analysis (e.g., Fig. 1 ). Peaks 1, 2 and 3 were assigned as follows, based on isolation followed by ESMS: 1: 5'-d(TTTTTA)-3', t R : 15.4 min, m/z: 1772.4 2: 5'-d(TTT s(R) TTA)-3', t R : 16.4 min, m/z: 1788.8 3: 5'-d(TTT s(S) TTA)-3', t R : 17.6 min, m/z: 1788.3

Table 2 . Sulfur-transfer efficiency of various reagents for syntheses of oligodeoxyribonucleotide hexamers
Sulfurizing

Sequence a

Concentration

Reaction

Distribution (%)

reagent

in CH 3 CN (M)

time (min)

P=S

P=O

DtsNH

i

0.05

0.5

~100

N.D.

DtsNH

i

0.01

5.0

97

3

EDITH

i

0.05

0.5

~100

N.D.

Beaucage

i

0.05

0.5

~100

N.D.

Beaucage

i

0.01

5.0

97

3

DtsNH

ii

0.05

0.5

~100

N.D.

EDITH

ii

0.05

0.5

~100

N.D.

Beaucage

ii

0.05

0.5

~100

N.D.

a (i) 5'-d(T s T s T s T s T s A)-3'; (ii) 5'-d(G s A s C s G s T s A)-3'. Hexamers were synthesized on a 1.0 [mu]mol scale, and relative amounts of P=S ([delta] 56 p.p.m.) and P=O ([delta] ~0 p.p.m.) were determined by integration of the 31 P NMR spectra (e.g., Fig. 2).

A mixed 20mer oligodeoxyribonucleotide S-d(CCTCTTCGCTATTACGCCAA) was also synthesized, using both EDITH and the Beaucage reagent at 0.05 M and 30 s reaction times. 31 P NMR again revealed that ~98-99% sulfur transfer efficiency was achieved at each step. Anion-exchange chromatography of the crude product oligomers showed that the major species was the full-length, fully sulfurized desired product (Fig. 5 ). The relative heights of peak IIs suggests that both reagents are somewhat less effective at sulfurizing the mixed sequence 20mers than was the case for the preparations of S-d(T 19 A) (Fig. 4 ). For a 20mer, a 2% yield of oxygenated product at each step would result in 59% fully-sulfurized product ( 32 ). The anion-exchange results are therefore consistent with the stepwise sulfur transfer efficiency estimated by NMR. Gel analysis of the mixed sequences was also carried out (Fig. 3 , lanes 1 and 2), and the results confirm that comparable yields of full-length and truncated products were obtained with EDITH and the Beaucage reagent.


Figure 4 . Anion-exchange HPLC at 55oC of oligodeoxyribonucleotide S-d(T 19 A) synthesized on a 1.0 [mu]mol scale, with multiple phosphorothioate linkages established by 30 s reactions with 0.05 M sulfurizing reagent in CH 3 CN. Elution was at 1.2 ml/min by a gradient starting from 100% buffer A = 20 mM Tris-HCl, pH 8.0-CH 3 CN (10:1) increased over 20 min by 2%/min of buffer B = 0.8 M NaClO 4 -CH 3 CN (10:1) (30). ( A ) Sulfurizations performed by EDITH; ( B ) sulfurizations performed by the Beaucage reagent.

Stabilities of DtsNH and EDITH

To determine the stabilities and solubilities of DtsNH and EDITH upon prolonged storage in solution, 0.2 and 0.05 M solutions were prepared in CH 3 CN and stored at 25oC over 4 Å molecular sieves. During a 2 week period, these solutions were tested periodically by RP-HPLC analysis (C 18 column developed at 1.2 ml/min with 0.1% aqueous TFA-CH 3 CN from 19:1 to 3:2 over 12 min, monitored at 254 nm). At both concentrations tested, the only peaks observed were those of the compounds under evaluation, and the peak areas remained entirely unchanged. In addition, 13 C NMR and 1 H NMR spectra in CD 3 CN were recorded after 1 month and compared with those of freshly prepared solutions: no new peaks appeared. Moreover, the solutions remained clear and colorless over 2 weeks. The solubility of the Beaucage reagent as a 0.05 M solution in CH 3 CN was evaluated similarly; already after 2 days, a significant precipitate occurred even when silanized bottles were used according to the manufacturer's recommendations.


Figure 5 . Both anion-exchange HPLC (conditions of Fig. 4) and 31 P NMR (insets) of the oligodeoxyribonucleotide S-d(CCTCTTCGCTATTACGCCAA) synthesized on a 1.0 [mu]mol scale, with multiple phosphorothioate linkages established by 30 s reactions with 0.05 M sulfurizing reagent in CH 3 CN. ( A ) Sulfurizations performed by EDITH; ( B ) sulfurizations performed by the Beaucage reagent.

We compared the sulfurization efficiency of freshly prepared EDITH and DtsNH (0.05 M solution and 0.5 min reaction time) with that of 2- and 1-month old solutions respectively, in the synthesis of 5'-d(TTT s TTA)-3'. RP-HPLC analysis of crude product oligomers indicated that in all cases >98% sulfur transfer efficiency was achieved. It is also worth comparing the favorable properties of DtsNH and EDITH found here with those described for S-Tetra ( 22 ). The latter reagent was reported to give inferior oligonucleotide synthesis results with solutions stored >1 week ( 22 ).

SUMMARY AND CONCLUSIONS

This paper reports new sulfurizing agents, DtsNH and EDITH, that are highly effective for the establishment of phosphorothioate linkages in oligodeoxyribonucleotides. The reagents are relatively easy and inexpensive to prepare, and are stable in solution. Furthermore, sulfurizations promoted by DtsNH and EDITH occur at low concentrations and with short reaction times. This array of positive attributes augur well for the significance of the DtsNH and EDITH reagents in nucleic acid research.

ACKNOWLEDGEMENTS

A portion of these results (preliminary studies with DtsNH) were reported in preliminary form at the Fourteenth American Peptide Symposium, June 18-23, 1995, Columbus, Ohio.

We thank Dr James G. Coull (PerSeptive BioSystems) and anonymous referees for constructive suggestions of additional experiments that have been carried out and reported in the revised version of this paper. DtsNH and EDITH that were used in some of these studies were prepared over a 20-year period by the following students and technicians: Lin Chen, Steven J. Eastep, David A. Halsrud and Lydia Ong, in addition to two of the authors (G.B. and R.P.H.). Finally, we are grateful to NIH grants GM 28934, 42722 and 43552 to G.B.; GM 49928 to K.M.F.; and grants LEQSF(RF/19931996)-RD-A-42 and NSF CHE-9500992 to R.P.H. for support of this research.

REFERENCES

1 Eckstein, F. and Gish, G. (1989) TIBS, 14, 97-100.

2 Zon, G. and Stec, W.J. (1991) In Eckstein, F. (ed.), Oligonucleotides and Analogues: A Practical Approach. IRL Press, Oxford, pp. 87-108.

3 Iversen, P. (1991) Anti-Cancer Drug Des., 6, 539-568.

4 Uhlmann, E. and Peyman, A. (1990) Chem. Rev., 90, 544-583.

5 Gao, W.-Y., Han, F.-S., Storm, C., Egan, W. and Cheng, Y.-C. (1992) Mol. Pharmacol., 41, 223-229. MEDLINE Abstract

6 Wagner, R.W. (1994) Nature, 372, 333-335. MEDLINE Abstract

7 Bongartz, J.-P., Aubertin, A.-M., Milhaud, P.G. and Lebleu, B. (1994) Nucleic Acids Res., 22, 4681-4688. MEDLINE Abstract

8 Fidanza, J.A., Ozaki, H. and McLaughlin, L.W. (1992) J. Am. Chem. Soc., 114, 5509-5517.

9 Musier-Forsyth, K. and Schimmel, P. (1994) Biochemistry, 33, 773-779.

10 Koziolkiewicz, M. and Stec, W.J. (1992) Biochemistry, 31, 9460-9466. MEDLINE Abstract

11 Milligan, J.F. and Uhlenbeck, O.C. (1989) Biochemisty, 28, 2849-2855.

12 Moore, M.J. and Sharp, P.A. (1993) Nature, 365, 364-368. MEDLINE Abstract

13 Garegg, P.J., Regberg, T., Stawinski, J. and Strömberg, R. (1985) Chemica Scripta, 25, 280-282.

14 Froehler, B.C. (1986) Tetrahedron Lett., 27, 5575-5578.

15 Agrawal, S. and Tang, J.-Y. (1990) Tetrahedron Lett., 31, 7541-7544.

16 Stec, W.J., Zon, G., Egan, W. and Stec, B. (1984) J. Am. Chem. Soc., 106, 6077-6079.

17 Connolly, B.A., Potter, B.V.L., Eckstein, F., Pingoud, A. and Grotjahn, L. (1984) Biochemistry, 23, 3443-3453. MEDLINE Abstract

18 Iyer, R.P., Phillips, L.R., Egan, W., Regan, J.B. and Beaucage, S.L. (1990) J. Org. Chem., 55, 4693-4699.

19 Vu, H. and Hirschbein, B.L. (1991) Tetrahedron Lett., 32, 3005-3008.

20 Roelen, H.C.P.F., Kamer, P.C.J., van den Elst, H., van der Marel, G.A. and van Boom, J.H. (1991) Recl. Trav. Chim. Pays-Bas., 110, 325-331.

21 Rao, M.V., Reese, C.B. and Zhengyun, Z. (1992) Tetrahedron Lett., 33, 4839-4842.

22 Stec, W.J., Uznanski, B., Wilk, A., Hirschbein, B.L., Fearon, K.L. and Bergot, B.J. (1993) Tetrahedron Lett., 34, 5317-5320.

23 Rao, M.V. and Macfarlane, K. (1994) Tetrahedron Lett., 35, 6741-6744.

24 Efimov, V. A., Kalinkina, A. L., Chakhmakhcheva, O. G., Hill, T. S. and Jayaraman, K. (1995) Nucleic Acids Res., 23, 4029-4033. MEDLINE Abstract

25 Zumach, G. and Kühle, E. (1970) Angew Chem. Int. Ed. Engl., 9, 54-63.

26 Dahms, G., Haas, A. and Klug, W. (1971) Chem. Ber., 104, 2732-2742.

27 Barany, G. Ph.D. thesis (1977) The Rockefeller University, Dissertation Abstr., 38, 5893-B.

28 Chen, L., Thompson, T.R., Hammer, R.P. and Barany, G. (1996) submitted.

29 Wyrzykiewicz, T. K. and Cole, D. L. (1995) Bioorg. Chem., 23, 33-41.

30 Ausserer, W. A. and Biros, M. L. (1995) BioTechniques, 19, 136-139. MEDLINE Abstract

31 Sproat, B., Colonna, F., Mullah, B., Tsou, D., Andrus, A., Hampel, A. and Vinayak, R. (1995) Nucleoside Nucleotides, 14, 255-273.

32 Bergot, B. J. (Mar. 7, 1995) U. S. Patent, 5, 395,928.

33 Little, D. P., Chorush, R. A., Speir, J. P., Senko, M. W., Kelleher, N. L. and McLafferty, F. W. (1994) J. Am. Chem. Soc., 116, 4893-4897.

34 Potier, N., Van Dorsselaer, A., Cordier, Y., Roch, O. and Bischoff, R. (1994) Nucleic Acids Res., 22, 3895-3903. MEDLINE Abstract

35 Barany, G. and Merrifield, R.B. (1977) J. Am. Chem. Soc., 99, 7363-7365. MEDLINE Abstract

36 Barany, G. and Merrifield, R.B. (1979) Anal. Biochem., 95, 160-170. MEDLINE Abstract

37 Barany, G. and Merrifield, R.B. (1980) J. Am. Chem. Soc., 102, 3084-3095.

39 Barany, G. (1982) Crystal Structure Commun., 11, 913-928.

40 Barany, G., Albericio, F., Chang, J.L., Ferrer, M., Hammer, R.P., Kneib-Cordonier, N., Ottinger, E.A. and Solé, N.A. (1992) ORGN 184. American Chemical Society, 203rd National Meeting, San Francisco, California, April 5-10, 1992.

41 Hammer, R.P. and Barany, G. (1987) American Chemical Society, 21st Great Lakes Regional Meeting, Chicago, Illinois, June 10-12, 1987.

Return

* To whom correspondence should be addressed
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Nucleic Acids ResHome page
S. An, G. Barany, and K. Musier-Forsyth
Evolution of acceptor stem tRNA recognition by class II prolyl-tRNA synthetase
Nucleic Acids Res., May 1, 2008; 36(8): 2514 - 2521.
[Abstract] [Full Text] [PDF]

Home page
 J. Gen. Virol.Home page
S. M. Fennewald, E. P. Scott, L. Zhang, X. Yang, J. F. Aronson, D. G. Gorenstein, B. A. Luxon, R. E. Shope, D. W. C. Beasley, A. D. T. Barrett, et al.
Thioaptamer decoy targeting of AP-1 proteins influences cytokine expression and the outcome of arenavirus infections
J. Gen. Virol., March 1, 2007; 88(3): 981 - 990.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (92K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (39)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Xu, Q
Right arrow Articles by Barany, G
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xu, Q
Right arrow Articles by Barany, G
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?