Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (201K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (41)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Kang, J. G.
Right arrow Articles by Roe, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kang, J. G.
Right arrow Articles by Roe, J. H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 1997 Oxford University Press 2566-2573

Identification of sigma factors for growth phase-related promoter selectivity of RNA polymerases from Streptomyces coelicolor A3(2)

Identification of sigma factors for growth phase-related promoter selectivity of RNA polymerases from Streptomyces coelicolor A3(2) Ju-Gyeong Kang, Mi-Young Hahn, Akira Ishihama1 and Jung-Hye Roe*

Department of Microbiology, College of Natural Sciences, and Research Center for Molecular Microbiology, Seoul National University, Seoul 151-742, Korea and 1Department of Molecular Genetics, National Institute of Genetics, Mishima, Shizuoka 411, Japan

Received April 28, 1997; Accepted May 19, 1997

ABSTRACT

We examined the promoter selectivity of RNA polymerase (RNAP) from Streptomycescoelicolor at two growth phases by in vitro transcription. Distinct sets of promoters were preferentially recognized by either exponential or stationary phase RNAP. No change in molecular weight or net charge of the core subunits was observed, suggesting that the associated specificity factors determined phase-specific promoter selectivity of the holoenzyme. Five different specificity factors and their cognate promoters were identified by in vitro holoenzyme reconstitution and transcription assays. [sigma]66 ([sigma]hrdB) and [sigma]46 ([sigma]hrdD) recognized promoters (rrnDp2and dagAp4for [sigma]66, actII-orf4p and whiBp2for [sigma]46)preferentially transcribed by the exponential phase RNAP. [sigma]52 recognized promoters (dagAp3and actIIIpx1)preferentially transcribed by the stationary phase RNAP. [sigma]28([sigma]sigE)recognized promoters (hrdDp1, whiBp1and dagAp2)transcribed equally by both RNAPs. A novel 31 kDa specificity factor recognized actIIIpx2, glnRp2and hrdDp2promoters preferentially transcribed by the stationary phase RNAP. This factor was isolated from the stationary phase RNAP and reconstituted holoenzyme in vitro as a sigma factor. The N-terminal sequence suggests that it is a novel factor. By examining phase-specific promoter recognition pattern we can predict that holoenzyme E[sigma]52 and E[sigma]31 activities are higher in the stationary phase, whereas E[sigma]66 and E[sigma]

46 activities are higher in the exponential phase. Possible promoter sequences recognized by some of these sigma factors were suggested.

INTRODUCTION

Various [sigma]factors in eubacterial RNA polymerase (RNAP) confer promoter selectivity on the core RNAP, thereby enabling the transcription pattern to change in response to environmental cues. At least eight different [sigma]factors have been found in Streptomyces coelicolor,which undergo complex mycelial growth and sporulation (1 ,2 ). Four homologues of Escherichia coli rpoD gene called hrdA-D were cloned and characterized (3 -5 ). The hrdB gene has been proved to be essential for the survival of S.coelicolor,whereas the functions of hrdA, -C and -D genes are not clear (6 ). Recently, it was demonstrated that HrdD actually functions as a sigma factor to transcribe redD and actII-orf4 promoters in vitro (7 ).Two sigma factors have been implicated in the control of the morphological differentiation of this organism. The whiG gene encodes an alternative [sigma]factor required for triggering the onset of sporulation whereas the sigF gene is required for normal spore maturation (8 ,9 ). In vitro transcription studies revealed that at least three different forms of RNAP holoenzyme exist, which are able to recognize the promoters of dagA gene encoding agarase (3 ,10 ).[sigma]hrdB ([sigma]66),the major vegetative sigma factor, recognizes dagAp4as well as the veg gene promoter of Bacillus subtilis. [sigma]52was identified as a [sigma]factor which recognizes dagAp3. [sigma]sigE ([sigma]28),the Streptomyces homologue of a [sigma]factor family thought to regulate extracytoplasmic functions (11 ), recognizes dagAp2. However, the promoter selectivity of various sigma factors as well as the relative abundance and/or activity under different growth conditions and during differentiation have not been systematically investigated.

In E.coli,the RNAP holoenzyme changes in the molecular characteristics of both core enzyme (E) and the associated [sigma]factors as cells enter into the stationary phase. More than 30genes which are induced upon entry into stationary phase are controlled by the stationary phase-specific [sigma]factor, [sigma]rpoS ([sigma]38). The intracellular level of [sigma]38 increases to 30%of the level of major sigma factor [sigma]70 upon entry into stationary phase whereas the level of [sigma]70 stays constant at the stationary phase (13 ). Modified forms of core RNAP were isolated from E.coli,each being separable by phosphocellulose column chromatography and exhibited different promoter selectivities from the exponential phase RNAP (14 ).

Streptomycete genes thus far identified exhibit a wide diversity in promoter sequences and transcription patterns. Among 139 Streptomycete promoters previously compiled, ~20% have sequence elements similar to those recognized by E.coli E[sigma]70 (15 ). The rest of the promoters contain enormously diverse sequences and the cognate [sigma] factors recognizing them have been hardly identified. In order to probe and characterize structural and functional changes in RNA polymerases in S.coelicolor cells during growth transition from the exponential to stationary phases of liquid culture, we prepared in this study RNAPs from the two growth phases and examined their promoter selectivity using a variety of promoters. As a result, the promoters could be classified on the basis of recognition patterns by the two RNAPs. Furthermore, by using in vitro transcription assays by holoenzymes reconstituted from core enzyme and proteins eluted from the gel, we identified several [sigma] factors including a novel [sigma] factor.

MATERIALS AND METHODS

Bacterial strains and culture conditions

Streptomyces coelicolor A3(2) M145 cells were grown in YEME medium (16 ) containing 5 mM MgCl2 and 10% sucrose in a fermenter aerated at 0.5 vol air/vol media/min and agitated at 250 r.p.m. at 30oC. Freshly grown seed culture (200 ml) was inoculated to 4 l culture broth in 5 l fermenter. The mycelium was harvested from the fermenter at 12 h after inoculation for the exponential phase and 32 h for the stationary phase culture, and was stored at -70oC until use.

Preparation of RNA polymerase

RNA polymerase was purified from cell pellets by slight modifications of the procedures developed for the purification of E.coli RNAP (17 -19 ). Approximately 20 g of wet mycelial cells were disrupted in a French pressure cell at 1000 p.s.i. The crude extract was subjected to polyethyleneimine (PEI) precipitation, salt fractionation and ammonium sulfate precipitation. The sample was applied to a heparin Sepharose CL-6B column (Pharmacia) which was washed with TGED buffer (10 mM Tris-HCl, pH 7.9 at 4oC, 0.1 mM EDTA, 0.1 mM DTT and 10% glycerol) containing 0.2 M NaCl. Proteins were eluted using a gradient of 0.2-0.7 M NaCl in TGED buffer. The fractions containing RNAP activity were pooled and concentrated by ammonium sulfate precipitation. The precipitate was dissolved in TED buffer (TGED without glycerol) and dialyzed against storage buffer (10 mM Tris, pH 7.9 at 4oC, 10 mM MgCl2, 0.1 M KC1, 0.1 mM EDTA, 1 mM DTT and 50% glycerol). For further purification, the proteins were diluted in TED buffer and chromatographed through Superdex HR 200 (Pharmacia) with TGED containing 0.3 M NaCl and MonoQ (Pharmacia) anion exchange columns using a gradient of 0.3-0.6 M NaCl in TGED buffer. The trailing fractions (higher salt eluates) of the RNAP peak eluted from Mono-Q column were used as core RNAP.

Preparation of template promoter fragments

The promoters examined in this study are listed in Table 1 . DNA fragments containing the dagA (20 ), rrnD (21 ), glnR (22 ) and actII-orf4 (23 ) promoters were PCR-amplified from the genomic DNA of S.coelicolor A3(2) strain M145 using the following pairs of oligonucleotide primers: ATCAGCCGGAGTGAACCGTT and GAGTGCGACGGCACTCCAC for dagA;CTGGCCTACGTCTACGTTGT and CGATCAGGTCGGGGTATCAA for rrnD;CGACGAACACCAGGTCAG and GCAGCAGAGAACTCATCG for glnR; GAGGACCCAGCCGTATCAG and GTACACGTACGTCTGCAG for actII-orf4. The resulting PCR products were cloned into pUC18 or pTZ-18R. The glkA, hrdD and whiB genes were provided by Dr M.Bibb at John Innes Center. The actI/III gene was provided by Dr S.K.Hong at Myeong Ji University. Each promoter fragment was subcloned from the larger parental plasmid into pUC18; glkA from pIJ2420 (24 ), hrdD from pIJ2036 (25 ), whiB from pIJ558 (26 ) and actI/III from pIJ2303 (27 ). Promoter DNA fragments ranging from 346 to 578 nucleotides in length were cut out from the resulting recombinant pUC18 plasmids using the restriction enzymes listed in Table 1 .

In vitro transcription assay

In vitro run-off transcription assay was performed using the combined conditions of Fujita et al. (18 ) and Buttner et al. (10 ). RNAP (1.5 pmol) was incubated at 30oC for 5 min in 15 [mu]l transcription buffer [40 mM Tris pH 7.9, 10 mM MgCl2, 0.6 mM EDTA, 0.4 mM potassium phosphate, 1.5 mM DTT, 0.25 mg/ml BSA and 20% (v/v) glycerol] with 0.15 pmol of template DNA. RNA synthesis was initiated by the addition of 3 [mu]l of substrate mixture containing 2 [mu]Ci[[alpha]-32P]CTP (400 Ci/mmol) and 0.4 mM each of UTP, ATP and GTP. An aliquot of 3 [mu]l of heparin (0.1 mg/ml final concentration) was added after 2 min to prevent further reinitiation and the incubation was continued for 5 min before adding 2 [mu]l of cold CTP (1.0 mM final concentration). After 10 min incubation, the reaction was terminated by adding 50 [mu]l of stop solution (375 mM sodium acetate pH 5.2, 15 mM EDTA, 0.15% SDS and 0.1 mg/ml calf-thymus DNA). Transcripts were precipitated with ethanol, resuspended in formamide sample buffer [80% (v/v) formamide, 8% glycerol, 0.1% SDS, 8 mM EDTA, 0.01% bromophenol blue and 0.01% xylene cyanol] and electrophoresed on 5% polyacrylamide gel containing 7 M urea.

Holoenzyme reconstitution assay

About 1 mg of RNAP partially purified through heparin Sepharose CL-6B chromatography was subjected to preparative SDS-PAGE. The gel was stained with 0.25 M KCl and 1 mM DTT and proteins were eluted by the procedure of Hager and Burgess (28 ). Gel slices (2-8 mm) were cut out and placed in dialysis bags containing 300 [mu]l of 2:5 diluted SDS-running buffer and 3 [mu]l of 10 mg/ml BSA. Electroelution from the gel was carried out at 30 mA for 3 h at 4oC. The eluates were recovered and precipitated by adding 1.2 ml of cold acetone. Renaturation of the eluted proteins was performed in the presence of GroEL as described (3 ). GroEL was purified from E.coli containing pGroELS (a gift from Dr Lorimer, E.I.Dupont de Nemours and Co.) through DEAE-Sepharose, heparin Sepharose CL-6B, Superose 6B (Pharmacia) column chromatographies (29 ,30 ). The acetone precipitate was dissolved thoroughly in 20 [mu]l of 6 M guanidine-HCl buffer (20 mM Tris-HCl pH 7.8, 150 mM NaCl, 5 mM DTT, 0.1 mM EDTA, 6 M guanidine-HCl) and incubated at room temperature for 20 min. The resuspended pellet was then diluted into 1 ml of GroEL incubation buffer (50 mM Tris pH 7.8, 12 mM MgCl2, 9 [mu]g/ml GroEL) and incubated at 22-25oC for 2 h. It was then dialyzed against renaturation buffer [20 mM Tris-HCl, pH 7.8 at 4oC, 10 mM MgCl2, 10 mM KCl, 0.1 mM EDTA and 50% (v/v) glycerol] for 12-16 h with one change of the buffer. An aliquot of 5 [mu]l of the renatured proteins was added to ~1 pmol of core RNA polymerase and the mixture was incubated on ice for 10 min. After addition of 0.15 pmol of DNA template, the mixtures were incubated at 30oC for 30 min and subjected to in vitro transcription assay.

Table 1 List of S.coelicolor promoters used in this study
Gene

 

Function

 

Template size (nt)
(truncated ends)
Promoter

 

Transcript length (nt)
 
Observation in vitro
 
Reference

 

actI/III

actinorhodin biosynthesis 358 (BamHI/SalI)

Ip

91

-

31

      IIIp 278 - 27
      IIIpx1 120 +  
      IIIpx2 87 +  
actII-orf4

 

regulator of actinorhodin biosynthesis 371 (AvaII)

 

p

 

187

 

+

 

23

 

dagA

agarase

578 (XbaI/HindIII) p1

91

+

20

      p2 137 +  
      p3 183 +  
      p4 278 +  
glkA glucose kinase 483 (NarI/NaeI) p23 245 + 24
glnR

 

regulator of glutamine synthetase gene 478 (HindIII/EcoRI)

 

p1

 

166

 

+

 

22

 

      p2 217 +  
      p3 247 +  
hrdD

homologue of E.coli rpoD 489 (HindIII/NarI) p1

314

+

25

      p2 62 +  
rrnD

ribosomal RNA

550 (BamHI/KpnI) p1

413

-

21

      p2 362 +  
      p3 216 +  
      p4 137 +  
whiB sporulation 346 (HindIII/SalI) p1 253 + 26
      p2 95 +  

N-terminal amino acid sequencing

RNAP fractions eluted from Mono-Q column with peak levels of the hrdD transcribing activity were pooled, electrophoresed, and electroblotted onto polyvinylidene difluoride membrane (pore size, 0.1 [mu]m, Millipore) in CAPS buffer [10 mM 3-(cyclohexylamino)-1-propanesulfonic acid, 10% methanol, pH 11.0]. The first 22 residues of [sigma]31and 10 residues of [sigma]28were determined by Edman degradation using Procise Protein Sequencing System (Applied Biosystems).

RESULTS

Collection of template promoters

To examine promoter selectivities of RNAPs in vitro,we prepared a number of DNA fragments, each carrying specific promoter(s) from various Streptomycete genes which are involved in such diverse functions as transcription or translation (hrdD, rrnD),carbon and nitrogen metabolism and their regulation (dagA, glkA, glnR)and morphological and physiological differentiation (whiB, actI/III, actII-orf4). Most of these genes have multiple promoters as listed in Table 1 . Of 21promoters examined, only dagAp4, rrnDp2and whiBp2have sequences similar to E.coli E[sigma]70-recognized promoters (15 ). The cognate [sigma] factor recognizing each promoter in our collection has not been identified except for the dagA and actII-orf4 promoters (3 ,7 ,10 ). The collection of promoter templates provides a representative example of the promoter sequence heterogeneity in S.coelicolor and thus was expected to serve as diverse templates to probe the RNAPheterogeneity.

Differential promoter selectivities of RNAPs from two growth phases of S.coelicolor

When S.coelicolor A3(2) M145cells were grown in YEME medium in a fermenter, they entered into the stationary phase ~20h after inoculation, as judged by the optical density of the culture. RNApolymerases were prepared from either exponentially growing cells (12h culture) or the stationary phase cells (32h culture) and compared for their promoter selectivity. Partially purified RNAPsat the step of heparin Sepharose CL-6B column chromatography were used for in vitro transcription assay. Both enzyme preparations contained [beta]', [beta] and [alpha] subunits as the major components but a number of additional proteins were identified by SDS-PAGE, including at least five sigma subunits (see below for details).

Figure 1 demonstrates representative transcription pattern of promoters from eight genes. Transcripts in vitro of the sizes expected from transcription initiation sites in vivo (Table 1 ) were observed for all the test promoters except for the actI/III and rrnDp1promoters. Promoters such as actII-orf4p, dagAp1, p4, glkAp23, glnRp3, rrnDp3, p4and whiBp2 promoters were preferentially recognized by the exponential phase RNAP whereas promoters actIIIpx1, px2, dagAp3and hrdDp2were preferentially recognized by the stationary phase RNAP.


Figure 1.Promoter selectivities of RNAPs from the exponential and stationary phase culture of S.coelicolor. Run-off transcripts from 0.15 pmol of various templates were generated by 1.5 pmol of RNAP prepared from the exponential (12 h culture, lane E) or stationary (32 h culture; lane S) phase S.coelicolor cells as described in the text. Transcripts were separated on 5% PAGE containing 7 M urea and detected by autoradiography. The position of each transcript was marked in accordance with the information in Table 1.

Table 2 . Preferential recognition of promoters by RNAP from two growth phases. Run-off transcripts from each promoter generated by the exponential (E) or stationary (S) phase RNAP were analyzed on 8 M urea-5% PAGE as shown in Figure 1. E/S selectivity ratio was deterrnined by quantifying the amount of each transcript produced by either exponential or stationary phase RNAP
RNAP Preferentially recognized promoters (E/S selectivity ratio)
Exponential phase RNAP dagAp4 (1.74), dagAp1 (1.65), rrnDp3 (3.06), rrnDp4(1.93), whiBp2 (2.32), glnRp3 (2.48), glkAp23(2.14), actII-orf4p (1.43)
Stationary phase RNAP dagAp3 (0.54), hrdDp2 (0.37), actIIIpx1(0.27), actIIIpx2 (0.43)
Both RNAPs

dagAp2 (1.04), rrnDp2 (1.11), whiBp1 (1.12), hrdDp1 (1.07), glnRp2 (0.92), glnRp1 (1.21)

Two putative promoters in the actIII gene, designated as px1 and px2 (Fig. 1 ), were recognized preferentially by the stationary phase RNAP, although transcripts of corresponding sizes have not been detected in vivo (31 ). Transcripts from the putative promoters px1 and px2 within the open reading frame of the actIII gene were repeatedly observed in our assay using either partially or highly purified RNAPs. Although it is not certain whether these putative promoters function in vivo,we included these promoters for further examination.

Among the four promoters of the dagA gene, p3was predominantly transcribed by the stationary phase RNAP, while p1 and p4 were preferentially recognized by the exponential phase RNAP. The dagAp2promoter was recognized to similar extent by both RNAPs. Buttner et al. (10 ) previously reported that the RNAP preparation from the stationary phase mycelium in a fermenter culture produced dagAp3transcript as the predominant species, whereas the dagAp4transcript was the predominant species produced by the RNAP preparation from shake-flask cultures undergoing rapid growth (10 ). Our results confirmed that the growth transition from growing to stationary phase, but not the difference in culture method, led to the change in promoter selectivity of RNAP for the dagA promoters. Among three promoters of glnR,p3 was preferentially recognized by the exponential phase RNAP whereas p1 and p2were similarly recognized by both enzymes. For the hrdD gene, p2was preferentially recognized by the stationary phase RNAP whereas p1 was recognized similarly by both enzymes. The quantified data of several sets of autoradiograms including those presented in Figure 1 was summarized in Table 2 . Among 18 promoters observed, eight were preferentially recognized by the exponential phase RNAP, fourwere preferentially recognized by the stationary phase RNAP and six were recognized to similar extent by both enzymes. The preferential recognition pattern was essentially the same when we tested different RNAP preparation from independently grown cultures on actIII, dagA and rrnD promoters.

Examination of growth-coupled changes in core RNAP

In order to find the structural basis for the observed differences in promoter selectivities, we examined the chromatographic behaviors and subunit compositions of the RNAPs prepared from the exponential and the stationary phase. In E.coli,upon transition from exponential to stationary growth phase, RNAP has been found to convert into different forms which could be separated by phosphocellulose column chromatography (14 ,32 ). They suggested that the change is due to association of poly- or oligo-phosphates with core subunits (Kusano,S. and Ishihama,A., in preparation). The altered stationary phase forms of RNAP manifested different promoter recognition properties from the exponential phase RNAP. In contrast to E.coli, S.coelicolor RNAPs were eluted as a single, broad peak from the phosphocellulose column. The conductivity measurement of the peak fractions revealed that the RNAPs from both phases were eluted at the same salt concentration (data not shown). Thus both S.coelicolor RNAPs seem to have similar net charge. Two dimensional SDS-PAGE analysis of both enzymes also showed no difference in the migration pattern of core subunits, suggesting no change in the molecular weight and net charge of each subunit. Therefore, it seems most likely that the two RNAP preparations differ not in core enzyme subunits but in the associated specificity factor.

Identification of the RNAP-associated specificity factors

We next set out to find the specificity factors associated with the RNAP from two growth phases of S.coelicolor. RNAP from exponentially growing cells was partially purified through heparin-Sepharose column. In order to identify [sigma] factors, the associated proteins were separated on SDS-PAGE, eluted from gel slices, renatured and mixed with the core enzyme to test the activity of promoter-directed transcription. Such holoenzyme reconstitution experiments have been successfully employed to identify [sigma] factors in several bacterial systems. Successful renaturation of the denatured [sigma]hrdB in the presence of chaperonin, GroEL, has been reported (3 ).

Core enzyme was obtained from highly-purified RNAP preparations following Mono Q column chromatography as previously described (10 ). The trailing fractions of the peak having high non-specific RNA synthesizing activity but little promoter-specific activity were taken as core enzyme. For isolation of [sigma] factors, the partially-purified RNAP sample was run on SDS-8% PAGE and proteins 20-70 kDa in size were eluted from gel slices and renatured as described in Materials and Methods. Figure 2 A demonstrates SDS-PAGE pattern, in which the positions of core subunits and of some known sigma factors predicted from their observed molecular weights are marked within the corresponding gel slices. The eluted proteins were renatured and mixed with the highly purified core enzyme for run-off transcription assay with various promoters. The results are shown in Figure 2 B. The core enzyme alone was inactive in transcription of all the test promoters, but regained the activity upon the addition of gel eluates. Only a subset of the transcripts observed in Figure 1 were detected with the reconstituted enzymes, suggesting that some as yet unidentified factors were not recovered from the gel or not renatured under the condition employed.AB


Figure 2.Reconstitution of the holoenzyme and promoter recognition analysis. (A) SDS-PAGE of RNAP used in holoenzyme reconstitution experiments. An aliquot of 10 [mu]g of heparin Sepharose CL-6B column fraction (lane H) was electrophoresed on 8% polyacrylamide gel containing 0.1% SDS and visualized by staining with Coomassie brilliant blue. The location of four known [sigma] factors within each slices as judged from their apparent molecular weights were indicated along with molecular weight markers (lane M: [beta]-galactosidase, 116.3 kDa; phosphorylase b, 97.4 kDa; BSA, 66.2 kDa, ovalbumin, 45.0 kDa; carbonic anhydrase, 31.0 kDa). (B) Proteins eluted from gel slices indicated in (A) were renatured in the presence of GroEL, mixed with core RNAP preparation and used for in vitro transcription assays as described in Materials and Methods. The lane numbers correspond to the gel slices from which proteins were eluted. Run-off transcripts were also generated by holoenzyme fraction (lane H), core RNAP fraction (lane C) and core plus pooled fractions eluted from all slices (lane all).

Fraction 1 is most likely to contain [sigma]hrdB ([sigma]66),since it recognizes the dagAp4promoter as previously described (3 ). Western blot analysis using antibody against [sigma]hrdB indeed demonstrated the presence of [sigma]hrdB protein in this fraction (data not shown). The rrnDp2promoter was also recognized by a factor in fraction 1. Since rrnDp2has high sequence similarity with E.coli E[sigma]70 consensus promoters, it is reasonable to predict that it is recognized by [sigma]hrdB. The reconstituted holoenzyme using a purified [sigma]hrdB preparation recognized the rrnDp2promoter as predicted (data not shown). Fraction 3 ismost likely to contain [sigma]52, judged from its molecular weight and the ability of specific transcription from the dagAp3promoter in agreement with the previous report (10 ). Fraction 3also allowed transcription from the actIIIpx1promoter, but this activity was also detected to less extent with fraction 4. Although there is also some overlap between fractions 3and 4 with the factor recognizing whiBp2promoter, fraction 4 is enriched for this activity. The fraction 4 may contain [sigma]hrdD judged from its observed molecular weight. Fractions 8-11 contained the activity which recognized actIIIpx2, dagAp2, hrdDp1, p2 and whiBp1promoters. A known sigma factor [sigma]sigE ([sigma]28) is predicted to exist within these fractions.

Table 3 . Recognition of specific promoters by each specificity factor and its growth-related activity
Apparent molecular weight(kDa) Identification

Promoters recognized

Growth phase with higher activity
66 HrdB([sigma]66) dagAp4, rrnDp2 exponential phase
52 [sigma]52 dagAp3, actIIIpx1 stationary phase
46 HrdD actIII-orf4p, whiBp2 exponential phase
31

[sigma]31

actIIIpx2, glnRp2, hrdDp2 stationary phase

28

SigE([sigma]28)

dagAp2, hrdDp1, whiBp1 both phases

In order to achieve finer resolution of factors, we prepared gel slices from a better separated gel for polypeptides in 45-66 and 27-33 kDa size range. The clear separation of factors within 45-66 kDa range was manifested in Figure 3 (fractions 1-4 in Fig. 2 were separated into fractions 1-7 in Fig. 3). Fraction 4 which is most likely to contain [sigma]52 recognized both dagAp3and actIIIpx1.Fraction 7 which is most likely to contain [sigma]hrdD ([sigma]46) recognized whiBp2in addition to actII-orf4pas previously reported (7 ). The whiBp2and actII-orf4ppromoters were also recognized weakly by a protein(s) in fraction 1 where [sigma]hrdB ([sigma]66)exists. This is consistent with the previous observation that [sigma]hrdB and [sigma]hrdD cross-recognized the actII-orf4ppromoter (7 ).


Figure 3.Resolution of specificity factors from 45 to 66 kDa range; separation of [sigma]hrdB,[sigma]52and [sigma]hrdD. RNAP (~100 [mu]g) in heparin Sepharose CL-6B column fractions were subjected to 0.1% SDS-6.5% polyacrylamide gel electrophoresis. The region containing proteins between 45 and 66 kDa was cut into seven slices. Proteins from each slice were eluted, renatured, mixed with RNAP preparation and used for in vitro transcription assay.

Better separation of proteins in 27-33 kDa size range resolved fractions recognizing different sets of promoters (Fig. 4 ). Fractions 8-11 in Figure 2 were separated into fractions 1-7 in Figure 4 . Fraction 6 contained the activity recognizing dagAp2, hrdDp1and whiBp1promoters. It is most likely that [sigma]sigE ([sigma]28) is included within this fraction judging from the observed molecular weight and the specific recognition of dagAp2as previously observed (10 ). Fraction 2 contained the activity to transcribe actIIIpx2, glnRp2and hrdDp2. From the mean molecular weight of proteins in this fraction we named this factor as 31 kDa specificity factor or putative [sigma]31.Fraction 3 contains a factor which also enables the specific recognition of hrdDp2. Whether this is an activator for holoenzyme or another specificity factor recognizing hrdDp2requires further investigation. The promoters specifically recognized by each sigma factor are summarized in Table 3 .


Figure 4. Resolution of specificity factors from 27 and 33 kDa range; separation of putative sigma factor [sigma]31 and [sigma]sigE. RNAP (~100 [mu]g) in heparin Sepharose CL-6B column fractions were subjected to 0.1% SDS-10% polyacrylamide gel electrophoresis. The region containing proteins between 27 and 33 kDa was cut into seven slices. Proteins from each slice were eluted, renatured, mixed with core RNAP preparation and used for in vitro transcription assays.

Growth-related variation in the relative activity level of various sigma factors

After comparison of the selective recognition of each promoter by each of the two partially purified holoenzyme preparations from two growth phases (Fig. 1 ; Table 2 )or each of the reconstituted holoenzymes (Figs 2 -4 ), we discovered that a good correlation exists between the growth phase-related activity of promoters and the selective recognition properties of promoters by different [sigma] factors (Table 3 ). [sigma]52and the putative [sigma]31 only recognized those `stationary' promoters, suggesting that E[sigma]52 and E[sigma]31 are more abundant (or active) in the stationary than in the exponential phase. The promoters recognized by [sigma]sigE were all transcribed to similar extent by RNAPs from both phases. Therefore the relative activity of E[sigma]sigE is likely to be similar in both phases. E[sigma]hrdB and E[sigma]hrdD recognized promoters that are preferentially transcribed by the exponential RNAP in vitro. Therefore, it is reasonable to predict that E[sigma]hrdB and E[sigma]hrdD may be relatively more abundant (active) in the exponential phase.

lsolation of 31 kDa protein and reconstitution of E[sigma]31 holoenzyme

Since the putative [sigma]31 is predicted to be more abundant in the stationary phase, we purified RNAP holoenzyme from the stationary phase mycelial cells. The RNAP activity measured by non-specific assay was eluted as a single broad peak from the heparin-Sepharose column. The RNAP containing [sigma]hrdB as detected by dagAp4-dependent transcription is more enriched in the leading fractions of the peak (lower salt eluate) whereas the RNAP with hrdDp2-transcribing ([sigma]31) activity is more enriched in the trailing fractions. We therefore applied the higher salt eluates to further purification steps through Superdex HR 200 and Mono-Q anion exchange column chromatographies as described above. Figure 5 A demonstrates the SDS-PAGE pattern of each step of enzyme preparation. Upon further purification, we could detect the stained band of putative [sigma]31 as well as [sigma]28 protein. We determined the N-terminal peptide sequences of both 31 and 28 kDa bands. The 28kDa protein contained a sequence of GEVLXXEEYV which matches well with the S.coelicolor SigE peptide (11 ), confirming that the 28kDa protein is indeed [sigma]sigE. The N-terminal peptide sequence of 31 kDa protein was determined to be XGTDAGTEHGQAEQPEGRGTXA, which did not match with any known sequence.AB


Figure 5.Purification of E[sigma]31 and E[sigma]28 (E[sigma]sigE) holoenzymes. (A) 0.1% SDS-13% PAGE pattern of RNAP preparation at each step of purification. Specific transcription activities of E[sigma]31 and E[sigma]28 holoenzymes were monitored by run-off transcription assays using hrdD promoters. The eluate from heparin Sepharose CL-6B column (lane HEP) enriched with E[sigma]31 and E[sigma]28 holoenzyme activities were further purified through Superdex HR-200 (lane GPC) and Mono-Q column chromatographies. The peak holoenzyme acivity was eluted from Mono-Q column at 0.4 M NaCl (lane MQ-H) and was followed by core RNAP fractions (lane MQ-C). The positions of RNAP subunits are indicated along with molecular weight markers (lane M; 21.5, 31.0, 45.0, 66.2, 97.4, 116.3, 200 kDa). (B) Transcripts were generated from the hrdD promoters by purified holoenzyme containing both [sigma]31 and [sigma]28(lane E[sigma]), core RNAP (lane E), core plus renatured [sigma]31 (lane E[sigma]31) and core plus renatured [sigma]28 (lane E[sigma]28).

The promoter-specific recognition was tested for 31 kDa protein by recombining it with the core enzyme and using hrdD promoters. Figure 5 B demonstrates the specific recognition of hrdD promoters by the reconstituted holoenzymes with either [sigma]31or [sigma]28(E[sigma]31 or E[sigma]28). The reconstituted E[sigma]31 recognized hrdDp2promoter specifically. It also transcribed actIIIpx2and glnRp2promoters as observed in Figure 4 (data not shown). On the other hand, E[sigma]28 recognized hrdDp1promoter specifically. These results confirm that the 31 kDa protein confers the core RNAP the promoter recognition activity and thus should be classified as a novel sigma factor.

Sequences of promoters recognized by each sigma factor

The promoters examined in this study were classified according to their cognate sigmas and compared with respect to the nucleotide sequences. Figure 6 represents the comparison of promoter sequences within each group, including those of known promoters whose recognition by each sigma factor was previously verified. The consensus sequences of promoters recognized by E[sigma]hrdB,E[sigma]hrdD,E[sigma]sigE and E[sigma]31 have been proposed. When the whiBp2promoter was compared with two other promoters known to be recognized by [sigma]hrdD (7 ), the -10 and -35 regions were quite similar. The comparison of three promoters recognized by E[sigma]hrdD demonstrated that the plausible consensus sequence is tTGAcN-N17-18-tatNaT which is more degenerate than E[sigma]hrdB recognition sequence, TTGaCA-N17-18-TAgaaT. Conservation of amino acids in the promoter binding regions of [sigma]hrdB and [sigma]hrdD suggest that they may recognize similar DNA sequences (2 ). The promoter sequences of hrdDp1and whiBp1matches well with dagAp2known to be recognized by [sigma]sigE. All these promoters contain Gg/cAAC at -35 region and TC dimer at -10 region with 19 nucleotides spacing. This is consistent with the consensus promoter sequences for [sigma]sigE predicted from the computer matches (33 ). Some common sequences found among promoters recognized by [sigma]52or [sigma]31are also presented in Figure 6 . Promoters recognized by E[sigma]31 contained GGgcag sequences in -35 region and Gttgc in -10 region with 17-18 nucleotides spacing. The significance of these sequence matches need further investigation.


Figure 6.Comparison of nucleotide sequences of the promoters recognized by each sigma factor in vitro. The promoters were classified according to their cognate sigma factors and compared within each group including previously identified promoters. Transcription start site determined from in vivo or in vitro transcripts (actIIIpx1and px2) are indicated by bold italic letters. The conserved sequences were shown in boldface and the putative -10 and -35 regions were underlined. Probable promoter elements were suggested.

DISCUSSION

We monitored the changes in promoter selectivity of RNAP at two growth phases using in vitro transcription assay on various promoters. The difference in promoter selection by partially purified holoenzyme from two growth phases reflects the difference in the distribution of sigma factors within the holoenzyme preparation. The abundance of a particular holoenzyme is primarily determined by the availability of its own sigma factor. However, depending on the concentration and the binding affinity of other competing sigma factors, the relative abundance is bound to change significantly. Our data predicts that E[sigma]hrdB and E[sigma]hrdD become less abundant whereas E[sigma]52 and E[sigma]31 become more abundant in the whole holoenzyme population at the stationary phase than at the exponential phase. As for E[sigma]hrdB a preliminary result suggests that its decrease in the stationary phase is not due to the decrease in the intracellular concentration of [sigma]hrdB judging from the relatively constant level of [sigma]hrdB by immunoblotting (data not shown). In B.subtilis, the level of major sigma factor [sigma]A maintained at a constant level throughout vegetatively growing or sporulating cells (34 ),whereas the level of purifiable E[sigma]A decreases as the cells proceed into sporulation (35 ). Putative inhibitor of [sigma]A at the late sporulation stage has been suggested to regulate the level of functional E[sigma]A holoenzyme (36 ). In E.coli,the level of the major sigma factor [sigma]70(rpoD)stays constant at the same level at all growth phases. However, the level of [sigma]38 increases significantly at the stationary phase and thereby reduces the relative level of E[sigma]70 holoenzyme (13 ). In this respect, it is likely that the decrease in E[sigma]hrdB in the stationary S.coelicolor cells may be due to the reduced relative abundance by competition or the reduced activity of [sigma]hrdB.

The observation of growth-related selectivity in vitro iscorrelated with the observation in vivo for several promoters. For example, the promoters known to be highly expressed in the exponentially growing cells in vivo were transcribed predominantly by the RNAP isolated from the exponential phase. These include rRNA promoters (rrnDp3, p4)and a sporulation gene promoter (whiBp2) (37 ,38 ). rrnDp3and p4are the strong promoters of the rrnD gene contributing >90% of its transcripts in rapidly growing cells. Following nutritional shift-down, transcription initiation decreases dramatically at all rrnD promoters (37 ). In vitro transcription pattern of rrnDp3and p4 isconsistent with the in vivo observation. On the other hand the efficient transcription of rrnDp2 in vitro and its relatively constitutive expression is different from its expression pattern in vivo. Transcription in vivo from whiBp2isknown to increase when aerial mycelial growth begins on surface culture, whereas the level of p1 transcript exhibits no obvious correlation with the developmental stage. In liquid culture, however, the level of p2 transcript is high especially during the exponential growth, whereas the level of p1 transcript is low and varies little with growth phase (38 ). The transcription of whiBp2 in vitro is consistent with the observation in vivo for liquid culture.

Promoter specificities of RNAP defined in vitro, however, may not directly reflect in vivo expression of the promoter. There are several examples where the in vitro promoter recognition pattern is not verified in vivo. [sigma]hrdD recognizes actII-orf4pand redDppromoters in vitro, whereas hrdD null mutants do not affect biosynthesis of actinorhodin and undecylprodigiosin (red antibiotics) (6 ,7 ). Similarly, [sigma]sigE recognizes phsA promoter in S.antibioticus in vitro, but sigE disruption does not abolish phsA transcription in vivo (39 ). These discrepancies could by due to either recognition of those promoters by multiple sigma factors in vivo,or the lack of any relationship between in vitro transcription conditions currently employed and the intracellular environment. The presence of transcriptional regulators in vivo could also influence the promoter selectivity of various holoenzymes. In order to resolve these apparent contradictions, further systematic experiments need be pursued both in vitro and in vivo.

Several promoters examined in this study were not transcribed by the reconstituted RNAP, indicating that the cognate specificity factors were not recovered from the gel. In particular, the strong promoters rrnDp3and p4 were not recognized by the reconstituted E[sigma]hrdB. This suggests that an as yet unidentified vegetative holoenzyme(s) other than E[sigma]hrdB partakes their transcription or an additional transcriptional activator(s) is required for E[sigma]hrdB to transcribe those promoters. As an attempt to identify the missing factor(s), we pooled all the renatured polypeptides from total gel slices and performed the reconstitution and transcription. Still we were not able to observe any rrnDp3and p4 transcripts in vitro (data not shown).

Enormously diverse sequences of Streptomycete promoters suggest that there are still large numbers of the cognate [sigma] factors and associated transcription factors remaining to be identified. The discovery of [sigma]31as a novel sigma factor recognizing actIIIpx2, glnRp2and hrdDp2promoters demonstrates that the holoenzyme reconstitution assay is a useful tool to identify those factors in Streptomycetes. By employing wider spectrum of promoters and in vitro transcription conditions it is possible to identify more specificity factors. How these specificity factors function in regulating diverse promoters in vivo and thereby perforrn coordinated gene expression remains a formidable task to challenge.

ACKNOWLEDGEMENTS

We thank Dr N.Fujita for his invaluable help in protein purification, in vitro transcription assay and for detailed advice on this work. Much gratitude is directed to Dr M.J.Bibb for providing glkA, hrdD and whiB promoters; Dr S.-K.Hong for providing actI/III promoters; Dr M.J.Buttner for providing HrdB overexpression construct and helpful comments; Dr K.Tanaka for providing antibody against HrdB; J.-B.Bae for technical assistance. This work was supported partly by a grant from both KOSEF and JSPS for Korea-Japan collaborative research between J.-H.R. and A.I. and a grant from the SRC (Research Center for Molecular Microbiology).

REFERENCES

1 Westpheling,J., Ranes,M. and Losick,R. (1985) Nature 313, 22-27. MEDLINE Abstract

2 Buttner,M.J. (1989) Mol. Microbiol. 3, 1653-1659. MEDLINE Abstract

3 Brown,K.L., Wood,S. and Buttner,M.J. (1992) Mol. Microbiol. 6,1133-1139.

4 Tanaka,K., Shiina,T. and Takahashi,H. (1988) Science 242, 1040-1042. MEDLINE Abstract

5 Tanaka,K., Shiina,T. and Takahashi,H. (1991) Mol. Gen. Genet. 229, 334-340. MEDLINE Abstract

6 Buttner,M.J. and Lewis,C.G. (1992) J. Bacteriol. 174, 5165-5167.

7 Fujii,T., Gramajo,H.C., Takano,E. and Bibb,M.J. (1996) J. Bacteriol. 178, 3402-3405.

8 Chater,K.F., Brian,P., Brown,G.L., Plaskitt,K.A., Buttner,M.J., Mendez,C. and Helmann,J.D. (1989) Cell 59,133-143.

9 Potúcková,L., Kelemen,G.H., Findlay,K.C., Lonetto,M.A., Buttner,M.J. and Kormanec,J. (1995) Mol. Microbiol., 17, 37-48.

10 Buttner,M.J., Smith,A.M. and Bibb,M.J. (1988) Cell 52, 599-607. MEDLINE Abstract

11 Lonetto,M.A., Brown,K.L., Rudd,K.E. and Buttner,M.J. (1994) Proc. Natl. Acad. Sci. USA 91, 7573-7577. MEDLINE Abstract

12 Hengge-Aronis,R. (1993) Cell 72, 165-168. MEDLINE Abstract

13 Jishage,M. and Ishihama,A. (1995) J. Bacteriol. 175, 6832-6835.

14 Ozaki,M., Wada,N., Fujita,N. and Ishihama,A. (1991) Mol. Gen. Genet. 230, 17-23. MEDLINE Abstract

15 Strohl,W.R. (1992) Nucleic Acids Res. 20, 961-974. MEDLINE Abstract

16 Hopwood,D.A., Bibb,M.J., Chater,K.F., Kieser,T., Bruton,C.J., Kieser,H.M., Lydiate,D.J., Smith,C.P., Ward,J.M. and Schrempf,H. (1985) Genetic Manipulation of Streptomyces: A Laboratory Manual. The John Innes Foundation, Norwich, UK.

17 Hager,D.A., Jin,D.J. and Burgess,R.R. (1990) Biochemistry, 29,7890-7894.

18 Fujita,N., Nomura,T. and Ishihama,A. (1987) J. Biol. Chem. 262,1855-1859.

19 Buttner,M.J. and Brown,N.L. (1985) J. Mol. Biol. 185,177-188.

20 Buttner,M.J., Fearnly,I.M. and Bibb,M.J. (1987) Mol. Gen. Genet. 209,101-109.

21 Baylis,H.A. and Bibb,M.J. (1988) Mol. Microbiol. 2,569-579. MEDLINE Abstract

22 Wray,L.V.,Jr and Fisher,S.H. (1993) Gene 130,145-150. MEDLINE Abstract

23 Fernández-Moreno,M.A., Caballero,J.L., Hopwood,D.A. and Malpartida,F. (1991) Cell 23,769-780.

24 Angell,S., Schwarz,E. and Bibb,M.J. (1992) Mol. Microbiol. 6,2833-2844. MEDLINE Abstract

25 Buttner,M.J., Chater,K.F. and Bibb,M.J. (1990) J. Bacteriol. 172,3367-3378. MEDLINE Abstract

26 Davis,N.K. and Chater,K.F. (1992) Mol. Gen. Genet. 232,351-358. MEDLINE Abstract

27 Hallam,S.E., Malpartida,F. and Hopwood,D.A. (1988) Gene 74,305-320. MEDLINE Abstract

28 Hager,D.A. and Burgess,R.R. (1980) Anal. Biochem. 109, 76-86. MEDLINE Abstract

29 Goloubinoff,P., Gatenby,A.A. and Lorimer,G.H. (1989) Nature 337,44-47. MEDLINE Abstract

30 Chandrasekhar,G.N., Tilly,K., Woolford,C., Hendrix,R. and Georgopoulos,C. (1986) J. Biol. Chem. 261,12414-12419.

31 Parro,V., Hopwood,A., Malpartida,F. and Mellado,R.P. (1991) Nucleic Acids Res. 19,2623-2627. MEDLINE Abstract

32 Ozaki,M., Fujita,N., Wada,A. and Ishihama,A. (1992) Nucleic Acids Res. 20, 257-261. MEDLINE Abstract

33 Bourn,W.R. and Babb,B. (1995) Nucleic Acids Res. 23,3696-3703. MEDLINE Abstract

34 Tjian,R. and Losick,R. (1974) Proc. Natl. Acad. Sci. USA 71,2872-2876. MEDLINE Abstract

35 Haldenwang,W.G., Lang,N. and Losick,R. (1981) Cell 23,615-624. MEDLINE Abstract

36 Haldenwang,W.G (1995) Microbiol. Rev. 59, 1-30. MEDLINE Abstract

37 Strauch,E., Takano,E., Baylis,H.A. and Bibb,M.J. (1991) Mol. Microbiol. 5, 289-298. MEDLINE Abstract

38 Soliveri,J., Brown,K.L., Buttner,M.J. and Chater,K.F. (1992) J. Bacteriol. 174,6215-6220. MEDLINE Abstract

39 Jones,G.H., Paget,M.S.B, Chamberlin,L. and Buttner,M.J. (1997) Mol. Microbiol. 23,169-178. MEDLINE Abstract


*To whom correspondence should be addressed. Tel: +82 2 880 6706; Fax: +82 2 888 4911; Email: jhroe@plaza.snu.ac.kr
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
A. Rodriguez-Garcia, A. Sola-Landa, K. Apel, F. Santos-Beneit, and J. F. Martin
Phosphate control over nitrogen metabolism in Streptomyces coelicolor: direct and indirect negative control of glnR, glnA, glnII and amtB expression by the response regulator PhoP
Nucleic Acids Res., June 1, 2009; 37(10): 3230 - 3242.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
Y.-r. Lin, M.-Y. Hahn, J.-H. Roe, T.-W. Huang, H.-H. Tsai, Y.-F. Lin, T.-S. Su, Y.-J. Chan, and C. W. Chen
Streptomyces Telomeres Contain a Promoter
J. Bacteriol., February 1, 2009; 191(3): 773 - 781.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
S. Yamamoto, Y. He, K. Arakawa, and H. Kinashi
{gamma}-Butyrolactone-Dependent Expression of the Streptomyces Antibiotic Regulatory Protein Gene srrY Plays a Central Role in the Regulatory Cascade Leading to Lankacidin and Lankamycin Production in Streptomyces rochei
J. Bacteriol., February 15, 2008; 190(4): 1308 - 1316.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
S.-Y. Oh, J.-H. Shin, and J.-H. Roe
Dual Role of OhrR as a Repressor and an Activator in Response to Organic Hydroperoxides in Streptomyces coelicolor
J. Bacteriol., September 1, 2007; 189(17): 6284 - 6292.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
G. A. Byrne, D. A. Russell, X. Chen, and W. G. Meijer
Transcriptional Regulation of the virR Operon of the Intracellular Pathogen Rhodococcus equi
J. Bacteriol., July 15, 2007; 189(14): 5082 - 5089.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
M. J. Kazmierczak, M. Wiedmann, and K. J. Boor
Alternative Sigma Factors and Their Roles in Bacterial Virulence
Microbiol. Mol. Biol. Rev., December 1, 2005; 69(4): 527 - 543.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
E.-J. Lee, Y.-H. Cho, H.-S. Kim, B.-E. Ahn, and J.-H. Roe
Regulation of {sigma}B by an Anti- and an Anti-Anti-Sigma Factor in Streptomyces coelicolor in Response to Osmotic Stress
J. Bacteriol., December 15, 2004; 186(24): 8490 - 8498.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
D. A. Russell, G. A. Byrne, E. P. O'Connell, C. A. Boland, and W. G. Meijer
The LysR-Type Transcriptional Regulator VirR Is Required for Expression of the Virulence Gene vapA of Rhodococcus equi ATCC 33701
J. Bacteriol., September 1, 2004; 186(17): 5576 - 5584.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
P. Bralley and G. H. Jones
Organization and Expression of the Polynucleotide Phosphorylase Gene (pnp) of Streptomyces: Processing of pnp Transcripts in Streptomyces antibioticus
J. Bacteriol., May 15, 2004; 186(10): 3160 - 3172.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
J. Kwak, A. J. Dharmatilake, H. Jiang, and K. E. Kendrick
Differential Regulation of ftsZ Transcription during Septation of Streptomyces griseus
J. Bacteriol., September 1, 2001; 183(17): 5092 - 5101.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
J. Kwak, L. A. McCue, K. Trczianka, and K. E. Kendrick
Identification and Characterization of a Developmentally Regulated Protein, EshA, Required for Sporogenic Hyphal Branches in Streptomyces griseus
J. Bacteriol., May 15, 2001; 183(10): 3004 - 3015.
[Abstract] [Full Text]


Home page
MicrobiologyHome page
O. Sprusanský, B. Rezuchová, D. Homerová, and J. Kormanec
Expression of the gap gene encoding glyceraldehyde-3-phosphate dehydrogenase of Streptomyces aureofaciens requires GapR, a member of the AraC/XylS family of transcriptional activators
Microbiology, May 1, 2001; 147(5): 1291 - 1301.
[Abstract] [Full Text]


Home page
J. Bacteriol.Home page
M. S. B. Paget, L. Chamberlin, A. Atrih, S. J. Foster, and M. J. Buttner
Evidence that the Extracytoplasmic Function Sigma Factor sigma E Is Required for Normal Cell Wall Structure in Streptomyces coelicolor A3(2)
J. Bacteriol., January 1, 1999; 181(1): 204 - 211.
[Abstract] [Full Text]


Home page
J. Bacteriol.Home page
E.-J. Kim, H.-J. Chung, B. Suh, Y. C. Hah, and J.-H. Roe
Expression and Regulation of the sodF Gene Encoding Iron- and Zinc-Containing Superoxide Dismutase in Streptomyces coelicolor Muller
J. Bacteriol., April 15, 1998; 180(8): 2014 - 2020.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (201K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (41)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Kang, J. G.
Right arrow Articles by Roe, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kang, J. G.
Right arrow Articles by Roe, J. H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?