Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (199K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (155)
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Xiao, Y.
Right arrow Articles by Weaver, D. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xiao, Y.
Right arrow Articles by Weaver, D. T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 1997 Oxford University Press 2985-2991

Conditional gene targeted deletion by Cre recombinase demonstrates the requirement for the double-strand break repair Mre11 protein in murine embryonic stem cells

Conditional gene targeted deletion by Cre recombinase demonstrates the requirement for the double-strand break repair Mre11 protein in murine embryonic stem cells Yonghong Xiao and David T. Weaver*

Department of Microbiology and Molecular Genetics, Harvard Medical School and Division of Tumor Immunology, Dana-Farber Cancer Institute, 44 Binney Street, Boston, MA 02115, USA

Received April 30, 1997; Revised and Accepted June 11, 1997

ABSTRACT

Repair of DNA damage resulting in double-strand breaks (DSBs) is controlled by gene products executing homologous recombination or end-joining pathways. The MRE11 gene has previously been implicated in DSB repair in the yeast Saccharomyces cerevisiae. Here we have developed a methodology to study the roles of the murine Mre11 homolog in pluripotent embryonic stem cells. Using a gene targeting approach, a triple LoxP site cassette was inserted into a region of MRE11 genomic DNA flanking conserved phosphodiesterase motifs. The addition of Cre recombinase activity promotes deletions of three types that can be scored. We find that deletion at phosphodiesterase motif III encoded in the N-terminus of Mre11 is acheived in the presence of a wild-type MRE11 allele. However, when the wild-type MRE11 allele is inactivated by gene targeted insertion of a neo marker, only Cre recombination events that allow expression of wild-type Mre11 protein are observed. Therefore, Mre11 is required for normal cell proliferation. This methodology introduces a means to study important regions of essential genes in cell culture models.

INTRODUCTION

Repair of chromosome damage in eukaryotes is dictated by a group of repair pathways and dependent on the type of chromosome break or DNA modification. For double-stranded breaks (DSBs) there are two principle repair mechanisms that have been identified. DSBs in the yeast Saccharomyces cerevisiae are mainly repaired by homologous recombination, where a large group of genes have been demonstrated to be utilized (RAD50-RAD58, MRE2, MRE11 and XRS2; reviewed in 1 ,2 ). A second pathway in eukaryotes involves the joining of DSBs with little requirement for DNA homology (3 ). These end-joining pathways have been adopted in developmentally programed gene rearrangements, such as V(D)J recombination. A subset of the genes involved in homologous recombination may also be utilized in end-joining pathways (4 -6 ).

Mutation of the S.cerevisiae MRE11 gene blocks meiotic recombination, has a hyper-recombinational phenotype and generates sensitivity to DSB damage in mitotic yeast (7 ). Mutation of the Schizosaccharomyces pombe MRE11 homolog (rad32) also causes increased chromosome loss (8 ). Two other yeast genes, RAD50 and XRS2, share the same phenotypes as MRE11 (9 ,10 ). Mre11 and Rad50 have been shown to interact using yeast two-hybrid analysis (11 ) and co-immunoprecipitation from human cells (12 ). Rad50 is a DNA and nucleotide binding protein of unknown function (13 ).

MRE11 and RAD50 are related to bacterial genes involved in chromosome stability in Escherichia coli (14 ). The products of sbcC and sbcD control destabilization of long cruciform or palindromic DNA sequences in the E.coli genome that may interfere with DNA synthesis (15 ). sbcC/D are also similar to nucleases of the UvrA family (16 ) and have an ATP-dependent exonuclease activity (17 ). For Mre11, the homology with sbcD is much greater than with other members of the phosphodiesterase superfamily and four regions of common residues are found (motifs I-IV) over ~100 amino acids (1 4 ). These strucutural motifs may indicate that MRE11 also encodes a nuclease.

Mammalian cells also have the capacity to undergo homologous recombination reactions (18 ). The ability to study the requirements for genes in this process has been hampered by the severity of the engineered mutations. For example, mutations in the recA-related DSB repair gene RAD51 are inviable in cell culture and formation of rad51-/- mouse embryos is blocked by the 4- to 8-cell stage (19 ).

Here we have developed a methodology to examine the requirement for MRE11 functions in mammalian cells. We find that inactivation of MRE11 by gene targeted insertion can be accomplished in a conditional manner using the Cre/loxP site-specific recombination system (20 ,21 ). Following addition of Cre to targeted cells, the rescue of loxP deletions in the MRE11 locus is dependent on the status of MRE11 on the other allele. Thus, Cre/loxP recombination has been used to prove an essential requirement for MRE11 in mammalian cell proliferation.

MATERIALS AND METHODS

Cloning and characterization of MRE11 genomic DNA

A murine [lambda] phage genomic DNA library, prepared from mouse strain 129 (Clontech), was screened by standard hybridization methodologies with an N-terminal human MRE11 cDNA fragment (1.3 kb) isolated previously (22 ,23 ). Genomic DNA inserts from three phage (18-1, 2-6 and 20-4) were found to have overlapping MRE11 genomic regions. Using an EcoRI-BamHI probe specific for the 5' 720 bp of the human MRE11 cDNA, these three phage were ordered and a restriction enzyme map showing the presence of MRE11 exons identified as shown in Figure 1 . A 1.0 kb HindIII-XhoI fragment and a 0.6 kb HindIII-EcoRI fragment were subcloned into pSKII and resulting inserts analyzed by automated DNA sequencing. Exons corresponding to a 5' region of the human MRE11 cDNA were identified.


Figure 1. Phosphodiesterase motifs of MRE11 localized in murine MRE11 genomic DNA. (A) The human MRE11 gene contains four regions (I-IV) of conservation with a family of putative phosphodiesterases at the N-terminus of the ORF. (B) Genomic DNA from the murine MRE11 locus. The approximate locations of exons were characterized by Southern blotting and hybridization. Motifs II and III of the phosphodiesterase family conserved region were identified by DNA sequencing. Boxed residues are identical in the motifs of family members. H, HindIII; R, EcoRI.

Gene targeting at the MRE11 gene

A gene targeting vector was constructed by subcloning MRE11 genomic fragments into pPGKneo as follows. The plasmid pPGKneo (24 ), containing the mutant version of the G418 resistance gene expressed from the mouse phosphoglycerate kinase (PGK) promoter, was digested with HindIII and XhoI and blunted by Klenow polymerase extension. A XhoI-EcoRI 5 kb MRE11 genomic fragment isolated from phage 18-1 was subcloned into this site. Second, a 7.5 kb MRE11 EcoRV-NotI genomic fragment isolated from phage 20-4 was then subcloned into a unique SmaI site of this plasmid, resulting in pYX11. MRE11 gene targeting was accomplished by linearization of 50 [mu]g pYX11 at the unique NotI site, followed by ethanol precipitation of the DNA and resuspension in 25 [mu]l sterile H2O.

Murine embryonic stem cells (D3, 129 strain) were cultured as previously described in ES cell medium (DMEM, 20% inactivated fetal calf serum + LIF) (25 ). For introduction of plasmid DNA, 1 * 107 cells were harvested and resuspended in 0.8 ml DME in a 0.4 cm electroporation cuvette (BioRad), 25 [mu]l linearized DNA were added and electroporation conducted in a BioRad Gene Pulser at 0.23 kV, 500 [mu]F. Cells were subsequently plated on a single gelatinized plate in medium overnight. The medium was then replaced with ES medium plus 200 [mu]g/ml G418 for neo selection. Cells were fed with this medium for 7-10 days prior to picking of colonies and/or further analysis. For gene targeting with puromycin resistance plasmids, identical electroporation conditions were used and selection was conducted in ES medium plus 1 [mu]g/ml puromycin.

Southern blots

Genomic DNA was isolated from ES cells by previous methods (22 ,25 ). For analysis of pYX11 gene targeting events at the MRE11 locus, 15 [mu]g genomic DNA was digested with either HindIII or EcoRI for >4 h and fractionated on 0.8% agarose gel electrophoresis. Similarly, for pYX25 gene targeting events genomic DNAs were digested with the same enzymes. Genomic Southern blots were prepared by standard methods (22 ). A phage 18-1 XhoI fragment (1 kb) was subcloned into pSKII, yielding pYX1. Probe 1 was a 0.4 kb XhoI-NcoI fragment from pYX1. Likewise, a phage 2-6 XbaI-EcoRV fragment (1 kb) was subcloned into pSKII, giving pYX9. Probe 2 was a 1 kb XbaI-EcoRV fragment from pYX9. Probe 3 was a 0.5 kb EcoRV-HindIII fragment from pYX7.

Mre11 antibody and immunoblotting

The human MRE11 cDNA (23 ) was digested with PstI and EcoRI and subcloned into pET15b. For bacterial expression of an ~70 kDa truncated Mre11 protein, BL21 E.coli cells were grown overnight on an LB plus 100 [mu]g/ml ampicillin plate and a single colony used to innoculate 25 ml LB plus 100 [mu]g/ml carbenicillin that was grown to an optical density of 0.6 OD595, adjusted to 1 mM IPTG and grown for an additional 4 h at 30oC. Cell pellets were harvested by centrifugation and lysates were prepared by sonication in 20 mM Tris-HCl, pH 7.9, 0.5 M NaCl, 5 mM imidazole, 6 M urea. Induction of Mre11 was examined by fractionation of lysates with or without IPTG addition by SDS-PAGE, followed by staining with Coomassie brilliant blue. Mre11 protein was first bound and eluted by Ni2+ affinity chromatography (Novagen) according to the supplier's instructions and was fractionated preparatively by SDS-PAGE. The 70 kDa protein was then visualized by KCl precipitation staining (22 ) and a gel fragment removed. The gel fragment containing Mre11 protein was directly used as an immunogen in New Zealand White rabbits (Hazelton Research Products).

For immunoblotting with Mre11 antibody, cell lysates were formed by direct resuspension of cell pellets (1 * 106 cells) in 100 [mu]l 1* SB (50 mM Tris-HCl, pH 7.0, 2% SDS, 360 mM 2-mercaptoethanol, 2.5 mg/ml bromophenol blue), boiled for 5 min, sheared with a 25 gauge needle and fractionated by 7.5 or 12% SDS-PAGE. The SDS-PAGE fractions were transferred to PVDF membranes (NEN) using a BioRad Semi-Dry Electrophoretic Transfer apparatus according to the manufacturer's directions at 20 V for 45 min in 48 mM Tris-HCl, 39 mM glycine, 1.3 mM SDS, 20% methanol, pH 9.2. Blots were blocked in PBS plus 10% Carnation non-fat dry milk for 30 min to overnight at room temperature. Polyclonal anti-Mre11 antiserum was used at a 1:2500 dilution in PBS for 60 min at room temperature. Blots were then washed five times in PBS plus 0.2% Tween-20. Blots were then incubated with 1:5000 protein A/G-HRP (Pierce) for 30-40 min in PBS plus 1% BSA and extensively washed in PBS plus 0.2% Tween-20. Next, blots were developed using a Chemiluminescence Renaissance Kit (NEN) according to the supplier's instructions. Signals were detected on Kodak XR1 film.

Cre recombination at the MRE11 gene

For preparation of a loxP-containing gene targeting vector, plasmid pYX11 was modified by the introduction of loxP recognition sites (34 bp) synthesized with two complementary oligonucleotides (AAGCATAACTTCGTATAATGTATGCTATACGAAGTTAT and AAGCATAACTTCGTATAGCATACATTATACGAAGTTAT) containing HindIII restriction sites at their 5'-ends. Following annealing of these two oligonucleotides, the double-stranded oligonucleotides were then subcloned into PYX11 at a HindIII site and the insertion and orientation of single loxP sites identified by DNA sequencing of clones. In addition, plasmid pPGKpuro, containing the puromycin resistance gene expressed from the PGK promoter, was modified so that loxP recognition sites were introduced at each side of the puro gene. This was accomplished by subcloning the PGKpuro fragment (digested with SalI and blunted) into pBS246 (LoxP-containing vector; Gibco BRL) at the HindIII site. A NotI LoxP-puro-LoxP fragment was then subcloned into pYX23 at the EcoRV site, creating pYX25. Gene targeting with pYX25 and ES cell selection was conducted as described above. The pYX25 transfection results in clones with either the wild-type MRE11 allele or the mre11neo allele targeted by the loxP insert.

For Cre recombinase-stimulated deletion at loxP sites in ES cells, the following methodology was adapted. Approximately 1 * 107 309 derivative cells were electroporated with 50 [mu]g pBS185 (Cre recombinase expression vector; Gibco BRL). 309 derivative cells were identified by the pYX25 transfections above and are described in Results. Cells were replated on ES medium without selection at dilutions of 10-3, 10-4 and 10-5 and incubated for 7 days for harvesting of single colonies. ES cell colonies were picked by manipulation with a P200 pipettor, trypsinized and replated in a single 1 cm well of a 24-well plate in ES medium. After expansion of the cells for 4-7 days, cells were frozen in liquid N2 for storage and harvested for genomic DNA analysis.

Alternatively, following electroporation with pBS185 (Cre), cells were plated at different densities after transfection. Aliquots of the transfected cells were plated at various dilutions and harvested at either 2 or 10 days post-transfection. Approximately 1-2 * 106 cells were used for preparation of genomic DNA (1 mg/ml).

PCR and blotting analysis of Cre recombination events

ES genomic DNAs (1 mg/ml) were used in PCR and Southern blot analysis to determine loxP-mediated Cre recombination. PCR in the MRE11 genomic region was conducted using two oligonucleotides (YX18, CCCACTGGTGTTTCAAGGGTTGA, and YX19, GGCCAGTACTAGTGAACCTGTTC) and a PCR kit (Expand Long Template PCR System; Boehringer-Mannheim) according to the supplier's instructions. YX18 is located in MRE11 genomic sequence and YX19 is part of pBS246 adjacent to a LoxP site. PCR products were fractionated on 1% agarose gel electrophoresis, transferred to nitrocellulose and blotted with specific hybridization probes in the region. Within this PCR fragment, probe 4 is a 0.6 kb EcoRI-HindIII fragment and probe 2 is as described above.

RESULTS

Yeast mre11 strains are deficient in DSB repair and recombination (7 ). To understand the roles of mammalian MRE11 in DSB repair, we isolated genomic regions of the murine MRE11 locus using our previously identified human MRE11 cDNA (Materials and Methods). The 5'-end of human MRE11 cDNA was used to screen a [lambda] phage 129 mouse strain genomic DNA library and three phage were isolated. Mapping, subcloning and DNA sequencing was then used to identify MRE11 exons in the 5'-end of a putative murine MRE11 open reading frame (ORF). We identified two exons by this approach, corresponding to the interval from amino acid 44 to 119 of the 708 amino acid human MRE11 gene (Fig. 1 A).

MRE11 is a member of a gene family encoding phosphodiesterase functions, such as nucleases (14 ). The N-terminal region of human and S.cerevisiae Mre11, including the 44-119 amino acid region, has greatest similarity with sbcD. By DNA sequencing of the above MRE11 exons within the murine genomic DNA fragments, we found that portions of the phosphodiesterase motifs were present in the mouse ORF. In particular, the second phosphodiesterase motif (II) was partially included in an exon homologous to human Mre11 amino acids 44-69 (II, Fig. 1 B). Within this exon, the murine and human genes were identical. The most conserved portion of motif II among the phosphodiesterase family (DxxILxxGDL) was found (Fig. 1 B). Likewise, an additional exon encoding the third phosphodiesterase motif (III) was found, corresponding to human Mre11 amino acids 86-112. Within the motif III exon, the murine and human genes were identical and the conserved residues PxxxIxGNHD were observed (Fig. 1 B).

In order to examine the role of MRE11 in mammalian cells, we modified the genomic DNA in the motif III region in preparation for gene targeting. Approximately 12.5 kb of mouse MRE11 genomic DNA was subcloned into a gene targeting vector containing a mutant G418 resistance gene (neo) expressed from the phosphoglycerate kinase promoter to make pYX11 (Fig. 2 A). pYX11 was linearized by NotI digestion and transfected into the murine embryonic stem (ES) cell line D3 by electroporation (Materials and Methods). After 1 day, G418 selection was initiated and continued for 1 week according to previous protocols (18 ). G418r colonies were expanded and analyzed by Southern blots for the pattern of integration at the MRE11 locus.


Figure 2. Gene targeted deletion of the motif III exon genomic region of MRE11 in murine ES cells. (A) The plasmid pYX11, containing the G418 resistance gene (neo) flanked by two regions of MRE11 genomic DNA. The left flanking region contains a motif II exon (II) and an additional exon. The right flank contains one MRE11 exon after motif III in the cDNA. The neo gene is expressed in the orientation indicated by an arrow from the PGK promoter. (B) The endogenous restriction map of the region of MRE11 used in these experiments. Dark boxes, exons in flanking DNA for the targeting vector; stippled boxes, exons replaced by PGKneo. (C)The product of gene targeted deletion replaces motif III exons with neo.H, HindIII; R, EcoRI; X, XbaI; Xh, XhoI.

We found 14 colonies out of 400 screened having an integration pattern consistent with targeted insertion at the appropriate MRE11 genomic site. Each of these 14 colonies yielded a novel 8.0 kb HindIII fragment indicative of MRE11 insertion and a 6.8 kb endogenous fragment when hybridized with probe 1 (clone 309; Fig. 3 A and data not shown). These results were confirmed by secondary restriction digestions and Southern blotting. Thus, 309 cells are heterozygous for an mre11 insertion mutation (MRE11/ mre11neo).


Figure 3. Identification and characterization of ES cells with gene targeting events at the MRE11 locus. (A) Southern blot of parental ES (D3), heterozygous MRE11+/- ES (309) and two derivative cell lines, 309p66 and 309p70. Genomic DNAs of these cell lines were digested with either HindIII or EcoRI, followed by agarose gel electrophoresis, DNA transfer and blotting with probe 1 or 2 respectively. (B) Western blot of fractionated proteins from cell lines generated with targeted insertions for several MRE11 alleles. Whole cell lysates were fractionated by 12% SDS-PAGE, transferred and immunoblotted with an anti-Mre11 polyclonal antibody, followed by chemiluminescence detection.

In the development of the gene targeting strategy described above, we utilized a mutant G418 resistance gene that expresses sufficiently low levels of the protein that it is useful in screening for infrequent chromosome duplications (24 ). 309 cells were expanded and cultured in high levels of G418 (2.5 mg/ml). No colonies emerged in high G418 with a genomic Southern blot pattern indicative of mre11neo/mre11neo cells. These preliminary results may indicate that mre11-/- cells are not viable. In order to more accurately define the requirement for MRE11, we developed a methodology to compare the products of targeted deletions in the MRE11 genomic region with cell proliferation and viability.

Cre recombinase stimulates the formation of chromosomal recombination events at LoxP recognition sites (20 ). A pair of loxP sites are required and direct LoxP repeat orientation leads to deletions of the intervening DNA. Further, Cre/LoxP has been demonstrated to efficiently recombine in loxP-mediated events for murine ES and other mammalian tissue culture cell lines (20 ,21 ).

We designed an additional gene targeting vector (pYX25) containing three loxP recognition sites and the puromycin resistance marker interspersed over the same exon/intron region of MRE11 (Fig. 4 ). Importantly, loxP sites were placed in intronic regions flanking the motif III exon and a puromycin resistance gene marker (Materials and Methods). As above, pYX25 was linearized at a unique NotI site and introduced into 309 cells heterozygous at the MRE11 locus. Puromycin-resistant cells were selected and colonies examined for gene targeting events (Fig. 4 A). Genomic DNAs were digested with either HindIII or EcoRI and Southern blot analysis conducted with either hybridization probe 1 or 2 respectively. We found four colonies where the integration pattern was consistent with targeted insertion of the wild-type MRE11 allele of 309 cells (309p70) and three colonies with insertion at the neo-marked allele (309p66) (Fig. 3 A). Thus, insertion of a loxP cassette at either allele (Fig. 4 B and C) did not interfere with the normal proliferative capacity of cells.


Figure 4. Gene targeted insertion of loxP sites into either allele of the MRE11 locus. (A) Gene targeting of pYX25 to create a MRE11loxP allele. Three copies of a loxP recognition site (P) and the puromycin resistance gene (puro) expressed from the PGK promoter were added to create pYX25. The product of gene targeting is shown. Restriction enzyme sites are as in Figure 2. (B) Gene targeting at the wild-type MRE11 allele in 309 cells creates a cell line with two marked MRE11 chromosomes (MRE11loxP and mre11neo). (C) Gene targeting at the neo-marked MRE11 allele of 309 cells to generate a cell line with the genotype MRE11/MRE11loxP.

To determine whether MRE11 targeting events resulted in expression of any stable Mre11 mutant proteins, we examined the cell lines of the various integration types. A polyclonal anti-Mre11 antiserum was formed by injection of rabbits with bacterially produced human Mre11 (Materials and Methods). We found that anti-Mre11 antiserum readily detected a 80 kDa Mre11 protein from the parental D3 murine ES cells and several human cell lines, consistent with the predicted size from the MRE11 ORF (Fig. 3 B and data not shown). The heterozygous cell line where MRE11 motif III is deleted by neo-marked insertion (MRE11/mre11neo) was found to produce Mre11 protein at the same level as D3. In addition, no other significantly expressed proteins were detected, indicating that the motif III deletion in the neo-marked allele either produces a very small (<20 kDa) or unstable Mre11 protein. Cell lines with LoxP-puro replacing the neo marker insertion (309p66, 309p57 and 309p60; MRE11/MRE11loxP) produced Mre11 at approximately the same level as the heterozygous control, 309 (Fig. 3 B). Cells with LoxP-puro replacing the wild-type allele (309p70, 309p10 and 309p27; mre11neo/MRE11loxP) produced Mre11, but at a level that was reproducibly lower than the controls (Fig. 3 B).

To investigate whether MRE11 was an essential gene that was required for cell proliferation, we used the targeted loxP sites to differentially remove portions of MRE11 in the two types of cell lines prepared above (Fig. 4 B and C). Introduction of Cre recombinase by transfection will result in loxP-mediated deletions of three types (Fig. 5 B). We were able to examine the efficiency of recombination at these three loxP sites without overall loss of Mre11 function, because 309p66 (MRE11/ MRE11loxP) cells contain a wild-type allele (Fig. 4 C). A Cre recombinase expression plasmid (pBS185) was introduced into 309p66, 309p57, 309p60 (MRE11/MRE11loxP) cells by electroporation. Cells were replated after transfection at low density for non-selective outgrowth of individual ES cell colonies. Colonies were picked after 7-10 days and expanded for preparation of genomic DNA. LoxP-mediated recombination events were scored by PCR using primers hybridizing to positions flanking the LoxP insertion (Fig. 5 A). Cells without Cre recombinase expression yielded a 4.3 kb PCR product. Deletions mediated by loxP sites 1/2, 1/3 and 2/3 yielded recombination products of 2.6, 0.6 and 2.6 kb respectively (Fig. 5 B). Deletion 1/2 removed two MRE11 exons, including motif III. Deletion 2/3 removed only the puro marker, whereas deletion 1/3 removed puro and the two MRE11 exons. The transfected 309 derivative cells of the MRE11/ MRE11loxP genotype were found to yield colonies showing any of the three loxP deletion events (Fig. 5 C and Table 1 ). The 1/2 deletions were discriminated from 2/3 deletions by lack of hybridization with probe 2 (Fig. 5 C). Thus, each of the loxP sites in the targeted insertion are accessible to the Cre recombination system.


Figure 5. Detection of Cre recombination products at MRE11loxP. (A) PCR and Southern blot detection methodology at MRE11loxP. The MRE11loxP allele is as shown in Figure 4. The 5' and 3' PCR primers are PCR1, which is 0.6 kb 5' of LoxP1, and PCR2, which is immediately 3' of LoxP3. The locations of Southern blot hybridization probes 2-4 are shown relative to the EcoRI (R) map. (B) Products of Cre recombination events at MRE11loxP. 1/2, deletion of MRE11 motif III exons; 2/3, deletion of the puromycin resistance gene; 1/3, deletion of both puro and MRE11 motif III exons. (C) Southern blot of PCR products from ES cell colonies testing for Cre recombination events. Examples of clones with 1/3, 2/3 and 1/2 deletions are shown. (D) Genomic DNA Southern blot from two 309 subclones. Genomic DNA was digested with EcoRI. The hybridization probe used was probe 3, as shown in (A). Lane 1, 309 subclone without loxP-mediated deletion, 3.5 kb; lane 2, 309 subclone with loxP-mediated deletion of the 2/3 type, 1.2 kb.

We also tested 309p70, 309p10 and 309p27 cells of the mre11neo/ MRE11loxP genotype by transfection with a Cre recombinase plasmid. Interestingly, only Cre recombination events removing the puro marker alone were recovered (2/3, Fig. 5 C and Table 1 ). The presence of the 2/3 deletion was confirmed by genomic DNA Southern blot analysis (Fig. 5 D) and puromycin sensitivity of the clones. Importantly, no cells where MRE11 exons had been removed could be identified. These data are consistent with a requirement for MRE11 during normal cell proliferation.

Table 1 . Determination of Cre recombinase products from cells with differing MRE11 genotypes
ES cell genotype Cre recombination event n
  loxP [Delta]1/2 loxP [Delta]2/3 loxP [Delta]1/3  
mre11/MRE1loxP
  309p10 0 2 0 48
  309p27 0 3 0 47
  309p45 0 2 0 46
  309p70 0 4 0 120
  Total 0 13 0 261
MRE11/MRE11loxP
  309p57 1 0 0 45
  309p60 0 0 2 46
  309p66 3 1 0 48
  Total 4 1 2 139

An additional assessment of the requirement for MRE11 was developed in a time course experiment following the induction of Cre recombinase activity in mre11neo/MRE11loxP cells. We reasoned that Mre11 expressed from the MRE11loxP allele would be sufficient to allow cell growth as long as the protein was present. Deletions of all types might occur at the MRE11loxP allele, whereas only the 2/3 events could allow longer term cell growth and survival. Following transfection of Cre as above, we grew the surviving mre11neo/MRE11loxP cells (309p10 and 309p70) for 2 and 10 days, preparing genomic DNA from both time points from pooled samples. Interestingly, at the 2 day time point the loxP 1/3 deletion was readily detectable by PCR and Southern blot analysis (probe 4, 0.6 kb, Fig. 6 A). In comparison, the 1/3 deletion also found in MRE11/MRE11loxP cells (309p66, 309p57 and 309p60) had a very similar intensity, suggesting that these recombinational deletions occur with equal likelihood from MRE11loxP in either cell line (Fig. 6 A). As in the above experiment, 309p10 and 309p70 cells containing 1/3 deletions are either absent or so rare in the culture by day 10 that they are difficult to detect with the PCR blotting methodology (Fig. 6 A). In contrast, cells containing the 2/3 deletion were equally detected at both times for each cell line (probe 2, 2.6 kb, Fig. 6 B). Thus, cells with the MRE11 motif III exons deleted that lose Mre11 expression specifically fail to proliferate.


Figure 6. Time course of Cre recombinase-mediated deletion from MRE11loxP. (A) PCR detection of deletion of MRE11 motif III exons. As in Figure 5, ES cell clones of the two genotypes, mre11neo/MRE11loxP (p10, p27) and MRE11/ MRE11loxP (p57, p60, p66), were transfected with Cre plasmid and genomic DNA harvested at 2 or 10 days of cell culture. PCR and Southern blot analysis was using probe 4 as in Figure 5. (B) Presence of the 2/3 deletion of the MRE11loxP allele is detected with probe 2 (see Fig. 5).

DISCUSSION

Here we show that the mammalian MRE11 gene is required for normal cell proliferation in a conditional knock-out system we have developed using murine embryonic stem (ES) cells and Cre/loxP. An advantage of our methodology is the ability to score requirements for genes from the pluripotent ES cells without resorting to labor-intensive mouse injections, screening and crossing. The method relies on the differential removal of MRE11-specific exons under conditions of Cre recombinase expression and dependent on the MRE11 genotype at the other allele. Because the Cre recombination outcome is dependent on Mre11, our strategy introduces a methodology to further examine the structural requirements for Mre11. For example, expression of MRE11 cDNA in conjunction with Cre would be anticipated to rescue 1/3 deletions by reconstituting the cell proliferation defect. In addition, screens for other genes overcoming the dependence on MRE11 can be envisaged.

Many other genes have been observed to have early embryonic lethality in mouse models and there are numerous circumstances where ES cells cannot be formed with homozygous mutations in a gene. Within the DSB repair homologous recombination epistasis group, mouse homologs for several of the genes have recently been derived. For murine RAD51, the strand exchange and recA-related gene, double knock-out cells and rad51-/- mice cannot be isolated (19 ). Likewise, the tumor suppressor protein Brca1, which interacts with Rad51 in vivo and in vitro (26 ), has a similar embryonic lethality (27 ). On the other hand, for murine or chicken RAD54, doubly homozygous mice and cell lines can be generated, even though these cells are defective in IR repair and homologous recombination (28 ,29 ). Also, mutations that interfere with end-joining mechanisms that may be dependent on MRE11, such as the DNA-PK subunit mutant cells, are all viable (30 -33 ). These differences ultimately must reflect the usage of these genes in cell repair, recombination and broader functions. In addition, certain genes may be redundant, with other genes contributing to the same pathways such that gene mutation is not lethal.

Mre11 is complexed in mammalian and yeast cells with the product of the RAD50 gene (12 ). This association may well be functionally significant for all Mre11 roles in the cell. Because of the inability to generate mre11-/- cell lines shown here, presumably the MRE11, RAD50 and possibly XRS2 genes will produce embryonic lethality when similarly mutated by gene targeting in mouse models.

Complexes of Mre11 with Rad50 may play an essential role in some aspects of the S or G2 phases, independent of recombination functions. Alternatively, there may be a sufficiently high level of spontaneous damage that repair by Mre11-dependent homologous recombination mechanisms is always required. By analogy with functions of E.coli sbcCD, Mre11-Rad50 may associate with and be involved in the resolution of unusual DNA structures formed during DNA synthesis. sbcCD is required for resolution of cruciforms and large palindromic repeats generated during DNA replication (17 ). Purified sbcCD also has double- and single-strand exonuclease activity, a biochemical property that may be significant in its role in resolving cruciform structures. The biochemical activity of Mre11 is currently under investigation.

Human Mre11 was originally isolated in a screen for proteins that interact with DNA ligase I (23 ). Perhaps the association between these two proteins detected by two-hybrid analysis is indicative of a DNA replication role for Mre11-containing complexes. It will be interesting to learn where Mre11-deficient cells arrest in the cell cycle, as an indication of where Mre11 functions are most required.

ACKNOWLEDGEMENTS

This research was supported by an NRSA postdoctoral fellowship to Y.X. and grants from the NIH, March of Dimes Birth Defects Foundation and Novartis Pharmaceuticals to D.T.W.

REFERENCES

1 Petes,T., Malone,R. and Symington,L. (1991) In Broach,J., Pringle,J. and Jones,E. (eds), Recombination in Yeast. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 407-521.

2 Friedberg,E.C., Walker,G.C. and Siede,W. (1995) DNA Repair and Mutagenesis. American Society for Microbiology,Washington, DC.

3 Weaver,D.T. (1995) Trends Genet., 11, 388-392. MEDLINE Abstract

4 Kramer,K.M., Brock,J.A., Bloom,K., Moore,J.K. and Haber,J.E. (1994) Mol. Cell. Biol., 14, 1293-1301. MEDLINE Abstract

5 Moore,J.K. and Haber,J.E. (1996) Mol. Cell. Biol., 16, 2164-2173. MEDLINE Abstract

6 Milne,G.T., Jin,S., Shannon,K. and Weaver,D.T. (1996) Mol. Cell. Biol., 16, 4189-4198. MEDLINE Abstract

7 Ajimura,M., Leem,S.-H. and Ogawa,H. (1992) Genetics, 133, 51-66.

8 Tavassoli,M., Shayeghi,M., Nasim,A. and Watts,F.Z. (1995) Nucleic Acids Res., 23, 383-388. MEDLINE Abstract

9 Game,J.C. and Mortimer,R.K. (1974) Mutat. Res., 24, 281-292. MEDLINE Abstract

10 Ivanov,E.I., Korolev,V.G. and Fabre,F. (1992) Genetics, 132, 651-664.

11 Johzuka,K. and Ogawa,H. (1995) Genetics, 139, 1521-1532. MEDLINE Abstract

12 Dolganov,G.M., Maser,R.S., Novikov,A., Tosto,L., Chong,S., Bressan,D.A. and Petrini,J.H.J. (1996) Mol. Cell. Biol., 16, 4832-4841. MEDLINE Abstract

13 Alani,E.S., Subbiah,S. and Kleckner,N. (1989) Genetics, 116, 541-545.

14 Sharples,G.J. and Leach,D.R.F. (1995) Mol. Microbiol., 17, 1215-1220. MEDLINE Abstract

15 Leach,D.R.F. (1994) Bioessays, 16, 893-900.

16 Leach,D.R.F., Lloyd,R.G. and Coulson,A.F.C. (1992) Genetica, 87, 95-100.

17 Connelly,J.C. and Leach,D.R.F. (1996) Genes Cells, 1, 285-291. MEDLINE Abstract

18 Thomas,K., Folger,K.R. and Capecchi,M. (1986) Cell, 44, 419-428. MEDLINE Abstract

19 Tsuzuki,T., Fujii,Y., Sakumi,K., Tominaga,Y., Nakao,K., Sekiguchi,M., Matsushiro,A., Yoshimura,Y. and Morita,T. (1996) Proc. Natl. Acad. Sci. USA, 93, 6236-6240. MEDLINE Abstract

20 Gu,H., Zou,Y.-R. and Rajewsky,K. (1993) Cell, 73, 1155-1164. MEDLINE Abstract

21 Gu,H., Marth,D., Orban,P.C., Mossmann,H. and Rajewsky,K. (1994) Science, 265, 103-106. MEDLINE Abstract

22 Milne,G.T., Donovan,J.W., Xiao,Y. and Weaver,D. (1996) In Adolph,K.W. (ed.), Comparative Gene Analysis and Dominant Negative Mutations in DNA Repair. CRC Press, Boca Raton, FL, pp. 115-135.

23 Petrini,J.H.J., Walsh,M., Dimare,C., Chen,X.-N., Korenberg,J.R. and Weaver,D.T. (1995) Genomics, 29, 80-86.

24 Mortensen,R.M., Conner,D.A., Chao,S., Geisterfer-Lowrance,A.A.T. and Seidman,J.G. (1992) Mol. Cell. Biol., 12, 2391-2395. MEDLINE Abstract

25 Petrini,J.H.J., Xiao,Y. and Weaver,D.T. (1995) Mol. Cell. Biol., 15, 4303-4308.

26 Scully,R., Chen,J., Fluke,A., Xiao,Y., Weaver,D., Feuteun,J., Ashley,T. and Livingston,D. (1997) Cell, 88, 265-275. MEDLINE Abstract

27 Hakem,R., de la Pompa,J.L., Sirard,C., Mo,R., Woo,M., Kakem,A., Wakeham,A., Potter,J., Reitmair,A., Billia,F., Firpo,E., Hui,C.C., Roberts,J., Rossant,J. and Mak,T.W. (1996) Cell, 85, 1009-1023. MEDLINE Abstract

28 Bezzubova,O., Silbergleit,A., Yamaguchi-Iwai,Y., Takeda,S. and Buerstedde,J.-M. (1997) Cell, 89, 185-193. MEDLINE Abstract

29 Essers,J., Hendriks,R.W., Swagemakers,S.M.A., Troelstra,C., de Wit,J., Bootsma,D., Hoeijmakers,J.H.J. and Kanaar,R. (1997) Cell, 89, 195-204. MEDLINE Abstract

30 Nussenzweig,A., Chen,C., da Costa Soares,V., Sanchez,M., Sokol,K., Nussenzweig,M.C. and Li,G.C. (1996) Nature, 382, 551-555. MEDLINE Abstract

31 Zhu,C., Bogue,M.A., Lim,D.-S., Hasty,P. and Roth,D.B. (1996) Cell, 86, 379-389. MEDLINE Abstract

32 Gu,Y., Jin,S., Gao,Y., Weaver,D.T. and Alt,F.W. (1997) Proc. Natl. Acad. Sci. USA, in press.

33 Jin,S., Inoue,S. and Weaver,D.T. (1997) Cancer Surv., 29, 221-261.


* To whom correspondence should be addressed
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
J. Kenyon and S. L. Gerson
The role of DNA damage repair in aging of adult stem cells
Nucleic Acids Res., December 26, 2007; (2007) gkm1064v1.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z.-H. Zhong, W.-Q. Jiang, A. J. Cesare, A. A. Neumann, R. Wadhwa, and R. R. Reddel
Disruption of Telomere Maintenance by Depletion of the MRE11/RAD50/NBS1 Complex in Cells That Use Alternative Lengthening of Telomeres
J. Biol. Chem., October 5, 2007; 282(40): 29314 - 29322.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
M. B. Burg, J. D. Ferraris, and N. I. Dmitrieva
Cellular Response to Hyperosmotic Stresses
Physiol Rev, October 1, 2007; 87(4): 1441 - 1474.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Med.Home page
S. Difilippantonio, A. Celeste, M. J. Kruhlak, Y. Lee, M. J. Difilippantonio, L. Feigenbaum, S. P. Jackson, P. J. McKinnon, and A. Nussenzweig
Distinct domains in Nbs1 regulate irradiation-induced checkpoints and apoptosis
J. Exp. Med., May 14, 2007; 204(5): 1003 - 1011.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
L. Ciapponi, G. Cenci, and M. Gatti
The Drosophila Nbs Protein Functions in Multiple Pathways for the Maintenance of Genome Stability
Genetics, July 1, 2006; 173(3): 1447 - 1454.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Biol.Home page
M. Di Virgilio and J. Gautier
Repair of double-strand breaks by nonhomologous end joining in the absence of Mre11
J. Cell Biol., December 5, 2005; 171(5): 765 - 771.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
N. I. Dmitrieva, M. B. Burg, and J. D. Ferraris
DNA damage and osmotic regulation in the kidney
Am J Physiol Renal Physiol, July 1, 2005; 289(1): F2 - F7.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Kracker, Y. Bergmann, I. Demuth, P.-O. Frappart, G. Hildebrand, R. Christine, Z.-Q. Wang, K. Sperling, M. Digweed, and A. Radbruch
Nibrin functions in Ig class-switch recombination
PNAS, February 1, 2005; 102(5): 1584 - 1589.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Reina-San-Martin, M. C. Nussenzweig, A. Nussenzweig, and S. Difilippantonio
Genomic instability, endoreduplication, and diminished Ig class-switch recombination in B cells lacking Nbs1
PNAS, February 1, 2005; 102(5): 1590 - 1595.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. G. Jansen, A. Tsaalbi-Shtylik, P. Langerak, F. Calléja, C. M. Meijers, H. Jacobs, and N. de Wind
The BRCT domain of mammalian Rev1 is involved in regulating DNA translesion synthesis
Nucleic Acids Res., January 13, 2005; 33(1): 356 - 365.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
I. Demuth, P.-O. Frappart, G. Hildebrand, A. Melchers, S. Lobitz, L. Stockl, R. Varon, Z. Herceg, K. Sperling, Z.-Q. Wang, et al.
An inducible null mutant murine model of Nijmegen breakage syndrome proves the essential function of NBS1 in chromosomal stability and cell viability
Hum. Mol. Genet., October 1, 2004; 13(20): 2385 - 2397.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
J. Puizina, J. Siroky, P. Mokros, D. Schweizer, and K. Riha
Mre11 Deficiency in Arabidopsis Is Associated with Chromosomal Instability in Somatic Cells and Spo11-Dependent Genome Fragmentation during Meiosis
PLANT CELL, August 1, 2004; 16(8): 1968 - 1978.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. Wicky, A. Alpi, M. Passannante, A. Rose, A. Gartner, and F. Muller
Multiple Genetic Pathways Involving the Caenorhabditis elegans Bloom's Syndrome Genes him-6, rad-51, and top-3 Are Needed To Maintain Genome Stability in the Germ Line
Mol. Cell. Biol., June 1, 2004; 24(11): 5016 - 5027.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
X. Wu, D. Avni, T. Chiba, F. Yan, Q. Zhao, Y. Lin, H. Heng, and D. Livingston
SV40 T antigen interacts with Nbs1 to disrupt DNA replication control
Genes & Dev., June 1, 2004; 18(11): 1305 - 1316.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Lahdesmaki, A. M. R. Taylor, K. H. Chrzanowska, and Q. Pan-Hammarstrom
Delineation of the Role of the Mre11 Complex in Class Switch Recombination
J. Biol. Chem., April 16, 2004; 279(16): 16479 - 16487.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. P. Davis and L. S. Symington
RAD51-Dependent Break-Induced Replication in Yeast
Mol. Cell. Biol., March 15, 2004; 24(6): 2344 - 2351.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. I. Dmitrieva, Q. Cai, and M. B. Burg
Cells adapted to high NaCl have many DNA breaks and impaired DNA repair both in cell culture and in vivo
PNAS, February 24, 2004; 101(8): 2317 - 2322.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
K Heikkinen, S-M Karppinen, Y Soini, M Makinen, and R Winqvist
Mutation screening of Mre11 complex genes: indication of RAD50 involvement in breast and ovarian cancer susceptibility
J. Med. Genet., December 1, 2003; 40(12): e131 - 131.
[Full Text]


Home page
Cancer Res.Home page
V. Dumon-Jones, P.-O. Frappart, W.-M. Tong, G. Sajithlal, W. Hulla, G. Schmid, Z. Herceg, M. Digweed, and Z.-Q. Wang
Nbn Heterozygosity Renders Mice Susceptible to Tumor Formation and Ionizing Radiation-Induced Tumorigenesis
Cancer Res., November 1, 2003; 63(21): 7263 - 7269.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Udayakumar, C. L. Bladen, F. Z. Hudson, and W. S. Dynan
Distinct Pathways of Nonhomologous End Joining That Are Differentially Regulated by DNA-dependent Protein Kinase-mediated Phosphorylation
J. Biol. Chem., October 24, 2003; 278(43): 41631 - 41635.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
N. I. Dmitrieva, D. V. Bulavin, and M. B. Burg
High NaCl causes Mre11 to leave the nucleus, disrupting DNA damage signaling and repair
Am J Physiol Renal Physiol, August 1, 2003; 285(2): F266 - F274.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
C.-X. Deng and R.-H. Wang
Roles of BRCA1 in DNA damage repair: a link between development and cancer
Hum. Mol. Genet., April 2, 2003; 12(90001): R113 - 123.
[Abstract] [Full Text] [PDF]


Home page
Microbiol. Mol. Biol. Rev.Home page
L. S. Symington
Role of RAD52 Epistasis Group Genes in Homologous Recombination and Double-Strand Break Repair
Microbiol. Mol. Biol. Rev., December 1, 2002; 66(4): 630 - 670.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-S. Kim, T. B. Krasieva, V. LaMorte, A. M. R. Taylor, and K. Yokomori
Specific Recruitment of Human Cohesin to Laser-induced DNA Damage
J. Biol. Chem., November 15, 2002; 277(47): 45149 - 45153.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. de Jager, C. Wyman, D. C. van Gent, and R. Kanaar
DNA end-binding specificity of human Rad50/Mre11 is influenced by ATP
Nucleic Acids Res., October 15, 2002; 30(20): 4425 - 4431.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
P. Bundock and P. Hooykaas
Severe Developmental Defects, Hypersensitivity to DNA-Damaging Agents, and Lengthened Telomeres in Arabidopsis MRE11 Mutants
PLANT CELL, October 1, 2002; 14(10): 2451 - 2462.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
M. de Jager and R. Kanaar
Genome instability and Rad50S: subtle yet severe
Genes & Dev., September 1, 2002; 16(17): 2173 - 2178.
[Full Text] [PDF]


Home page
Genes Dev.Home page
C. F. Bender, M. L. Sikes, R. Sullivan, L. E. Huye, M. M. Le Beau, D. B. Roth, O. K. Mirzoeva, E. M. Oltz, and J. H. J. Petrini
Cancer predisposition and hematopoietic failure in Rad50S/S mice
Genes & Dev., September 1, 2002; 16(17): 2237 - 2251.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. P. Robinson, R. McCulloch, C. Conway, A. Browitt, and J. D. Barry
Inactivation of Mre11 Does Not Affect VSG Gene Duplication Mediated by Homologous Recombination in Trypanosoma brucei
J. Biol. Chem., July 12, 2002; 277(29): 26185 - 26193.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
S. P. Jackson
Sensing and repairing DNA double-strand breaks
Carcinogenesis, May 1, 2002; 23(5): 687 - 696.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. van den Bosch, J. B. M. Zonneveld, K. Vreeken, F. A. T. de Vries, P. H. M. Lohman, and A. Pastink
Differential expression and requirements for Schizosaccharomyces pombeRAD52 homologs in DNA repair and recombination
Nucleic Acids Res., March 15, 2002; 30(6): 1316 - 1324.
[Abstract] [Full Text] [PDF]


Home page