ABSTRACT
A general approach for isolating large nested deletions in P1 artificial chromosomes (PACs) and bacterial artificial chromosomes (BACs) by retrofitting with a loxP site-containing Tn10 mini-transposon is described. Cre-mediated recombination between the loxP site existing in these clones and one introduced by transposition leads to deletions and inversions of the DNA between these sites. Large deletions are selectively recovered by transducing the retrofitted PAC or BAC clones with P1 phage. The requirement that both loxP sites in the cointegrate be packaged into a P1 head ensures that only large deletions are rescued. PCR analyses identified these deletions as products of legitimate recombination between loxP sites mediated by Cre protein. BACs produce deletions much more efficiently than PACs although the former cannot be induced to greater than unit copy in cells. Mammalian cell-responsive antibiotic resistance markers are introduced as part of the transposon into genomic clone deletions for subsequent functional analysis. Most importantly, the loxP site retrofitting and P1 transduction can be performed in the same bacterial host containing these clones directly isolated from PAC or BAC libraries. These procedures should facilitate physical and functional mapping of genes and regulatory elements in these large plasmids.
Libraries of DNA fragments from the genomes of numerous organisms have been constructed in cloning systems as diverse as yeast artificial chromosomes (YACs) (1 ), cosmids (2 ), bacteriophage P1 (3 -8 ), F-factor derived bacterial artificial chromosomes (BACs) (9 ,10 ), P1 artificial chromosomes (PACs) (11 ), P1 vector-based bacteriophage T4 packaging system (12 ) and the human artificial episomal chromosomes (HAECs) (13 ). Despite the availability of several vector systems capable of faithful propagation and easy manipulation of high molecular weight DNA, the study of genes and other regulatory sequences in clones from these systems has invariably been conducted using subcloning strategies (14 -16 ). Physical mapping of genes have also relied upon PCR and hybridization analysis of insert DNA subcloned into smaller vectors. Often the manipulations that go along with the ordering of small pieces of DNA in a large uncharacterized clone become cumbersome in approaches using such reconstruction strategies.
Genomic cloning systems that produce good yields of relatively pure DNA offer the advantage of having their plasmids used directly in biological experiments after modification. A general retrofitting procedure capable of introducing such alterations was recently described in the P1 system (17 ). In this approach sequences of up to 10 kb are readily inserted into the genomic DNA as part of a Tn10 mini-transposon. The near random distribution of Tn10 insertions allows one to also generate nested deletions from one end of the insert by Cre catalyzed recombination between the P1 vector loxP site and another introduced by transposition (17 ). However, deletions are only one half of the products of this recombination process. Recombination between loxP sites that are in opposite orientation leads to a less desirable inversion product in half the population (18 -21 ). For P1 clones, the recovery of both recombination products by transduction with P1 phage is very efficient (17 ). The deletions in this approach can be distinguished from the inversions only after analyzing the size of the DNA isolated from a retrofitted clone.
PACs and BACs are also amenable to such a retrofitting strategy for generating nested deletions since there is a loxP site within the vector sequences in both of these cloning systems (9 ,11 ,22 ). Because plasmids from these systems are generally much larger than P1, the transduction procedure can be used here to select for deletions that are large enough that the DNA fits into a P1 head. By supplying Cre protein in trans from P1 virs during transduction (17 ), the need for transferring the PAC or BAC plasmids to a cre+ background is avoided. Thus clones from existing PAC and BAC libraries can be used directly to generate nested deletion sets for numerous mapping studies. Antibiotic resistance markers selectable in mammalian cells can be introduced into genomic clone deletions as part of the loxP transposon. This should allow functional characterization of the deleted sequences in suitable mammalian cells.
Here we demonstrate the use of this strategy to isolate large nested deletion sets in (i) the PAC system with newly designed transposons carrying a loxP site, a chloramphenicol resistance gene and the mammalian cell-selectable marker for puromycin resistance (Fig. 1 B); and (ii) the BAC system with a different transposon which carries a kanamycin resistance gene and a loxP site. The RSVneomycin gene present in this transposon (Fig. 1 B) can confer resistance both to kanamycin in bacteria and neomycin in mammalian cells.
PAC clones #2, 5, 9 and 27 and BAC clones #10, 11, 18, 21, 22, 29 and CLC5BAC were gifts from Drs David Smoller and Kirk Findlay (Genome Systems Inc. MO, USA). These were isolated from the respective libraries constructed with human genomic DNA. The host DH10B containing the PAC and BAC plasmids is recA and expresses the lacIq repressor constitutively.
Isogenic cre- and cre+ strains, NS3516 and NS3529 respectively, were described earlier (5 ,23 ). The virulent form of P1 phage (P1 virs) used to transduce P1, PAC and BAC deletions has also been described (5 ). The P1/apex clone in the cre- host NS3516 was described earlier (17 ).
P1 virs stocks were made by a modification of the procedure outlined in (24 ,25 ) and described in detail in (17 ). Phage titers of 8 * 1010 p.f.u./ml were obtained using this procedure.
All Tn10 mini-transposon plasmids were propagated in lacIq strains (e.g. NS3516) overexpressing lac repressor. The transposon donating plasmid pTnRSVneo/loxP (17 ) served as the starting point for construction of all transposon plasmids described here. pTn(Minimal)/loxP was constructed by replacing the NotI-AscI fragment containing the RSVneo gene with a NotI-AscI synthetic oligonucleotide duplex containing a BglII site (Fig. 1 B). pTnPGKpuro/loxP was constructed similarly by replacing the same NotI-AscI fragment with a NotI-SacI fragment containing the PGKpuro gene from plasmid pPGKpuroBPA (obtained from Dr Alan Bradly, Baylor College of Medicine, Houston) and a synthetic oligonucleotide adapter with SacI-AscI ends. Transposon plasmid pTnpuro/loxP devoid of NotI and BglII sites was constructed by blunt end ligating the NotI-AscI large fragment from pTnRSVneo/loxP to the 2 kb fragment containing the puromycin gene from pPUR3 obtained from Clontech. This puromycin gene lacks the BglII site.
The transposon donating plasmid pTnBAC/loxP used in BACs was constructed by destroying the chloramphenicol resistance gene in pTnRSVneo/loxP. This was achieved by replacing the smallest NotI-EcoRI fragment (size 1.6 kb) with a synthetic oligonucleotide adapter.
Retrofitting PAC and BAC clones with loxP transposons was performed in a manner similar to that described earlier for P1 clones (17 ). Transposon plasmids pTnRSVneo/loxPand pTnPGKpuro/loxP or pTnBAC/loxP were first introduced separately into PAC or BAC plasmid-containing DH10B cells by calcium chloride treatment (26 ). Cells harboring both a transposon plasmid and a PAC or BAC plasmid were selected for resistance to all three antibiotics, kanamycin or chloramphenicol (from PAC or BAC respectively) and chloramphenicol or neomycin/kanamycin (from the PAC or BAC transposon plasmids respectively) and ampicillin (from both transposon plasmids) on L agar plates containing 25 [mu]g/ml of each antibiotic. A single transformed colony was grown to an A600 of 0.1 in 10 ml of L broth containing 25 [mu]g/ml each of kanamycin and chloramphenicol. The transposase gene in the transposon plasmid was induced by adding 100 [mu]l of a 0.1 M solution of isopropyl-[beta]-D-thiogalactopyranoside (IPTG). Cells were shaken vigorously for 4-5 h at 37oC, concentrated 10-fold by centrifugation in a Sorval table top centrifuge at 3000 r.p.m. for 10 min at 4oC and the pellet resuspended by gentle vortexing in 1 ml of prewarmed L broth containing 5 mM calcium chloride. Cells were infected with a P1 virs lysate at a multiplicity of infection (m.o.i.) of 2 and incubated at 37oC for 10 min without shaking. Then 2 ml of prewarmed L broth containing 5 mM calcium chloride was added and incubation continued at 37oC for another 2 h with vigorous shaking. Lysis was enhanced by adding 100 [mu]l of chloroform to the culture, vortexing and incubating an additional 1 min at 37oC, and vortexing again. Lysed cultures were centrifuged at 7000 r.p.m. for 10 min at 4oC in a SS 34 Sorval rotor. The P1 lysate was stored at 4oC. This phage lysate contains the population of retrofitted, headful-sized PAC or BAC DNA. Cre- NS3516 cells were infected with this lysate to regenerate the PAC or BAC deletion plasmid (5 ,17 ). This transformation from phage to plasmid was performed as described earlier for infection with P1 virs except that sufficient NS3516 cells were used to give an m.o.i. of 0.5. Infected cells were shaken at 37oC for 1 h after dilution, concentrated 10-fold and aliquots spread on L agar plates containing kanamycin, chloramphenicol or ampicillin alone or kanamycin and chloramphenicol together to select for retrofitted PACs or BACs.
Plasmid DNA from PAC or BAC deletions were isolated by the alkaline-SDS procedure after inducing cells with IPTG (for PACs only) as described earlier for P1 DNA (17 ).
PCR reactions were set up with reagents from Perkin Elmer and used a 1 min annealing at 60oC followed by a 4 min polymerization at 72oC. Sequence of primers usedfor analyzing deletions in P1 and PACs are: CM-1, d(CAACGGTGGTATATCCAGTG) and P1-loxP, d(CTCTGTCAGAAACGGCCTTACG). Relative orientations are indicated in Figure 1 A. Primers used for analyzing deletions in BACs are: Bac-1, d(GAGCTCGGACATGAGGTTG), Neo-1, d(GAGCAAGGTGAGATGACAGGAG), Bac-2, d(CCGTATTCAGTGTCGCTG), Neo-2, d(CTGCCTCGTCCTGCAGTTCATTC), Bac-3, d(CAATTATGACGCAGGTATCG) and Neo-3, d(GAATGAACTGCAGGACGAGGCAG). Bac-2 and Neo-2 are in the same direction as Bac-1 and Neo-1 respectively, while Bac-3 and Neo-3 are opposite in orientation to Bac-1 and Neo-1 respectively.
Plasmid DNAs digested with restriction enzymes were electrophoresed in 0.9% agarose gels in 1* TAE buffer (26 ) at 23 V for 18-20 h to analyse DNA fragments <15 kb.
NotI digested P1, PAC or BAC DNAs were analyzed by FIGE in 0.7% agarose gels in 1* TBE buffer (26 ). Samples were electrophoresed for 1 h at 80 V without switching and then continued for 20-40 h with a switching regimen of 1 s forward, 0.3 s reverse (ramp factor 0.5). Gels were occasionally rerun after staining with ethidium bromide and photography to enhance differences in mobility between linear PAC DNA fragments and small supercoiled transposon plasmid molecules.
The PAC system was developed to clone greater than 100 kb DNA using a modified version of the P1 vector and replacing the in vitro P1 headful packaging and infection procedures with electroporation (11 ). The BAC vector is F-factor derived with different regulatory elements that do not allow increasing plasmid copy number with IPTG. BACs contain a chloramphenicol instead of a kanamycin resistance gene (9 ,22 ) and a loxP site, and thus plasmids from this system can be used for generating nested deletion sets as described earlier for P1 clones (17 ). Retrofitting was initiated by introducing the transposon donating plasmid into the same cell containing the PAC or BAC plasmid. The chloramphenicol resistance gene in pTnRSVneo/loxP, pTn(Minimal)/loxP and pTnPGKpuro/loxP and the neomycin-kanamycin resistance gene in pTnBAC/loxP are located within the 70 bp inverted repeat ends of the transposon and is inserted along with the loxP sequence into the target DNA during transposition while the ampicillin resistance gene and the gene encoding transposase enzyme which lie outside the boundaries of the transposon are left behind.
Treatment of cells containing a PAC or BAC plasmid and a transposon donating plasmid with IPTG induces expression of the transposase gene and increases PAC plasmid number (17 ,21 ,27 ). Transduction with P1 phage efficiently recovers the low percentage of retrofitted PAC or BAC DNA as a packaged phage. The infecting P1 virs provides the PAC or BAC plasmid with a pac site when forming the cointegrate via Cre mediated loxP recombination (Fig. 1 A; ref. 17 ). Packaging initiated at the pac site allows recovery of that DNA which has undergone not only a transposon insertion but also a deletion large enough to enable the second loxP site in the cointegrate to fit into the P1 head such that the DNA is able to cyclize and survive after entering a suitable host. Cre- NS3516 cells were used for infection with the phage lysate because earlier studies (5 ,17 ) had indicated more efficient plasmid DNA recovery from this host. Again, Cre protein expressed early in infection from the pac-loxP P1 virs transduced fragment (Fig. 1 A; ref. 17 ), circularizes the infecting DNA between the two loxP sites (21 ).
A P1 clone with a 90 kb DNA insert containing the mouse AP endonuclease (apex) gene and four PAC clones with inserts ranging in size from 30 to 170 kb were used in this study. Results summarized in Table 0 show that the P1/apex plasmid is efficiently transduced with P1 virs in the absence of a transposon donating plasmid and produces a large number of colonies resistant to kanamycin. Colonies resistant to both antibiotics arise only if a transposon plasmid such as pTn(Minimal)/loxP or pTnPGKpuro/loxP was originally present in the same cell as the P1/apex plasmid and appear 10% as frequently as those resistant to kanamycin alone.
Table 1
Analysis of P1 DNA indicates that while colonies resistant to kanamycin alone contain P1/apex DNA indistinguishable from the parent, those isolated from clones resistant to both drugs contain either deletions or inversions. Lane 2 in Figure 2 A shows a field inversion gel pattern of NotI digested DNA from the P1/apex clone without transposon insertions. Lanes 3 and 4 show NotI digests of DNA from two clones containing inversions while lanes 5 and 6 show the DNA of two clones with deletions. Note that transposon insertion introduces not only 3-5 kb of DNA sequence but also a NotI restriction site. The inversions contain two plasmid populations because the colonies selected on kanamycin and chloramphenicol plates did not undergo further single colony purifications (17 ). Therefore the sum of the molecular weights of DNA bands in a NotI digest is expected to be slightly more than twice the starting clone size.
BAC clones produced nested deletions efficiently upon inserting a loxP site. The transposon TnBAC/loxP (Fig. 1 B) used to retrofit BAC clones contains the RSVneo gene which confers resistance to kanamycin in Escherichia coli and neomycin in mammalian cells (28 ). Although BAC plasmids cannot be induced to multiple copies, they produced almost 10 times more colonies with deletions than PACs using similar conditions. Six BAC clones with inserts between 120 and 180 kb isolated from a human library were used in this analysis. As in PACs, P1 transduction alone failed to recover BAC plasmids of this size class. However, a less-than P1 headful-sized BAC clone with a 80 kb insert containing the human CLC5 gene was efficiently transduced under identical conditions (data not shown). BAC clones resistant to both chloramphenicol and kanamycin were recovered upon retrofitting. Analysis of plasmid DNA indicates the presence of large deletions of 40-90 kb. FIGE of NotI digested DNA from 15 such clones is shown in Figure 3 .
Success in recovering PAC and BAC clones after retrofitting with a loxP transposon using the P1 transduction procedure relies upon the generation of large deletions. It is crucial therefore to determine whether the deletions in these large plasmids are due to genuine recombination between loxP sites mediated by Cre protein. PCR was used to demonstrate this.
The sequence and location of primers are shown in Materials and Methods and Figure 1 A. Primer CM-1 was designed from the N-terminus of the chloramphenicol resistance gene going outward toward the loxP site in the transposon and primer P1-loxP was designed from sequences between the P1 plasmid replicon and the loxP site in the P1 vector (sequences 13034-13013 in the pAd10SacB II map) such that primer extension by Taq polymerase would continue toward the loxP site in the P1 vector and into the genomic insert. A deletion between the loxP site existing in P1 or PAC and the transposed loxP site would generate a PCR product of ~3.2 kb when retrofitted with pTnRSVneo/loxP, a 1.5 kb product with pTn(Minimal)/loxP and a 3 kb product with pTnPGKpuro/loxP. DNA from a number of PAC deletion clones and a few deletion and inversion clones arising from P1/apex after retrofitting with different loxP site containing transposons was analysed by PCR. All PAC deletion clones arising from insertion of TnRSVneo/loxP transposon produce the expected 3.2 kb DNA band with digestion patterns predicted from the restriction map of the transposon (Fig. 1 B) as shown in lanes 2 and 3, 4 of Figure 4 A. PAC deletion clones and P1/apex deletion and inversion clones isolated after insertion of Tn(Minimal)/loxP transposon produced the predicted 1.5 kb DNA band with its characteristic digestion pattern shown in lanes 5 and 6, 7 and 9, 10 respectively, in Figure 4 A. Note that the inversion product is a mixture of two plasmids (17 ), one of which has the same relative configuration of the two primers as the deletion product. P1 and PAC clones with deletions or inversions (for P1 and smaller PACs) retrofitted with the TnPGKpuro/loxP transposon failed to produce a PCR product under identical conditions although the frequency of clones obtained were indistinguishable from that isolated with the Tn(Minimal)/loxP transposon. The puromycin DNA sequence revealed a high GC content and this property could account for the lack of a PCR product due to formation of stable secondary structures in the template. Nevertheless, PCR reactions with transposon donating plasmids or the starting P1 and PAC plasmids as templates failed to produce the specific bands obtained with the PAC and P1 deletion clones (data not shown).
An identical analysis performed with several BAC deletions confirm that they also arise from genuine loxP recombinations mediated by Cre protein. PCR primers from the transposon plasmid pTnBAC/loxP were designed from sequences within the neomycin gene as shown in Figure 1 A and Materials and Methods. These were paired in different combinations with primers designed from sequences within the BeloBAC vector in the region 6913-7024 and used in PCR reactions with the original BAC plasmids or deletions derived from them as templates. Four out of the nine combinations of primer pairs (one of each pair chosen from the neomycin gene and the other from the BeloBAC vector sequences) gave PCR products of the correct size with the BAC deletion clone templates as predicted (Fig. 4 B). Digestion patterns of the 1.5 kb PCR product with PmeI (lanes 3 and 6) or AscI (lanes 4 and 7) indicate that the products arise from the correct location on the template DNA. No products were observed when either the original BAC clone or the transposon donating plasmid pTnBAC/loxP were used as templates (data not shown).
Analysis of plasmid DNA reveals that ~10% of colonies with PAC or BAC deletion plasmids also contain the much smaller transposon donating plasmid. Examples of these are shown in lanes 2 and 3 of Figure 5 for PAC-27 retrofitted with either Tn(Minimal)/loxP or TnPGKpuro/loxP transposons respectively and lane 17 of Figure 3 for a BAC clone. The lowest molecular weight band in lanes 2 and 3 arises from linearized transposon plasmid since each contains a single NotI site (Fig. 1 B). Although the transposon plasmid bands copurifying in these samples are of original size, small deletions are also observed occasionally (for example lane 17 in Fig. 3 and lane 13 in Fig. 5 ).
Retrofitting plasmids from a genomic library should allow one to study the genes and regulatory sequences in a clone without resorting to laborious subcloning experiments. A procedure for retrofitting clones directly derived from a P1 library with a Tn10 mini-transposon containing a variety of sequence signals was described recently (17 ). Such a scheme is easily adaptable to the PAC system because identical regulatory elements operate in these two systems. Owing to their larger size PAC clones, after retrofitting, need to be recovered by electroporation into suitable hosts. While that is true for retrofitting in general, the present study focuses on one specific kind of retrofitting namely, the insertion of a loxP site and a mammalian cell-specific selectable marker into a PAC clone with the goal of generating nested deletion sets. This should prove highly useful not only in physical mapping studies of genes and regulatory sequences but also in the functional characterization of a clone by reintroducing it into suitable mammalian cells or animals. Although different DNA elements regulate BACs, the presence of the unique loxP site at one end of the insert DNA enables us to extend this retrofitting technology also to that system. Cre-mediated recombination between the loxP site in PACs or BACs and the one introduced via transposition can lead to two alternative events: deletion of the DNA between them if the two loxP sites are in the same orientation or inversion of the DNA if they are in the opposite orientation (19 -21 ). In this study P1 transduction (5 ,17 ) was used to selectively recover PAC and BAC plasmids containing large deletions after retrofitting with a loxP transposon. Because the transduction with P1 virs provides Cre protein in trans, such deletions between loxP sites can occur in the same cre- host containing the PAC or BAC plasmid. This procedure therefore circumvents the need to transfer large PACs or BACs from their original hosts to a cre+ background, minimizing potential disruptions in the DNA that might lead to rearrangements upon subsequent electroporation (11 ).
The transposon plasmid pTnRSVneo/loxP has been used in an earlier study (17 ). As noted in the previous study and described here in an earlier section, transduction with P1 virs efficiently transfers both the PAC deletion plasmid and the transposon plasmid by forming a packaging-competent cointegrate via the loxP site existing in either plasmid (Fig. 1 B). The modest activity of the neomycin gene in E.coli, generating resistance to kanamycin, leads to a high background of clones (almost 10 times that of a retrofitted P1) resistant to both kanamycin and chloramphenicol arising not from a retrofitted P1 clone but originating instead from the starting transposon donating plasmid. This problem became more severe in PACs where only one out of 30 colonies resistant to kanamycin and chloramphenicol proved to be a PAC deletion (data not shown). As noted earlier (17 ), one could check for ampicillin sensitivity of clones resistant to both kanamycin and chloramphenicol and discard the large majority that are ampicillin resistant (Fig. 1 B). In an effort to eliminate this problem we describe several new transposons in which the RSVneomycin gene is replaced by a duplex oligonucleotide as in pTn(Minimal)/loxP or a PGKpuromycin gene as in pTnPGKpuro/loxP (Fig. 1 B). Both transposon plasmids gave identical results in retrofitting experiments, similar to those obtained with pTnRSVneo/loxP after the background of clones containing only the transposon plasmid was subtracted.
The ability of the RSVneo gene in pTnRSVneo/loxP to confer resistance to kanamycin in bacteria was exploited in the design of the transposon plasmid pTnBAC/loxP used for BACs. Since BACs contain the chloramphenicol resistance gene, the retrofitting plasmid was designed to be devoid of this resistance marker and the ability of the RSVneo gene to confer resistance to kanamycin was used as a positive selection for isolating clones with TnBAC/loxP insertions.
The occasional copurification of transposon plasmid with a PAC or BAC deletion plasmid (Figs 5 and 3 ) is not surprising since multiple less-than-headful size DNA molecules with loxP sites have been known to be packaged in a P1 head (29 ). After circularizing the P1 virs DNA forms cointegrates with both the loxP transposon plasmid and the PAC or BAC deletion plasmid. Yield of P1 virs-transposon plasmid cointegrates is probably higher in cells because the IPTG induction might not produce large numbers of PACs due to their slower replication compared with the smaller multicopy transposon plasmid. There should also be no selection between the two kinds of cointegrates during packaging of the DNA into a P1 head. Because more than one DNA molecule can occupy the same head, a transposon plasmid is capable of entering the same cell with the PAC plasmid at a low frequency and circularize via its loxP sites (29 ). It is also possible that due to the large intracellular pool of transposon plasmid, the majority of phage produced in the lysate contain only transposon plasmid DNA. Then one would speculate that DNA from more than one particle is stabilized in cells when this lysate is used in a subsequent infection. As long as the selection for both drugs is maintained, both plasmids will be propagated because they contain different replication origins. However the smaller plasmid is readily lost once the selection for its drug resistance is removed (Fig. 5 ). Deletions in the transposon plasmid are relatively rare and might arise from loxP site insertions into themselves.
The 10-fold higher yield of BAC deletions compared with PACs is somewhat difficult to explain. It is conceivable that the added load of replicating large PAC plasmids after IPTG induction is deleterious to cells. It is also possible that the relatively rare retrofitted PAC plasmid is inefficiently transduced by P1 virs because of competition by the large majority that do not contain a transposon. Distinctions between these and other possibilities can be made definitively with a transposon vector system in which the transposase gene is inducible independently of the P1 lytic replicon in PACs by something other than IPTG.
The results with PAC-5 suggest a degree of flexibility in the amount of DNA that can be packaged in a P1 head. In the absence of retrofitting, the slightly greater than P1 headful sized DNA in this clone is transduced infrequently by P1 virs. Restriction enzyme digests of DNA from several transduced clones show them to be indistinguishable from the parent (data not shown). The PAC-5 DNA appears to be packaged into the P1 head a little more tightly at times so as to include the downstream loxP site and cre gene. Alternatively, a slight variation in capsid dimensions in a small subset of P1 phage particles capable of packaging a few extra kilobases of DNA cannot be ruled out as a possible explanation.
In conclusion, we believe that the procedures described here for isolating large nested deletions in PACs and BACs should prove useful not only in high resolution mapping of genes and regulatory elements but also in developing strategies for creating internal deletions in these large plasmids for gene disruption or `targeting' experiments.
We would like to thank Dr Nancy Shepherd for valuable suggestions and encouragement during the work, Drs David Smoller and Kirk Findlay of Genome Systems for gifts of PAC and BAC clones used in this study and for numerous helpful discussions, Dr Bruce Birren for providing the sequence of the BeloBAC vector, and Drs Allan Jaffe, Richard Hoopes, Jr and Joseph Dinchuk, for helpful discussions.
kanr
kanr + camr
P1 (apex) (90 kb insert)
++++
0
P1 (apex) + pTn(Minimal)/loxP
++++
++
P1 (apex) + pTnPGKpuro/loxP
++++
++
PAC-2 (120 kb insert)
0
0
PAC-2 + pTn(Minimal)/loxP
++
++
PAC-2 + pTnPGKpuro/loxP
++
++
PAC-5 (100 kb insert)
++
0
PAC-5 + pTn(Minimal)/loxP
++
++
PAC-5 + pTnPGKpuro/loxP
++
++
PAC-9 (30 kb insert)
+++
0
PAC-9 + pTn(Minimal)/loxP
+++
++
PAC-9 + pTnPGKpuro/loxP
+++
++
REFERENCES



