Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (82K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (152)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Collins, M. L.
Right arrow Articles by Ho, D. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Collins, M. L.
Right arrow Articles by Ho, D. D.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 1997 Oxford University Press 2979-2984

A branched DNA signal amplification assay for quantification of nucleic acid targets below 100 molecules/ml

A branched DNA signal amplification assay for quantification of nucleic acid targets below 100 molecules/ml Mark L. Collins*, Bruce Irvine, Diana Tyner, Eric Fine, Crystle Zayati, Chu-an Chang, Thomas Horn, David Ahle, Jill Detmer, Lu-Ping Shen, Janice Kolberg, Steve Bushnell, Mickey S. Urdea and David D. Ho1

Chiron Diagnostics, 4560 Horton Street, Emeryville, CA 94608, USA and 1Aaron Diamond AIDS Research Center, 455 First Avenue, New York, NY 10016, USA

Received May 5, 1997; Revised and Accepted June 22, 1997

ABSTRACT

The branched DNA hybridization assay has been improved by the inclusion of the novel nucleotides, isoC and isoG, in the amplification sequences to prevent non-specific hybridization. The novel isoC, isoG-containing amplification sequences have no detectable interaction with any natural DNA sequence. The control of non-specific hybridization in turn permits increased signal amplification. Addition of a 14 site preamplifier was found to increase the signal/noise ratio 8-fold. A set of 74 oligonucleotide probes was designed to the consensus HIV POL sequence. The detection limit of this new HIV branched DNA amplifier assay was ~

50 molecules/ml. The assay was used to measure viral load in 87 plasma samples of HIV- infected patients on triple drug therapy whose RNA titers were <500 molecules/ml. In all 11 patients viral load eventually declined to below the detection limit with the new assay.

INTRODUCTION

Quantitative hybridization assays based on branched DNA signal amplification are widely used to monitor patients on antiviral therapy for human immunodeficiency virus (HIV), hepatitis C (HCV) and hepatitis B (HBV) and to stratify patients for therapy (1 -7 ). They have also been used to predict time to onset of AIDS (8 -10 ) and to establish the kinetics of HIV production and destruction, which has led to new insights into the mechanisms of pathogenesis (11 ,12 ). The most important characteristics of these hybridization assays are sensitivity, wide dynamic range, and precise and accurate quantification. The branched DNA hybridization assay pictured in Figure 1 employs linear signal amplification rather than exponential amplification of target.

A family of oligonucleotides called capture extenders (CEs) is used to capture the target to the solid support. The target is labeled by virtue of binding a large number (typically >30) of target-specific oligonucleotides called label extenders (LEs). In the first generation assay the LE probes bind a branched DNA amplifier (bDNA), which in turn binds many alkaline phosphatase probes. In the second and third generation assays, the LE probes bind preamplifiers, which in turn bind many amplifiers. The result is stronger signal amplification and lower detection limits. In all versions of the assay, the linearly amplified signal is directly related to the number of targets present in the original sample. This first generation bDNA assay has been shown to quantify nucleic acid targets accurately and precisely between ~10 000 and 10 000 000 molecules; assays for HIV, HCV and HBV have been developed (13 -17 ). The second generation HIV bDNA assay has a quantitative detection limit of 500 molecules (18 ).

The recent introduction of HIV protease inhibitors has driven viral loads to below even the detection limits of the second generation HIV bDNA assay (1 ,2 ). The first and second generations of the assay were limited by non-specific hybridization (NSH) between the amplification sequences and other nucleic acids. Short regions of hybridization between any member of the amplification system (alkaline phosphatase probe, amplifier or preamplifier) and any non-target nucleic acid sequence will lead to amplification of background. Capture probes (CPs), CEs and sample nucleic acids are all sources of this background hybridization. The purpose of this study was to examine the effect of redesigning the amplification molecules by incorporation of the non-natural bases, isocytidine and isoguanosine, to reduce their hybridization potential to all non-target nucleic acids. If target-specific signal amplification is accomplished without a concomitant amplification of the background from non-target molecules, then sensitivity should be greatly improved.

MATERIALS AND METHODS

Clinical specimens

Blood was collected in EDTA tubes. Plasma was prepared and stored at -80oC until use and virus was concentrated by centrifugation as described (18 ).

Oligonucleotide probe design

A consensus HIV POL sequence was generated from the GenBank database using sequences from six subtypes, A-F, and sectioned into 26 nucleotide (nt) fragments, resulting in an average dissociation temperature (Td) of 72oC. This created 110 possible oligonucleotide probes. A computer program (S.Bushnell et al., in preparation) was used to calculate degeneracy, equilibrium melting temperature (Tm) and dissociation temperature for each oligonucleotide. An initial probe set was selected based on the following criteria: Tm > 63oC, Td > 63oC, and degeneracy less than four sites. The program then calculates the homology between the initial probe set and the amplification sequences. It selects probes with the lowest homology (below a user-defined cutoff) to the amplification sequences to be CEs. Finally, probes with the lowest homology to the CP and the CEs are then selected to be LEs. The resulting probe set consisted of 54 LE and 20 CE probes.

Universal sequence design


Figure 1. Basic bDNA assay components. (A) First generation assay; (B) second and third generation assays. The preamplifier (heavy lines) is unique to the second and third generation assays.

Sequences for the preamplifier, amplifier and alkaline phosphatase probe were redesigned to contain ~30% isobases [5-methyl-2'- deoxyisocytidine (isoC) and 5-methyl-2'-deoxyisoguanosine (isoG)]. The sequences were designed to have no secondary structure longer than a trimer, no interactions with any sequence longer than a trimer except with their complements, and to have a melting temperature in excess of 80oC at 1 nM in 3* SSC. The sequences chosen are listed in Table 1 .

Oligonucleotide target design

To measure the improvement in sensitivity with each layer of amplification in the bDNA assay, oligonucleotide targets were designed to hybridize to the CP on the microtiter well and serve as targets for the amplification system. The sequences are listed in Table 2 .

Preamplifier synthesis

Eight oligonucleotides were enzymatically ligated essentially as described (18 ) to produce a molecule with 14 repeat sequences and one leader sequence.

Amplifier synthesis

A 15*2 branched DNA was constructed essentially as described (19 ). An arm consisting of two copies of the amplifier repeat was ligated onto a comb containing one copy of the amplifier leader sequence.

Alkaline phosphatase probe

An alkaline phosphatase probe was prepared essentially as described (20 ).

Table 1 Sequences used in the system 8 bDNA amplification assay, which is pictured in Figure 1
Function (copies) Sequence Complement
LE tail (1) d(JTATJCGCJCTGFTATJCCG) Preamplifier leader (1)
Preamplifier repeat (14) d(TCFACGJCFCTAJGGAFAAFG) Amplifier leader (1)
Amplifier repeat (30) d(AGTFAJCGCFGTAFCAAJTJC) Alkaline phosphatase probe (1)
The sequences labeled `leader' appear once in the indicated construct, while sequences labeled `repeat' appear the indicated number of times. The tail on the LE is a single sequence. F, isoC; J, isoG.

Table 2 . Oligonucleotide target sequences
Oligonucleotide Sequence Complement
1 d(AGTFAJCGCFGTAFCAAJTJCQCTCTTGGAAAGAAAGTGAAGTGT) Alkaline phosphatase probe
2 d(TCFACGJCFCTAJGGAFAAFGQCTCTTGGAAAGAAAGTGAAGTGT) Amplifier
3 d(JTATJCGCJCTGFTATJCCGQCTCTTGGAAAGAAAGTGAAGTGT) Preamplifier
All three oligonucleotides possess the same 23 nt 3' terminal sequence that allows them to hybridize to the CP on the microtiter wells. Oligonucleotide 1 is detected by direct hybridization with the alkaline phosphatase probe; oligonucleotide 2 is detected by hybridization with the bDNA amplifier, which hybridizes to the alkaline phosphatase probe; oligonucleotide 3 is detected by hybridization with the preamplifier, which hybridizes to the amplifier, which hybridizes to the alkaline phosphatase probe. F, isoC; J, isoG; Q, triethyleneglycol spacer.

Capture wells

Polystyrene capture wells were prepared essentially as described (21 ).

bDNA diluents

Capture diluent. 127 mM LiCl, 5% lithium lauroyl sulfate, 9 mM EDTA, 50 mM HEPES (pH 7.5), 0.05% hespan (DuPont Pharmaceuticals), 0.05% ProClin 300 (Supelco), 0.2% casein (Research Organics, Hammarsten quality). Amplifier diluent.Prepared by incubating 50% horse serum with 0.5 mg/ml proteinase K in 5* SSC, 1.3% SDS, 6 mM Tris-HCl at 65oC for 2 h and then adding 6 mM phenylmethylsulfonyl fluoride, 0.05% sodium azide, 0.05% ProClin 300 and 10% dextran sulfate (500 000 MW; Pharmacia). Alkaline phosphatase diluent. Prepared by adding 17 mM MgCl2, 0.85 mM ZnCl2, and 0.85% Brij 35 to amplifier diluent without dextran sulfate.

System 8 bDNA assay procedure

System 8 is a detection system employing isoC and isoG in the preamplifier, amplifier and alkaline phosphatase probe. Viral pellets were resuspended in capture diluent and solubilized at 63oC for 2 h prior to overnight incubation at 45oC in capture wells. Three serial incubations were done at 45oC with no cool down between steps: preamplifier (5 fmol/50 [mu]l in amplifier diluent) for 30 min, amplifier (5 fmol/50 [mu]l in amplifier diluent) for 30 min, and ap probe (10 fmol/50 [mu]l in alkaline phosphatase diluent) for 15 min. After each incubation step, the wells were washed twice with wash A (18 ). An additional three washes with wash D (18 ) were done after the alkaline phosphatase step, prior to incubation with substrate (18 ) in the Chiron luminometer. After 30 min at 37oC the luminescence was measured in relative light units (RLU).

Calculation of detection limit

Let D = detection limit, T = Target level, ST = signal at T, and N = assay noise. Detection limit is defined as the target level at which [Delta] = 0. The [Delta] function is defined by:

[Delta] = (S - 2)(CVs * S) - (N - 2)(CVn * N)

where CV is the coefficient of variation, CVs * S = [sigma]s = standard deviation of S, and CVn * N = [sigma]n = standard deviation of N.

Let Sd = signal at the detection limit, then

Sd = [N(1 + 2Cvn)]/(1 - 2CVs)

At the detection limit, CVs ~ CVn ~ CVassay, the average CV of the entire assay. This is true because assays to measure detection limit use points clustered about the detection limit (i.e., all target levels are close to the detection limit). Thus Sd ~ [N(1 + 2CVassay)]/ (1 - 2CVassay). At any point along the S - N curve versus T, one can estimate D as approximately equal to T(Sd - N)/(ST - N). The detection limit is estimated for each target level. An average and standard deviation of the detection limit estimated at three or more target levels are then calculated. Linearity, L, was estimated at two or more target levels, T1 and T2, as

L = 100% * [(S1 - N)/(S2 - N)]/(T1/T2).

A perfectly linear dose-response curve = 100% linearity.

RESULTS

Control of non-specific hybridization by redesign of the amplification sequences with isoC and isoG

To improve the sensitivity of the bDNA assay, while maintaining the precision and accuracy of quantification and the wide dynamic range, all of the amplification sequences were redesigned. In the new design, termed `system 8 bDNA', approximately every fourth nucleotide of the preamplifier, amplifier and alkaline phosphatase probe is either isoC or isoG (Table 1 ), which attenuates the hybridization of these molecules to natural sequences (22 ,23 ). IsoC and isoG base pair with each other, but not with any of the four natural bases (24 ). Sequences containing isoC-isoG base pairs are ~2oC more stable per base pair than their C-G congeners (24 ).

To test the ability of amplification sequences containing isoC and isoG to control NSH, 100 fmol of 12 CEs [to hepatitis G virus (HGV) RNA] were bound individually to microwells and incubated with natural sequence amplifier and alkaline phosphatase probe or system 8 (isoC and isoG) amplifier and alkaline phosphatase probe. Binding was measured by dioxetane chemiluminescence (25 ,26 ) RLU. The results are shown in Table 3 .

The RLU of the no CE control, which represents assay NSB (non-specific binding), was subtracted from the RLU of individual CE probes to highlight sequence-specific binding. The NSB of the natural sequence amplifier and alkaline phosphatase probe was 10.9 RLU and the NSB of the isoC, isoG amplifier and alkaline phosphatase probe was 3.0 RLU. NSH Background < 5 RLU is not significant in view of the natural sequence NSB value. The natural sequence amplifier showed sequence-specific background with seven of the 12 oligonucleotide probes, ranging from 1200 to 12 RLU. The 1200 RLU background of probe HGV.225 is the highest ever observed. Computer modeling of the background with this probe suggests that the amplifier repeat sequence forms two 5mer hybrids with the CE separated by a 5 nt bulge. The background is most likely caused by the binding of multiple amplifier repeat sequences to multiple CE probes on the well surface (polyvalent binding).

Table 3 Control of NSH with amplifier sequences containing isoC and isoG
Capture extender

Natural sequence: NSH
(RLU)
IsoC,isoG: NSH
(RLU)
HGV.225 1227 0
HGV.247 117 0
HGV.181 90 0
HGV.115 36 0
HGV.159 33 0
HGV.27 14 1
HGV.71 12 0
HGV.93 5 0
HGV.5 3 0
HGV.137 2 0
HGV.203 2 0
HGV.269 -2 0
Control (no CE probe) 0 0
The indicated CE probe (100 fmol) was bound to microwells and incubated with either natural sequence amplifier and alkaline phosphatase probe or the isoC,isoG amplifier and isoC,isoG alkaline phosphatase probe. Hybrids were quantified by dioxetane chemiluminescence in RLU. The value of the no CE probe control, which represents NSB was subtracted from the total noise to yield the NSH of each CE probe.

Table 4 . Improvement of the signal/noise ratio by employing multiple layers of amplification in the system 8 bDNA assay
Amplification molecules Signal (RLU) Noise (RLU) Signal/Noise
Alkaline phosphatase probe only 2.6 0.4 5.5
Amplifier and alkaline phosphatase probe 10.3 0.5 19.6
Preamplifier, amplifier and alkaline phosphatase probe 93.2

0.6

154.3

Oligonucleotide targets (5 attomol), listed in Table 2, complementary to either the alkaline phosphatase probe, the amplifier or the preamplifier were hybridized to the CP on microtiter wells. The oligonucleotide targets were detected with the indicated amplification molecules and the hybridization signal measured by dioxetane chemiluminescence in RLU.
Noise = RLU associated with no oligonucleotide target.

The system 8 amplifier and alkaline phosphatase probe showed no background (<2 RLU) with any of the 12 CE probes. The absence of NSH to system 8 amplifier and alkaline phosphatase probe was also observed for 30 CE probes designed to five different cytokine mRNAs; the natural amplifier again showed sequence-specific variation of background, ranging from 35 to 0 RLU (data not shown).

Sensitivity improves with each additional layer of amplification

Control over NSH with isoC and isoG (system 8 amplification) should in principle allow the use of larger preamplifiers and larger amplifiers or the use of multiple layers of amplification to improve sensitivity since signal can be augmented without equal amplification of noise. To test this concept, 5 attomol of three different isoC, isoG oligonucleotide targets (Table 2 ) were hybridized to the CP on microtiter wells. Target number 1 was detected by hybridization with the alkaline phosphatase probe; target number 2 was detected by hybridization with the amplifier, followed by the alkaline phosphatase probe; target number 3 was detected by hybridization with the preamplifier, followed by the amplifier, followed by the alkaline phosphatase probe. The sensitivity was determined by dioxetane chemiluminescence. The results are shown in Table 4 .

Detection of 5 attomol of oligonucleotide target with alkaline phosphatase probe had an S/N of 5.5; a two-layered amplification had an S/N of 19.6; a three-layered amplification had an S/N of 154.3. By extension, it is likely that a four layered system will increase the sensitivity of the three-layered system. A 30 site bDNA amplifier improved sensitivity another 1.4-fold (data not shown) as compared to the 15 site bDNA amplifier used in this experiment.

Detection of 60 molecules of HIV RNA with system 8 bDNA assay

To test the performance of system 8 detection of an RNA target, the HIV POL RNA sequence was chosen.

An HIV RNA standard curve was prepared by serial dilution of virus in negative human plasma and was titered against an HIV POL RNA standard quantified by phosphate analysis and confirmed by OD260 and hyperchromicity (27 ). The samples were hybridized overnight in quadruplicate to the oligonucleotide probes in microtiter wells. The captured RNA was detected by dioxetane chemiluminescence following system 8 amplification. The results are shown in Table 5 .

Table 5 System 8 bDNA HIV RNA molecular detection limit
Experiment no.

HIV RNA
(molecules)
Signal
(RLU)
Linearity
(%)
Detection limit
(molecules)
1 1440 7.2 97 91
  720 4.5 91 88
  360 3.2 100 80
  180 2.4   80
  0 1.6   85 +- 6 (average)
2 3200 20.3 101 45
  320 3.1 119 45
  160 2.0   53
  0 1.2   48 +- 5 (average)
3 400 5.5 82 55
  200 4.2 66 45
  50 2.9   29
  0 2.1   43 +- 13 (average)
In three independent experiments, serial dilutions of HIV (prepared from frozen plasma and quantified against the standard RNA transcript) were incubated overnight in microwells with 20 CE and 54 LE oligonucleotides and the signal was amplified with the system 8 preamplifier, amplifier and alkaline phosphatase probes. Dioxetane chemiluminescence was measured in RLU.
Noise = no HIV (negative human plasma). Linearity (dose-response) and Detection limit are defined in Materials and Methods. Signals are the average of four determinations.

The three assays each have ~5% CV. The linearity and detection limit were calculated as described in Materials and Methods for each target level T.

The average detection limit of the three experiments is 59 +- 23 molecules: the percent CV of the detection limits reflect the dose-response. The better the linearity of S - N versus T, the lower the percent CV of the detection limit. A perfectly linear dose-response = 100% linearity. The curves thus show precise quantification down to the limit of 60 molecules/ml.


Figure 2. Quantification of HIV RNA/ml in 11 patients over time. Plasma was collected from the patients at the indicated time intervals and stored at -80oC in David Ho's laboratory. Duplicate 1 ml samples were concentrated by centrifugation and system 8 bDNA assays were run at Chiron. Serial dilutions of virus (quantified against standard HIV POL RNA) were used as a standard curve, which was run in quadruplicate. Each point shown on the graph is a single determination.

Utility of system 8 bDNA assay in monitoring HIV-infected patients on triple drug therapy

The system 8 bDNA assay was used to measure viral load in 87 samples from HIV-infected patients on various therapy regimens, including triple drug therapy consisting of Nelfinavir, AZT and 3TC. Figure 2 summarizes the results of this study.

The viral load of the 11 patients showed a nearly monotonic decline to below the assay detection limit during the treatment. A total of 47 samples (54%) quantified above the detection limit and 78 samples (90%) quantified above zero. Only the development of a still more sensitive assay will be able to validate the positivity of the 31 samples quantifying between 0 and the detection limit. In spite of the fact that the average sample contained ~130 virions/ml, the average CV (of the RLU) of the duplicate samples was only 14%.

The HIV 2.0 bDNA assay was previously performed on these samples, all of which were below the detection limit of 500 molecules/ml. This is in good agreement with the current study in which 76 out of 87 samples quantified <500 molecules/ml and 10 out of 11 quantified between 500 and 1000 molecules/ml.

DISCUSSION

A more sensitive branched DNA assay has been developed to quantify nucleic acid targets <100 molecules/ml. This system 8 bDNA assay employs isoC and isoG nucleotides in the amplification molecules to reduce backgrounds and allow for stronger amplification. System 8 amplification was used to show that triple therapy is at least eight times more effective (<60 molecules/ml) than determined using the previous version of the branched DNA assay (<500 molecules/ml). If 10 ml samples were concentrated before the assay, the assay could theoretically detect ~6 HIV RNA/ml or 3 virions/ml.

In theory the system 8 bDNA assay can be made considerably more sensitive not only by increasing volume, but also by increasing the S/N ratio. Most of the background is coming from LE NSB and amplifier NSB (data not shown). By using cruciform LEs, a design in which two LE probes must bind the target in the correct orientation to bridge the preamplifier, most of the LE NSB can in theory be removed (18 ). By finding more effective blockers for the solid phase or by redesigning the branched DNA molecule or the solid phase itself, much of the amplifier's NSB can be removed. Alternatively, by using sequences of reduced complexity (such as trinucleotide repeats), lower concentrations of the amplification molecules can be used during hybridization, resulting in reduced NSB. Additional layers of amplification can also be added.

A prototype system 8 bDNA assay has also been developed to quantify HCV RNA in plasma. A total of 12 2'-O-methyl probes (eight LE and four CE) were designed to the well-conserved 5' untranslated region of the genome. The assay has a detection limit of 200 molecules (unpublished data), which is ~50-fold better than the HCV 2.0 QuantiplexTM assay (15 ).

The system 8 bDNA assay should also be useful in other hybridization assays. In both filter and in situ hybridization assays, for example, billions of overlapping, unique oligonucleotide sequences are available for possible NSH to probes. The ability to amplify the signal without amplifying noise from hybridization of amplification molecules to sample nucleic acid sequences should greatly improve the sensitivity of these assays. Currently, in situ PCR is the standard for detection of single copy DNA sequences in cells (28 ,29 ); in situ RT-PCR has occasionally been problematic for mRNA detection (30 -33 ). RNA targets that are partially degraded or intramolecularly crosslinked at selected sites should pose no special problems for in situ bDNA assays since priming and reverse transcription are not required. As in assays that target DNA, multiple oligonucleotides will be used to label target RNA in cells; failure to bind one or more of these oligonucleotides is of no real consequence. Quantification may also be possible with the in situ bDNA assay with proper selection of internal standards. The sensitivity of the system 8 bDNA filter and in situ hybridization assays should be limited mostly by the specificity of the oligonucleotide probes. Empirical selection of the best LE oligonucleotide probes and the use of the cruciform design (18 ) should prove most useful in optimizing specificity.

The isoC-isoG base pair may find utility in several other areas. Amplification of weak signals from immunoassays, particularly with low titer antigens on the surface of cells or within cells, should be possible. In multiplex bDNA hybridization analysis, many targets will be analyzed simultaneously using many CPs and CE sequences. The ability to control NSH of the labeling system with any of the multiple capturing systems will be critical to the success. Combinatorial fluorescence (34 ) can be used in multiplex applications to increase the specificity and the reliability of target detection at very low levels. With a six base code containing isoC and isoG nucleotides, it is relatively easy to construct four complete labeling systems (preamplifier, amplifier, labeled probe) that will have no cross-hybridization greater than a 3mer with each other.

In nanotechnology, DNA is a more useful framework than other biopolymers because of the regularity and the predictability of the structures that form when unique sequences are mixed together under appropriate hybridization conditions (35 ,36 ). The use of isoC-isoG in these constructions should allow more intricate structures to be formed with greater control over the specificity of the hybridizations.

Provided that isoC and isoG are not toxic, they may find utility in oligonucleotide therapeutics. The isoC-isoG base pair could be used to replace selected C-G base pairs to increase the specificity of nucleic acid aptamers (37 -39 ) and decoys (40 ). This should reduce undesirable NSH of the aptamers or decoys to cellular nucleic acid sequences. The use of isoC and isoG in constructing nanomachines for delivery of therapeutics to target cells can also be envisioned.

Other base pairs that may be useful in these applications have been defined, including the [kappa]-[pi] base pair with three hydrogen bonds (22 ,23 ) and a stability similar to the A-T base pair (41 ,42 ). With an eight base code, sequences of even greater uniqueness and specificity can be devised for all of the above applications.

Eventually, quantification with all DNA probe assays (including quantitative PCR) will be limited by Poisson sampling error. To analyze this, the assay can be conveniently divided into three steps, each of which has an associated probability distribution and variance ([sigma]2): (i) pipetting the sample containing n target molecules (Poisson distribution, [sigma]P2 = n); (ii) capture of the targets (binomial distribution, [sigma]b2 = nPq), where P = probability of capture and q = 1 - P; and (iii) amplification and detection [a normal distribution, [sigma]ad2 = (CVad * n)2], where CVad = the CV of the amplification and detection steps. By summing the variances and rearranging, the total assay CV may be written as:

CVassay = (1/n)[n(1 + Pq) + (CVad * n)2]1/2

The following conclusions can be drawn from this formula. The contribution to the total assay CV from the different steps in the assay depends on the target level. Capture efficiency makes very little difference above five molecules. Below 25 molecules the Poisson contribution dominates the total CV. The accuracy of quantification of target levels between 50 and 500 molecules is significantly affected by the CV of the amplification/detection reaction. With a CVad of 5%, 100 molecules are detected with a CV of 11-12%; with a CVad of 30%, the assay CV is 32%.

With 25 molecules in a sample, a 20% CV of quantification is expected in the first pipetting step of the assay. With an amplification/detection CV of 5% the minimum assay CV of quantification would be between 21% (99% efficient capture) and 23% (30% efficient capture). At five molecules, the overall CV will be at least 45%. Thus as the assay detection limit approaches one molecule, it will cease to quantify target precisely well before detectable signals disappear. One solution is to fragment the target in a volume much larger than the assay volume. In this way one target becomes many mini-targets prior to sampling. Target fragmentation should also improve the hybridization efficiency of the probes to the target (due to reduced secondary and tertiary structure) and the capture of the target (due to less steric hindrance).

ACKNOWLEDGEMENTS

We thank David Chernoff and Drew Johnson for setting up the study between Chiron and The Aaron Diamond AIDS Research Center. We thank Carrie and Howard Wong for preparing the oligonucleotides used in this study and Kristina Whitfield for the Figures.

REFERENCES

1 Markowitz, M. et al. (1995) N. Engl. J. Med. 333, 1534-1539. MEDLINE Abstract

2 Danner, S. et al. (1995) N. Engl. J. Med. 333, 1528-1533. MEDLINE Abstract

3 Lau, J.Y.N., et al. (1993) Lancet 341, 1501-1504.

4 Orito, E. et al. (1994) J. Med. Virol. 44, 410-414. MEDLINE Abstract

5 Laurent-Puig, P. et al. (1995) C. Eur. J. Gastro. Hep. 7, 335-340.

6 Arase, Y. et al. (1995) Intern. Hep. Comm. 4, 19-25.

7 Yamada, G. et al. (1995) Hepatology 22, 1351-1354. MEDLINE Abstract

8 Cao, Y., Qin, L, Zhang, L, Safrit, J. and Ho, D.D. (1995) N. Engl. J. Med. 332, 201-208. MEDLINE Abstract

9 Mellors, J.W., Kingsley, L.A., Rinaldo, C.R., Todd, J.A., Hoo, B.S., Kokka, R.P. and Gupta, P. (1995) Ann. Intern Med. 122, 573-579. MEDLINE Abstract

10 Mellors, J.W., Rinaldo, C.R., Gupta, P., White, R.M., Todd, J.A. and Kingsley, L.A. (1996) Science 272, 1167-1170. MEDLINE Abstract

11 Ho, D.D., Neumann, A.U., Perelson, A.S., Chen, W., Leonard, J.M. and Markowitz, M. (1995) Nature 373, 123-126. MEDLINE Abstract

12 Perelson, A.S., Neumann, A.U., Markowitz, M., Leonard, J.M. and Ho, D.D. (1996) Science 271, 1582-1586. MEDLINE Abstract

13 Pachl, C. et al. (1995) J. Acquired Immune Def. Synd. 8, 446-454.

14 Alter, H.J. et al. (1995) J. Viral Hep. 2, 121-132.

15 Detmer, J. et al. (1996) J. Clin. Microbiol. 34, 901-907. MEDLINE Abstract

16 Zaaijer, H.L., Borg, F., Cuypers, H.T.M., Hermus, M.C.A.H. and Lelie, P.N. (1994) J. Clin. Microbiol. 32, 2088-2091. MEDLINE Abstract

17 Hendricks, D.A. et al. (1995) Am. J. Clin. Pathol. 104, 537-546. MEDLINE Abstract

18 Kern, D., Collins, M. L., Fultz, T., Detmer, J., Hamren, S., Peterkin, J.J., Sheridan, P, Urdea, M, White, R., Yeghiazarian, T. and Todd, J. (1996) J. Clin. Microbiol. 34, 3196-3202. MEDLINE Abstract

19 Chang, C.-A., Horn, T., Ahle, D. and Urdea, M.S. (1991) Nucleosides Nucleotides 10, 389-392.

20 Urdea, M.S. Warner, B.D., Running, J.A., Stempien, M., Clyne, J. and Horn, T. (1988) Nucleic Acids Res. 16, 4937-4955.

21 Running, J.A. and Urdea, M.S. (1990) BioTechniques 8, 276-277. MEDLINE Abstract

22 Switzer, C.Y., Moroney, S.E. and Benner, S.A. (1993) Biochemistry 32, 10489-10496. MEDLINE Abstract

23 Tor, Y. and Dervan, P.B. (1993) J. Am. Chem. Soc. 115, 4461-4467.

24 Horn, T., Chang, C.-A. and Collins, M.L. (1995) Tetrahedron Lett. 36, 2033-2036.

25 Bronstein, I. et al. (1989) Clin. Chem. 35, 1441-1446. MEDLINE Abstract

26 Schaap, A.P. et al. (1989) Clin. Chem. 35, 1863-1864. MEDLINE Abstract

27 Collins, M.L. et al. (1995) Anal. Biochem. 226, 120-129. MEDLINE Abstract

28 Haase, A.T., Retzel, E.F. and Staskus, K.A. (1990) Proc. Natl. Acad. Sci. USA87, 4971-4975. MEDLINE Abstract

29 Bagasra, O., Hauptman, D.O., Lischner, H.W., Sachs, M. and Pomerantz, R.J. (1992) N. Engl. J. Med. 326, 1385-1391. MEDLINE Abstract

30 Nuovo, G.J. (1995) PCR Methods Appl. 4, S151-S167. MEDLINE Abstract

31 Teo, I.A. and Shaunak, S. (1995) Histochem. J. 27, 647-659. MEDLINE Abstract

32 Komminoth, P., Adams, V., Long, A.A., Roth, J., Saremaslani, P., Flury, R., Schmid, M. and Heitz, P.U. (1994) Pathol. Res. Pract. 190, 1017-1025. MEDLINE Abstract

33 Lidonnici, K., Lane, B. and Nuovo, G.J. (1995) Diagn. Mol. Pathol. 4, 98-107. MEDLINE Abstract

34 Ried, T. et al. (1992) Hum. Mol. Genet. 1, 307-313. MEDLINE Abstract

35 Seeman, N.C. (1990) J. Biomol. Struct. Dynamics 8, 573-581.

36 Seeman, N.C. (1991) DNA Cell Biol. 10, 475-486. MEDLINE Abstract

37 Tuerk, C. and Gold, L. (1990) Science 249, 505-510. MEDLINE Abstract

38 Joyce, G. (1989) Gene 82, 83-87. MEDLINE Abstract

39 Ellington, A. and Szostak, J. (1990) Nature 346, 818-822. MEDLINE Abstract

40 Yamada, O., Kraus, G., Luznik, L., Yu, M. and Wong-Staal, F. (1996) J. Virol. 70, 1596-1601. MEDLINE Abstract

41 Piccirilli, J.A., Krauch,T., Moroney, S.E. and Benner, S.A. (1990) Nature 343, 33-37. MEDLINE Abstract

42 Leach, A.R. and Kollman, P.A. (1992) J. Am. Chem. Soc., 114, 3675-3683.


*To whom correspondence should be addressed at present address: Nanogen Inc., 10398 Pacific Center Court, San Diego, CA 92121, USA. Tel: +1 619 546 7700; Fax: +1 619 546 7717
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Clin. Microbiol.Home page
A. Holguin, M. Lopez, M. Molinero, and V. Soriano
Performance of Three Commercial Viral Load Assays, Versant Human Immunodeficiency Virus Type 1 (HIV-1) RNA bDNA v3.0, Cobas AmpliPrep/Cobas TaqMan HIV-1, and NucliSens HIV-1 EasyQ v1.2, Testing HIV-1 Non-B Subtypes and Recombinant Variants
J. Clin. Microbiol., September 1, 2008; 46(9): 2918 - 2923.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
K. Hosoda, T. Matsuura, H. Kita, N. Ichihashi, K. Tsukada, I. Urabe, and T. Yomo
A novel sequence-specific RNA quantification method using nicking endonuclease, dual-labeled fluorescent DNA probe, and conformation-interchangeable oligo-DNA
RNA, March 1, 2008; 14(3): 584 - 592.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
A. Vermeulen, B. Robertson, A. B. Dalby, W. S. Marshall, J. Karpilow, D. Leake, A. Khvorova, and S. Baskerville
Double-stranded regions are essential design components of potent inhibitors of RISC function
RNA, May 1, 2007; 13(5): 723 - 730.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. E. Martin, T. L. Jones, C. L. Thomas, P. L. Lorenzi, D. A. Nguyen, T. Runfola, M. Gunsior, J. N. Weinstein, P. K. Goldsmith, E. Lader, et al.
Multiplexing siRNAs to compress RNAi-based screen size in human cells
Nucleic Acids Res., April 3, 2007; 35(8): e57 - e57.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
L. Perrin, J. M. Pawlotsky, M. Bouvier-Alias, C. Sarrazin, S. Zeuzem, and G. Colucci
Multicenter Performance Evaluation of a New TaqMan PCR Assay for Monitoring Human Immunodeficiency Virus RNA Load
J. Clin. Microbiol., December 1, 2006; 44(12): 4371 - 4375.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
A. Das, E. Spackman, D. Senne, J. Pedersen, and D. L. Suarez
Development of an Internal Positive Control for Rapid Diagnosis of Avian Influenza Virus Infections by Real-Time Reverse Transcription-PCR with Lyophilized Reagents.
J. Clin. Microbiol., September 1, 2006; 44(9): 3065 - 3073.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
Y. Fedorov, E. M. Anderson, A. Birmingham, A. Reynolds, J. Karpilow, K. Robinson, D. Leake, W. S. Marshall, and A. Khvorova
Off-target effects by siRNA can induce toxic phenotype
RNA, July 1, 2006; 12(7): 1188 - 1196.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
M. J. Moser, D. R. Christensen, D. Norwood, and J. R. Prudent
Multiplexed Detection of Anthrax-Related Toxin Genes
J. Mol. Diagn., February 1, 2006; 8(1): 89 - 96.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
D. R. Christensen, L. J. Hartman, B. M. Loveless, M. S. Frye, M. A. Shipley, D. L. Bridge, M. J. Richards, R. S. Kaplan, J. Garrison, C. D. Baldwin, et al.
Detection of Biological Threat Agents by Real-Time PCR: Comparison of Assay Performance on the R.A.P.I.D., the LightCycler, and the Smart Cycler Platforms
Clin. Chem., January 1, 2006; 52(1): 141 - 145.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
T. Elbeik, P. Nassos, P. Kipnis, B. Haller, and V. L. Ng
Evaluation of the VACUTAINER PPT Plasma Preparation Tube for Use with the Bayer VERSANT Assay for Quantification of Human Immunodeficiency Virus Type 1 RNA
J. Clin. Microbiol., August 1, 2005; 43(8): 3769 - 3771.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
P. Swanson, C. de Mendoza, Y. Joshi, A. Golden, R. L. Hodinka, V. Soriano, S. G. Devare, and J. Hackett Jr.
Impact of Human Immunodeficiency Virus Type 1 (HIV-1) Genetic Diversity on Performance of Four Commercial Viral Load Assays: LCx HIV RNA Quantitative, AMPLICOR HIV-1 MONITOR v1.5, VERSANT HIV-1 RNA 3.0, and NucliSens HIV-1 QT
J. Clin. Microbiol., August 1, 2005; 43(8): 3860 - 3868.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
A. Guihot, L-J. Couderc, F. Agbalika, L. Galicier, P. Bossi, E. Rivaud, A. Scherrer, D. Zucman, C. Katlama, and E. Oksenhendler
Pulmonary manifestations of multicentric Castleman's disease in HIV infection: a clinical, biological and radiological study
Eur. Respir. J., July 1, 2005; 26(1): 118 - 125.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. D. Ahle, S. Barr, A. M. Chin, and T. R. Battersby
Sequence determination of nucleic acids containing 5-methylisocytosine and isoguanine: identification and insight into polymerase replication of the non-natural nucleobases
Nucleic Acids Res., June 2, 2005; 33(10): 3176 - 3184.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
A. VERMEULEN, L. BEHLEN, A. REYNOLDS, A. WOLFSON, W. S. MARSHALL, J. KARPILOW, and A. KHVOROVA
The contributions of dsRNA structure to Dicer specificity and efficiency
RNA, May 1, 2005; 11(5): 674 - 682.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
T. Elbeik, N. Markowitz, P. Nassos, U. Kumar, S. Beringer, B. Haller, and V. Ng
Simultaneous Runs of the Bayer VERSANT HIV-1 Version 3.0 and HCV bDNA Version 3.0 Quantitative Assays on the System 340 Platform Provide Reliable Quantitation and Improved Work Flow
J. Clin. Microbiol., July 1, 2004; 42(7): 3120 - 3127.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. C. Johnson, C. B. Sherrill, D. J. Marshall, M. J. Moser, and J. R. Prudent
A third base pair for the polymerase chain reaction: inserting isoC and isoG
Nucleic Acids Res., March 29, 2004; 32(6): 1937 - 1941.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. M. Sismour, S. Lutz, J.-H. Park, M. J. Lutz, P. L. Boyer, S. H. Hughes, and S. A. Benner
PCR amplification of DNA containing non-standard base pairs by variants of reverse transcriptase from Human Immunodeficiency Virus-1
Nucleic Acids Res., February 2, 2004; 32(2): 728 - 735.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
T. Elbeik, J. Surtihadi, M. Destree, J. Gorlin, M. Holodniy, S. A. Jortani, K. Kuramoto, V. Ng, R. Valdes Jr., A. Valsamakis, et al.
Multicenter Evaluation of the Performance Characteristics of the Bayer VERSANT HCV RNA 3.0 Assay (bDNA)
J. Clin. Microbiol., February 1, 2004; 42(2): 563 - 569.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
S. Palmer, A. P. Wiegand, F. Maldarelli, H. Bazmi, J. M. Mican, M. Polis, R. L. Dewar, A. Planta, S. Liu, J. A. Metcalf, et al.
New Real-Time Reverse Transcriptase-Initiated PCR Assay with Single-Copy Sensitivity for Human Immunodeficiency Virus Type 1 RNA in Plasma
J. Clin. Microbiol., October 1, 2003; 41(10): 4531 - 4536.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. P. Tsai, A. Wong, E. Mai, P. Chan, G. Mausisa, M. Vasser, P. Jhurani, M. H. Jakobsen, W. L. T. Wong, and J.-P. Stephan
Nucleic acid capture assay, a new method for direct quantitation of nucleic acids
Nucleic Acids Res., March 15, 2003; 31(6): e25 - e25.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
M. J. Moser, D. J. Marshall, J. K. Grenier, C. D. Kieffer, A. A. Killeen, J. L. Ptacin, C. S. Richmond, E. B. Roesch, C. W. Scherrer, C. B. Sherrill, et al.
Exploiting the Enzymatic Recognition of an Unnatural Base Pair to Develop a Universal Genetic Analysis System
Clin. Chem., March 1, 2003; 49(3): 407 - 414.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
D. Kenny, L.-P. Shen, and J. A. Kolberg
Detection of Viral Infection and Gene Expression in Clinical Tissue Specimens Using Branched DNA (bDNA) In Situ Hybridization
J. Histochem. Cytochem., September 1, 2002; 50(9): 1219 - 1227.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
C. Giachetti, J. M. Linnen, D. P. Kolk, J. Dockter, K. Gillotte-Taylor, M. Park, M. Ho-Sing-Loy, M. K. McCormick, L. T. Mimms, and S. H. McDonough
Highly Sensitive Multiplex Assay for Detection of Human Immunodeficiency Virus Type 1 and Hepatitis C Virus RNA
J. Clin. Microbiol., July 1, 2002; 40(7): 2408 - 2419.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
N. Li, D. P. Hartley, N. J. Cherrington, and C. D. Klaassen
Tissue Expression, Ontogeny, and Inducibility of Rat Organic Anion Transporting Polypeptide 4
J. Pharmacol. Exp. Ther., May 1, 2002; 301(2): 551 - 560.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
C. de Mendoza, J. Alcami, M. Sainz, D. Folgueira, and V. Soriano
Evaluation of the Abbott LCx Quantitative Assay for Measurement of Human Immunodeficiency Virus RNA in Plasma
J. Clin. Microbiol., April 1, 2002; 40(4): 1518 - 1521.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
J. J. Germer, P. J. Heimgartner, D. M. Ilstrup, W. S. Harmsen, G. D. Jenkins, and R. Patel
Comparative Evaluation of the VERSANT HCV RNA 3.0, QUANTIPLEX HCV RNA 2.0, and COBAS AMPLICOR HCV MONITOR Version 2.0 Assays for Quantification of Hepatitis C Virus RNA in Serum
J. Clin. Microbiol., February 1, 2002; 40(2): 495 - 500.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
H. Mohri, A. S. Perelson, K. Tung, R. M. Ribeiro, B. Ramratnam, M. Markowitz, R. Kost, Hurley, L. Weinberger, D. Cesar, et al.
Increased Turnover of T Lymphocytes in HIV-1 Infection and Its Reduction by Antiretroviral Therapy
J. Exp. Med., October 29, 2001; 194(9): 1277 - 1288.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
A. Si-Mohamed, L. Andreoletti, I. Colombet, M.-P. Carreno, G. Lopez, G. Chatelier, M. D. Kazatchkine, and L. Belec
Quantitation of Human Immunodeficiency Virus Type 1 (HIV-1) RNA in Cell-Free Cervicovaginal Secretions: Comparison of Reverse Transcription-PCR Amplification (AMPLICOR HIV-1 MONITOR 1.5) with Enhanced-Sensitivity Branched-DNA Assay (Quantiplex 3.0)
J. Clin. Microbiol., June 1, 2001; 39(6): 2055 - 2059.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
A. N. Player, L.-P. Shen, D. Kenny, V. P. Antao, and J. A. Kolberg
Single-copy Gene Detection Using Branched DNA (bDNA) In Situ Hybridization
J. Histochem. Cytochem., May 1, 2001; 49(5): 603 - 612.
[Abstract] [Full Text]


Home page
J. Clin. Microbiol.Home page
M. P. de Baar, E. C. Timmermans, M. Bakker, E. de Rooij, B. van Gemen, and J. Goudsmit
One-Tube Real-Time Isothermal Amplification Assay To Identify and Distinguish Human Immunodeficiency Virus Type 1 Subtypes A, B, and C and Circulating Recombinant Forms AE and AG
J. Clin. Microbiol., May 1, 2001; 39(5): 1895 - 1902.
[Abstract] [Full Text]


Home page
J. Clin. Microbiol.Home page
P.-Y. Shi, E. B. Kauffman, P. Ren, A. Felton, J. H. Tai, A. P. Dupuis II, S. A. Jones, K. A. Ngo, D. C. Nicholas, J. Maffei, et al.
High-Throughput Detection of West Nile Virus RNA
J. Clin. Microbiol., April 1, 2001; 39(4): 1264 - 1271.
[Abstract] [Full Text]


Home page
J. Clin. Microbiol.Home page
P. Swanson, V. Soriano, S. G. Devare, and J. Hackett Jr.
Comparative Performance of Three Viral Load Assays on Human Immunodeficiency Virus Type 1 (HIV-1) Isolates Representing Group M (Subtypes A to G) and Group O: LCx HIV RNA Quantitative, AMPLICOR HIV-1 MONITOR Version 1.5, and Quantiplex HIV-1 RNA Version 3.0
J. Clin. Microbiol., March 1, 2001; 39(3): 862 - 870.
[Abstract] [Full Text]


Home page
J. Clin. Microbiol.Home page
D. G. Murphy, L. Côté, M. Fauvel, P. René, and J. Vincelette
Multicenter Comparison of Roche COBAS AMPLICOR MONITOR Version 1.5, Organon Teknika NucliSens QT with Extractor, and Bayer Quantiplex Version 3.0 for Quantification of Human Immunodeficiency Virus Type 1 RNA in Plasma
J. Clin. Microbiol., November 1, 2000; 38(11): 4034 - 4041.
[Abstract] [Full Text]


Home page
J. Clin. Microbiol.Home page
A. Erice, D. Brambilla, J. Bremer, J. B. Jackson, R. Kokka, B. Yen-Lieberman, and R. W. Coombs
Performance Characteristics of the QUANTIPLEX HIV-1 RNA 3.0 Assay for Detection and Quantitation of Human Immunodeficiency Virus Type 1 RNA in Plasma
J. Clin. Microbiol., August 1, 2000; 38(8): 2837 - 2845.
[Abstract] [Full Text]


Home page
J. Clin. Microbiol.Home page
H. G. M. Niesters, M. Krajden, L. Cork, M. de Medina, M. Hill, E. Fries, and A. D. M. E. Osterhaus
A Multicenter Study Evaluation of the Digene Hybrid Capture II Signal Amplification Technique for Detection of Hepatitis B Virus DNA in Serum Samples and Testing of EUROHEP Standards
J. Clin. Microbiol., June 1, 2000; 38(6): 2150 - 2155.
[Abstract] [Full Text]


Home page
Drug Metab. Dispos.Home page
D. P. Hartley and C. D. Klaassen
Detection of Chemical-Induced Differential Expression of Rat Hepatic Cytochrome P450 mRNA Transcripts Using Branched DNA Signal Amplification Technology
Drug Metab. Dispos., May 1, 2000; 28(5): 608 - 616.
[Abstract] [Full Text]


Home page
Nucleic Acids ResHome page
S. Capaldi, R. C. Getts, and S. D. Jayasena
Signal amplification through nucleotide extension and excision on a dendritic DNA platform
Nucleic Acids Res., April 1, 2000; 28(7): e21 - e21.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
T. Elbeik, E. Charlebois, P. Nassos, J. Kahn, F. M. Hecht, D. Yajko, V. Ng, and K. Hadley
Quantitative and Cost Comparison of Ultrasensitive Human Immunodeficiency Virus Type 1 RNA Viral Load Assays: Bayer bDNA Quantiplex Versions 3.0 and 2.0 and Roche PCR Amplicor Monitor Version 1.5
J. Clin. Microbiol., March 1, 2000; 38(3): 1113 - 1120.
[Abstract] [Full Text]


Home page
J. Clin. Microbiol.Home page
C. Manegold, C. Krempe, H. Jablonowski, L. Kajala, M. Dietrich, and O. Adams
Comparative Evaluation of Two Branched-DNA Human Immunodeficiency Virus Type 1 RNA Quantification Assays with Lower Detection Limits of 50 and 500 Copies per Milliliter
J. Clin. Microbiol., February 1, 2000; 38(2): 914 - 917.
[Abstract] [Full Text]


Home page
CVIHome page
H. Gale
Evaluation of the Quantiplex Human Immunodeficiency Virus Type 1 RNA 3.0 Assay in a Tertiary-Care Center
Clin. Vaccine Immunol., January 1, 2000; 7(1): 122 - 124.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
J. Niubò, W. Li, K. Henry, and A. Erice
Recovery and Analysis of Human Immunodeficiency Virus Type 1 (HIV) RNA Sequences from Plasma Samples with Low HIV RNA Levels
J. Clin. Microbiol., January 1, 2000; 38(1): 309 - 312.
[Abstract] [Full Text]


Home page
J. Clin. Microbiol.Home page
H. C. Highbarger, W. G. Alvord, M. K. Jiang, A. S. Shah, J. A. Metcalf, H. C. Lane, and R. L. Dewar
Comparison of the Quantiplex Version 3.0 Assay and a Sensitized Amplicor Monitor Assay for Measurement of Human Immunodeficiency Virus Type 1 RNA Levels in Plasma Samples
J. Clin. Microbiol., November 1, 1999; 37(11): 3612 - 3614.
[Abstract] [Full Text]


Home page
J. Clin. Microbiol.Home page
M. P. de Baar, A. M. van der Schoot, J. Goudsmit, F. Jacobs, R. Ehren, K. H. M. van der Horn, P. Oudshoorn, F. de Wolf, and A. de Ronde
Design and Evaluation of a Human Immunodeficiency Virus Type 1 RNA Assay Using Nucleic Acid Sequence-Based Amplification Technology Able To Quantify Both Group M and O Viruses by Using the Long Terminal Repeat as Target
J. Clin. Microbiol., June 1, 1999; 37(6): 1813 - 1818.
[Abstract] [Full Text]


Home page
Clin. Chem.Home page
L. J. Kricka
Nucleic Acid Detection Technologies — Labels, Strategies, and Formats
Clin. Chem., April 1, 1999; 45(4): 453 - 458.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
M. Zazzi, L. Romano, M. Catucci, G. Venturi, A. De Milito, and P. E. Valensin
Clinical Evaluation of an In-House Reverse Transcription-Competitive PCR for Quantitation of Human Immunodeficiency Virus Type 1 RNA in Plasma
J. Clin. Microbiol., February 1, 1999; 37(2): 333 - 338.
[Abstract] [Full Text]


Home page
J. Clin. Microbiol.Home page
B. L. Pasloske, C. R. Walkerpeach, R. D. Obermoeller, M. Winkler, and D. B. DuBois
Armored RNA Technology for Production of Ribonuclease-Resistant Viral RNA Controls and Standards
J. Clin. Microbiol., December 1, 1998; 36(12): 3590 - 3594.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (82K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (152)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Collins, M. L.
Right arrow Articles by Ho, D. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Collins, M. L.
Right arrow Articles by Ho, D. D.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?