Eukaryotic release factor 1 (eRF1) abolishes readthrough and competes with suppressor tRNAs at all three termination codons in messenger RNA
Eukaryotic release factor 1 (eRF1) abolishes readthrough and competes with suppressor tRNAs at all three termination codons in messenger RNA
Gabrièle Drugeon1,*, Olivier Jean-Jean2, Lyudmila Frolova1,3,4, Xavier Le Goff3, Michel Philippe3, Lev Kisselev4,5, Anne-Lise Haenni1
1Institut Jacques Monod, 2 Place Jussieu-Tour 43, 75251 Paris Cedex 05, France, 2Laboratoire de Génétique Moléculaire, Ecole Normale Supérieure, 46 rue d'Ulm, 75230 Paris Cedex 05, France, 3Département de Biologie Génétique du Développement, CNRS UPR41, Université de Rennes 1, Campus de Beaulieu, 35042 Rennes Cedex, France,4Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, 117984 Moscow, Russia and 5Institut Curie, 26 rue d'Ulm, 75005 Paris, France
Received April 16, 1997;Revised and Accepted April 28, 1997
ABSTRACT
It is known from experiments with bacteria and eukaryotic viruses that readthrough of termination codons located within the open reading frame (ORF) of mRNAs depends on the availability of suppressor tRNA(s) and the efficiency of termination in cells. Consequently, the yield of readthrough products can be used as a measure of the activity of polypeptide chain release factor(s) (RF), key components of the translation termination machinery. Readthrough of the UAG codon located at the end of the ORF encoding the coat protein of beet necrotic yellow vein furovirus is required for virus replication. Constructs harbouring this suppressible UAG codon and derivatives containing a UGA or UAA codon in place of the UAG codon have been used in translation experiments in vitro in the absence or presence of human suppressor tRNAs. Readthrough can be virtually abolished by addition of bacterially-expressed eukaryotic RF1 (eRF1). Thus, eRF1 is functional towards all three termination codons located in a natural mRNA and efficiently competes in vitro with endogenous and exogenous suppressor tRNA(s) at the ribosomal A site. These results are consistent with a crucial role of eRF1 in translation termination and forms the essence of an in vitro assay for RF activity based on the abolishment of readthrough by eRF1.
INTRODUCTION
Termination of protein synthesis occurs when the ribosome translation machinery encounters an in-frame termination codon, either UAG (amber), UGA (opal) or UAA (ochre), on the mRNA. Hydrolysis of the ester bond linking the polypeptide chain and the last tRNA is triggered by the peptidyltransferase center of the ribosome and requires specific release factors (RFs) and GTP (for recent reviews see 1-3).
In higher eukaryotes, the situation concerning peptide chain termination remained largely unexplored following the identification and partial purification from rabbit reticulocytes of one RF recognizing any of the three termination codons (4,5). Recently, the rabbit RF was purified to homogeneity and four of its proteolytic peptides sequenced (6). These peptides were identical or very similar to peptides deduced from the amino acid sequences derived from the human TB3-1, Xenopus laevis Cl1, Saccharomyces cerevisiae sup45 and Arabidopsis thaliana sup45-like cDNAs. Expression of the human and X.laevis genes in yeast and Escherichia coli respectively, yielded proteins endowed with RF activity. Since all these proteins possess similar amino acid sequences, it was proposed that they belong to a highly conserved protein family designated eRF1 (6). No GTP binding domain was detected in the eRF1 family (6), and indeed, GTP is not an obligatory component of eRF1 activity (7). A second eRF was identified and characterized from X.laevis (7) that behaves in vitro similarly to E.coli RF3 (8,9). This protein possesses GTP-binding domains as do the human GSPT1, S.cerevisiae sup35 and Pichia pinus sup35 proteins. It binds to eRF1 and stimulates eRF1 activity in the presence of GTP. This family of proteins is designated eRF3 (7) by analogy with the E.coli RF3. eRF3 belongs to small G proteins and is an eRF1- and ribosome-dependent GTPase (10).
The assay devised to test termination in prokaryotes (11) was adapted for eukaryotic systems (12). The preformed intermediate is composed of AUG and E.coli fMet-tRNAfMet bound to rabbit reticulocyte ribosomes. Release of fMet is accomplished by incubating the intermediate with eRF, GTP, and either a tetranucleotide encompassing one of the three termination codons or a copolymer such as poly(U,G,A). The eRF1 activity is GTP independent (7), and the requirement for GTP in the original RF assay (12) was presumably due to the presence of eRF3 in the partially purified eRF1 preparation (10).
It is known that the context 5" and more significantly 3" of the termination codon influences the efficiency of termination and suppression (reviewed in 1,13). In addition, the nature of the last two amino acids of the growing peptide chain affects the efficiency of suppression and possibly also of termination (2,14). In view of the drawbacks of the original RF assay, an assay system was developed that circumvents the limitations outlined above. Pure eRF1 was used, and a natural mRNA was the source of termination signal: it contains a naturally-occurring suppressible termination codon that served to evaluate readthrough, as opposed to release of fMet from fMet-tRNA.
A suppressible UAG codon is present in the genome of beet necrotic yellow vein furovirus (BNYVV). RNA2 of the tetrapartite RNA genome of this plant virus, is 4612 nucleotides (nt) long excluding the polyA tail (15). It contains towards its 5" terminus, the open reading frame (ORF) for the viral CP of 22 kDa that terminates with a UAG codon. This is followed in-frame by a readthrough domain of 54 kDa. Readthrough of the UAG codon at the end of the CP ORF, leads to the synthesis of a 75 kDa protein (calculated size). Readthrough is detected in vitro (16) and in vivo (17). The readthrough protein is required for transmission of the virus by its fungus vector (18). It is also involved in virus assembly (19) and is present in trace amounts in purified virus particles (20).
Starting from a construct containing the cDNA corresponding to the BNYVV CP ORF and the readthrough domain, transcripts were synthesized in vitro and used as templates for in vitro translation studies in the absence or presence of exogenous eRF1. The results demonstrate that eRF1 prevents readthrough, that this occurs also when the UAG codon is replaced by UGA or UAA, and that eRF1 competes with suppressor tRNAs (tRNAsu+) for all three termination codons.
MATERIALS AND METHODS
Constructs
The starting wild-type plasmid pB218 (designated here pB218-TAG) was used for the transcription experiments; it includes the fragment corresponding to BNYVV RNA2, from nt 1 to 2715 cloned between the T7 and T3 promoters of a Blue Scribe vector (21). This insert contains an NcoI and an MluI restriction site. The resulting BNYVV RNA fragment contains the 5" untranslated region, the CP and readthrough domains, as well as 495 nt following the termination codon at the end of the readthrough domain.
Mutated cDNAs of pB218-TAG in which the TAG codon of the CP was replaced by TGA or TAA, were obtained by the polymerase chain reaction (PCR). Primer 1 was: 5[prime]CAAATTACCATGGACACCTGTTCAAGGTAGAACCAGTCCATCCGGACAATGAC-AATTAGCTGC3". It is homologous to nt 660-722 of viral RNA2 except for the TGA (bold) which replaced the TAG in pB218-TAG, and the introduction of a T residue in place of a C residue to form the BspE1 site (underlined) for screening purposes, and it contains an NcoI site (underlined). Primer 2 was identical to primer 1 except that the TGA in primer 1 was replaced by TAA. Primer 3 was 5[prime]CTGTAGCACGCGTGTGCAGC3". It is complementary to nt 1130-1150 of viral RNA2, and contains an MluI restriction site (underlined). An additional mutated cDNA derived from pB218-TAG was produced. In this cDNA, the wild-type TAG codon was maintained, but the C residue following the TAG, was replaced by a G residue, yielding pB218-TAGG. This was achieved with primer 4 which was identical to primer 1 except that the TGAC was replaced by TAGG. Primers 1, 2 or 4 were used in conjunction with primer 3.
Cloned Pfu DNA polymerase (Stratagene) was used for PCR reactions according to the supplier's recommendations. The PCR products were inserted into the NcoI and MluI restriction sites of pB218-TAG. The sequence of the resulting constructs pB218-TGA, pB218-TAA and pB218-TAGG was verified by the dideoxynucleotide chain termination method (22) using the USB sequencing kit.
mRNAs synthesized by in vitro transcription
Conditions were as described (23). After linearization of the wild-type and mutated plasmids by BamHI, transcription was performed with T7 RNA polymerase (BRL) and m7GpppG (Pharmacia), and the integrity, size and concentration of the transcripts estimated. The wild-type transcript is designated tB218- UAG and the mutated transcripts tB218-UGA, tB218-UAA and tB218-UAGG.
Release factors and suppressor tRNAs
Escherichia coli-expressed X.laevis and human His-tagged eRF1 were purified as described (6). The factors were tested for RF activity using the fMet release assay (6,12). Escherichia coli- expressed X.laevis His-tagged eRF3 was purified and assayed as described (7).
Suppressor tRNAs were partially purified from human 293 cells transiently expressing plasmids ptRNAam, ptRNAop or ptRNAoc which contain respectively the amber, opal or ochre derivatives of a human tRNASer gene (24). Plasmid ptRNAwt contains the wild-type version of this gene. These plasmids (24) were modified as described (25). The 293 cells at 50% confluency were transfected with 15 [mu]g of plasmid DNA per 100 mm plate and 48 h after transfection total cellular RNAs were extracted as described (26). The RNA samples were electrophoresed in 7 M urea-10% acrylamide gels. After ethidium bromide staining, the RNA band containing the tRNASer isoacceptors, localized by previous Northern blot hybridization with a probe specific for human tRNASer, were excised from the gel, electroeluted in 0.5× TBE (4.5 mM Tris base, 4.5 mM boric acid and 0.1 mM EDTA) and concentrated by ethanol precipitation. They are referred to as the tRNAsu+ (tRNAam, tRNAop and tRNAoc) and to the wild-type tRNAsu-. Their concentration was estimated on a urea-acrylamide gel by comparison with pure tRNAMet used as standard.
Translation
The mRNAs (0.2 [mu]g) were translated for 1 h at 25°C using 530 kBq of Pro-Mix [35S]methionine+cysteine (>37 TBq/mmol; Amersham) in 10 [mu]l containing 5 [mu]l of home-made rabbit reticulocyte lysate as described (27). The translation products were analyzed on 12.5% acrylamide-0.1% bisacrylamide-0.1% SDS gels (modified from ref. 28). The gels were then fixed, dried and submitted to autoradiography.
RESULTS
Capped tB218-UAG containing the BNYVV CP ORF and the readthrough domain was added to a reticulocyte lysate without or with increasing X.laevis eRF1 concentrations. The resulting proteins were resolved by SDS-polyacrylamide gel eletrophoresis (SDS-PAGE). In the absence of exogenous eRF1, the CP and the readthrough protein of 75 kDa were easily detected (Fig. 1A). Synthesis of the 75 kDa protein reflects the presence in the lysate of (an) unidentified suppressor tRNA(s) recognizing the UAG codon. Addition of increasing eRF1 concentrations led to a progressive decrease in the synthesis of the 75 kDa protein; at 20 [mu]g/ml of eRF1 (lane 3), readthrough was virtually abolished. Similar results were obtained with human eRF1 (not shown).
Figure 1 Analysis by SDS-PAGE of the effect of X.laevis eRF1 on readthrough in vitro of the suppressible UAG codon of the BNYVV CP in tB218-UAG. (A) Effect of increasing eRF1 concentrations. Lane 1: without mRNA. Lanes 2-8: with tB218-UAG as mRNA. Lanes 3-7: with decreasing eRF1 concentrations as indicated above the lanes. Lane 8: eRF1 was replaced by the equivalent volume of buffer used for dilution of the factor. (B) Effect of different proteins and of heated eRF1 on readthrough. Lane 9: as lane 2. Lanes 10-13: with 20 [mu]g/ml of His-tagged GFP, BSA, eRF1, or eRF1 heated for 10 min at 65°C. In both panels, the positions of the CP (22 kDa) and of the readthrough protein (75 kDa) are indicated. Lanes 9-13 are from the same gel.
To verify that eRF1 was responsible for the decrease in readthrough, various controls were performed (Fig. 1B). When eRF1 was heated for 10 min at 65°C prior to addition to the translation system, it no longer affected readthrough (compare lanes 12 and 13). Neither bovine serum albumin (BSA; lane 11), nor His-tagged green fluorescent protein (GFP) prepared and isolated as was eRF1 (lane 10), affected readthrough.
To determine the specificity of the X.laevis eRF1 and examine the competition between eRF1 and the appropriate tRNAsu+ for the three termination codons, the wild-type transcript tB218- UAG and the mutated counterparts tB218-UGA or -UAA were used as templates in translation experiments performed in the absence or presence of eRF1, and in the absence or presence of the tRNAsu+. In addition, transcript tB218-UAGG in which the C residue following the UAG codon was mutated to a G residue, was translated in a reticulocyte lysate in the same conditions as those outlined above. In the absence of exogenous eRF1, readthrough was easily detected whatever the termination codon present at the end of the CP ORF (Fig. 2, lanes 5, 11 and 15), except in the case of tB218-UAGG where the level of readthough was very low (lane 1). Addition of 20 [mu]g/ml of eRF1 decreased the level of readthrough which was virtually (lanes 6, 12 and 16) or even totally (lane 2) abolished. In the presence of the appropriate tRNAsu+, but without eRF1, increase in the level of the readthrough protein was accompanied by a decrease of the yield of CP (lanes 3, 8, 13 and 17). In the presence of tRNAsu+ and eRF1, the level of readthrough protein decreased whereas the level of the CP increased (lanes 4, 9, 14 and 18). Neither wild-type tRNAsu- alone (lane 7) nor GFP in the presence of tRNAsu+ (lane 10) affected readthrough. Equally efficient competition was observed in the presence of tB218-UAG between eRF1 and pure serine accepting tRNAop from Schizosaccharomyces pombe (not shown).
Figure 2 Analysis by SDS-PAGE of the competition between eRF1 and tRNAsu+ using tB218-UAG, tB218-UGA, tB218-UAA and tB218-UAGG as mRNAs. Addition of eRF1 (20 [mu]g/ml) and/or tRNAsu+ (10 [mu]g/ml) was as indicated above the lanes. In lane 10, GFP (20 [mu]g/ml) replaced eRF1. All lanes are from the same gel, except for lanes 1-4 which are from another gel. The positions of the CP (22 kDa) and of the readthrough protein (75 kDa) are indicated.
In a wheat germ translation system, and for the same amounts of X.laevis eRF1 and/or tRNAsu+ as used in the reticulocyte lysate, similar responses were obtained, but the efficiency of termination triggered by eRF1 was lower than in the reticulocyte lysate (not shown).
In another series of experiments, the possible influence of eRF3 on readthrough efficiency was examined (Fig. 3) using tB218-UAG, either in the absence (lanes 1-7) or in the presence (lanes 8-14) of exogenous suppressor tRNAam. As expected, eRF3 alone did not affect the level of readthrough (lanes 6, 7, 13 and 14). When eRF3 was added with eRF1 to the incubation mixture in a 4-fold molar excess over eRF1, it barely enhanced the effect of eRF1 (lanes 5 and 12). However, when present in a much larger excess over eRF1, eRF3 enhanced the effect of eRF1 in triggering termination (lanes 4 and 11). It was verified that the buffer containing eRF3 was not responsible for this effect (not shown).
DISCUSSION
Figure 3 Analysis by SDS-PAGE of the effect of X.laevis eRF3 on eRF1 activity in vitro. Transcript tB218-UAG was used as mRNA throughout. Addition and concentrations (in [mu]g/ml) of eRF1 and/or eRF3 were as indicated above the lanes. Where indicated, tRNAam (10 [mu]g/ml) was included. All lanes are from the same gel. The positions of the CP (22 kDa) and of the readthrough protein (75 kDa) are indicated.
We have developed an assay system to evaluate eukaryotic termination of protein synthesis versus readthrough in vitro using pure eRF1, suppressor tRNA and a naturally-occurring suppressible UAG codon embedded in the genome of a plant RNA virus, RNA2 of BNYVV. Suppression of the UAG codon located between the CP ORF and a 54 kDa domain on RNA2 leads to the synthesis of a readthrough product of 75 kDa that is indispensible for virus propagation.
In the present study, the capped transcript tB218-UAG containing the 5"-terminal 2715 nt of RNA2 and thus encompassing the entire 75 kDa ORF, was produced from pB218-TAG (21), and used as template for in vitro translation studies with a rabbit reticulocyte lysate to evaluate the effect of eRF1 and of suppressor tRNAam on the level of termination of translation. Transcripts tB218-UGA and tB218-UAA in which respectively the opal and ochre codon replaced the naturally-occurring amber codon were also tested in similar conditions using the corresponding tRNAsu+. Analysis of the translation products synthesized revealed that all three types of transcript lead to the production of the CP and of the readthrough protein of 75 kDa and that the readthrough protein results from the presence of suppressor tRNAs in the lysate.
With all three types of transcript and in the experimental conditions used here, readthrough was virtually abolished in the presence of 20 [mu]g/ml of X.laevis eRF1 that corresponds to three to four added eRF1 molecules per ribosome. This should in effect correspond to a large excess of eRF1 over termination codons, given that one molecule of eRF1 is normally required to terminate one polypeptide chain on polyribosomes. Nevertheless, the exact ratio between eRF1 and ribosome is difficult to evaluate, because the proportion of active eRF1 molecules in the preparation is not known.
The results obtained demonstrate that eRF1 specifically recognizes all three termination codons when contained in an mRNA, as it does also in the assay based on the release of fMet from fMet-tRNA in response to tetraplets containing termination codons (5,6). The assay described here presents the advantage that eRF1 interacts with termination codons embedded in an mRNA whose affinity towards ribosomes is much higher than that of tetraplet termination signals. Moreover, a natural protein is terminated as opposed to hydrolysis of fMet-tRNA which probably never occurs in a natural system.
The ability of eRF1 on its own to compete efficiently with tRNAsu+ of various nonsense codons in vitro (this work) and in vivo (25) implies that association of eRF1 with eRF3 is probably not required for productive eRF1 binding to the ribosomal A site. Recent data on yeast eRF1 (Sup45p) mutants (29) agree with this interpretation. In these studies, reduction of the level of Sup45p in yeast cells caused the appearance of a suppressor phenotype, while the level of Sup35p (equivalent to eRF3) remained unaltered. The results presented here are also in line with those obtained with a Salmonella typhimurium strain (30) carrying a UGA suppressor allele in the gene encoding RF2 (a prokaryotic analog of eRF1). In these experiments, reduction in the level of RF2 was responsible for the suppressor phenotype. In view of all these findings (7,25,29,30; this work) the earlier data (31 and references therein) regarding the antisuppressor activity of eRF3 on its own requires further experiments.
Suppression of termination during translation is a strategy frequently encountered among animal and plant RNA viruses for the synthesis of their proteins (reviewed in 32-34). To date only suppressible UAG and UGA codons have been encountered. The codon context surrounding the suppressible amber codon in BNYVV RNA2, is identical to the one surrounding the suppressible amber codon in tobacco mosaic tobamovirus (TMV) RNA (35) over 12 nt (CAAUAGCAAUUA). In the case of TMV in which readthrough is required to produce the RNA-dependent RNA polymerase (36), it has been demonstrated that the two codons downstream of the UAG signal are important determinants of suppression in vivo (37), and in vitro (38). Moreover, it has been demonstrated that translational termination efficiency is strongly influenced by the base following the termination codon (39), A and G being preferred over C and U. Indeed, mutating the nucleotide following the suppressible UAG codon in BNYVV RNA2 from a C to a G resulted in barely detectable readthough protein as compared with the wild-type transcript. Thus it is not surprising that in the BNYVV and TMV RNAs in which readthrough is required, a C residue follows the termination codon, thereby presumably decreasing the possibility of termination at this position.
Addition of excess X.laevis eRF3 over eRF1 enhanced the release activity of eRF1. Alone, eRF3 had no effect on the efficiency of readthrough, and conversely, eRF1 alone was sufficient to inhibit readthrough. Earlier it was shown that even in the absence of eRF3 and GTP, eRF1 on its own was active in promoting termination codon-dependent fMet-tRNA hydrolysis (7). The finding described here, that eRF1 in the absence of exogenous eRF3 efficiently competes with endogenous and exogenous suppressor tRNA(s) implies that recognition of termination codons and peptidyl-tRNA hydrolysis are predominantly associated with eRF1. These experiments show the contribution of eRF3 in stimulating the antisuppressor activity of eRF1 though this effect is obviously of secondary importance. Our experiments indicate that in this in vitro translation system, eRF1 rather than eRF3 limits the efficiency of termination.
Readthrough of termination codons requires the positioning of a suppressor tRNA in the ribosomal A site. Our results indicate that exogenous eRF1 efficiently competes at the A site with endogenous and exogenous suppressor tRNA(s) for the termination codon in a natural mRNA.ribosome complex. This observation emphasizes the functional resemblance between tRNAs and eRF1, and implies that eRF1 could also be structurally similar to aminoacyl-tRNA. This suggestion is in line with the recently proposed tRNA-protein mimicry concept (40) and its extension to RFs (2,41).
ACKNOWLEDGEMENTS
We are very grateful to K. Richards for the wild-type plasmid pB218, to Yu. Stasiv for the E.coli clone harboring the expressible human eRF1 cDNA, to C. Prigent for the His-tagged GFP and to J. Kohli for a gift of yeast tRNASer from an opal suppressible strain. L.F. was partly financed by a `Poste Rouge' from the CNRS. X.L.G. and M.P. were supported by the Ligue Nationale contre le Cancer. L.K. was supported by the Russian Foundation for Basic Research. This work also benefited of a grant from INTAS (94-1521) and of an International Chair `Blaise Pascal' (Fondation de l'Ecole Normale Supérieure). The Institut Jacques Monod is an `Institut Mixte, CNRS-Université Paris 7'.
REFERENCES
1. Tate, W.P., Poole, E.S. and Mannering, S.A. (1996) Prog. Nucl. Acid Res. Mol. Biol., 52, 293-335.
2. Nakamura, Y., Ito, K. and Isaksson, L.A. (1996) Cell, 87, 147-150.MEDLINE Abstract
4. Goldstein, J.L., Beaudet, A.L. and Caskey, C.T. (1970) Proc. Natl. Acad. Sci. USA, 67, 99-106.MEDLINE Abstract
5. Beaudet, A.L. and Caskey, C.T. (1971) Proc. Natl. Acad. Sci. USA, 68, 619-624.MEDLINE Abstract
6. Frolova, L., Le Goff, X., Rasmussen, H.H., Cheperegin, S., Drugeon, G., Kress, M., Arman, I., Haenni, A.-L., Celis, J.E., Philippe, M., Justesen, J. and Kisselev, L. (1994) Nature, 372, 701-703.MEDLINE Abstract
7. Zhouravleva, G., Frolova, L., Le Goff, X., Le Guellec, R., Inge-Vechtomov, S., Kisselev, L. and Philippe, M. (1995) EMBO J., 14, 4065-4072.MEDLINE Abstract
8. Mikuni, O., Ito, K., Moffat, J., Matsumura, K., McCaughan, K., Nobukuni, T., Tate, W. and Nakamura, Y. (1994) Proc. Natl. Acad. Sci. USA, 91, 5798-5802.MEDLINE Abstract
9. Grentzmann, G., Brechemier-Baey, D., Heurgue, V., Mora, L. and Buckingham, R.H. (1994) Proc. Natl. Acad. Sci. USA, 91, 5848-5852.MEDLINE Abstract
10. Frolova, L., Le Goff, X., Zhouravleva, G., Davydova, E., Philippe, M. and Kisselev, L. (1996) RNA, 2, 334-341.MEDLINE Abstract
11. Caskey, C.T., Tompkins, R., Scolnick, E., Caryk, T. and Nirenberg, M. (1968) Science, 162, 135-138.MEDLINE Abstract
E. Ilegems, H. M. Pick, and H. Vogel Downregulation of eRF1 by RNA interference increases mis-acylated tRNA suppression efficiency in human cells
Protein Eng. Des. Sel.,
December 1, 2004;
17(12):
821 - 827.
[Abstract][Full Text][PDF]
T. Kobayashi, Y. Funakoshi, S.-i. Hoshino, and T. Katada The GTP-binding Release Factor eRF3 as a Key Mediator Coupling Translation Termination to mRNA Decay
J. Biol. Chem.,
October 29, 2004;
279(44):
45693 - 45700.
[Abstract][Full Text][PDF]
D. M. Janzen and A. P. Geballe The effect of eukaryotic release factor depletion on translation termination in human cell lines
Nucleic Acids Res.,
August 23, 2004;
32(15):
4491 - 4502.
[Abstract][Full Text][PDF]
Z. N. Karamysheva, A. L. Karamyshev, K. Ito, T. Yokogawa, K. Nishikawa, Y. Nakamura, and S. Matsufuji Antizyme frameshifting as a functional probe of eukaryotic translational termination
Nucleic Acids Res.,
October 15, 2003;
31(20):
5949 - 5956.
[Abstract][Full Text][PDF]
J. CARNES, M. JACOBSON, L. LEINWAND, and M. YARUS Stop codon suppression via inhibition of eRF1 expression
RNA,
June 1, 2003;
9(6):
648 - 653.
[Abstract][Full Text][PDF]
D. M. Janzen, L. Frolova, and A. P. Geballe Inhibition of Translation Termination Mediated by an Interaction of Eukaryotic Release Factor 1 with a Nascent Peptidyl-tRNA
Mol. Cell. Biol.,
December 15, 2002;
22(24):
8562 - 8570.
[Abstract][Full Text][PDF]
E. Ilegems, H. M. Pick, and H. Vogel Monitoring mis-acylated tRNA suppression efficiency in mammalian cells via EGFP fluorescence recovery
Nucleic Acids Res.,
December 1, 2002;
30(23):
e128 - e128.
[Abstract][Full Text][PDF]
F. Lecointe, O. Namy, I. Hatin, G. Simos, J.-P. Rousset, and H. Grosjean Lack of Pseudouridine 38/39 in the Anticodon Arm of Yeast Cytoplasmic tRNA Decreases in Vivo Recoding Efficiency
J. Biol. Chem.,
August 16, 2002;
277(34):
30445 - 30453.
[Abstract][Full Text][PDF]
B. Cosson, A. Couturier, S. Chabelskaya, D. Kiktev, S. Inge-Vechtomov, M. Philippe, and G. Zhouravleva Poly(A)-Binding Protein Acts in Translation Termination via Eukaryotic Release Factor 3 Interaction and Does Not Influence [PSI+] Propagation
Mol. Cell. Biol.,
May 15, 2002;
22(10):
3301 - 3315.
[Abstract][Full Text][PDF]
D. Moreira, S. Kervestin, O. Jean-Jean, and H. Philippe Evolution of Eukaryotic Translation Elongation and Termination Factors: Variations of Evolutionary Rate and Genetic Code Deviations
Mol. Biol. Evol.,
February 1, 2002;
19(2):
189 - 200.
[Abstract][Full Text][PDF]
G. Bertram, S. Innes, O. Minella, J. P. Richardson, and I. Stansfield Endless possibilities: translation termination and stop codon recognition
Microbiology,
February 1, 2001;
147(2):
255 - 269.
[Full Text]
I. N. Berezovsky, G. T. Kilosanidze, V. G. Tumanyan, and L. L. Kisselev Amino acid composition of protein termini are biased in different manners
Protein Eng. Des. Sel.,
January 1, 1999;
12(1):
23 - 30.
[Abstract][Full Text][PDF]
I. L. Derkatch, M. E. Bradley, and S. W. Liebman Overexpression of the SUP45 gene encoding a Sup35p-binding protein inhibits the induction of the de novo appearance of the [PSI+] prion
PNAS,
March 3, 1998;
95(5):
2400 - 2405.
[Abstract][Full Text][PDF]