Synthesis and hybridization properties of inverse oligonucleotides
Synthesis and hybridization properties of inverse oligonucleotidesMirella Marangoni, Arthur Van Aerschot, Patrick Augustyns1, Jef Rozenski and Piet Herdewijn*
Laboratory of Medicinal Chemistry, Rega Institute for Medical Research, Katholieke Universiteit Leuven, Minderbroedersstraat 10, B-3000 Leuven, Belgium and 1Laboratory of Galenics and Clinical Pharmacy, Katholieke Universiteit Leuven, Herestraat 49, B-3000 Leuven, Belgium
Received April 28, 1997;Revised and Accepted June 11, 1997
ABSTRACT
The synthesis of adenine and thymine cyclopentylethyl nucleosides is presented. This novel constrained monomeric building block is very difficult to incorporate into oligonucleotides. It was introduced in 13mer oligodeoxynucleotide sequences at a single position using H-phosphonate chemistry. Phosphoramidite chemistry completely failed in this particular case. The H-phosphonate building blocks were obtained starting from the corresponding phosphoramidites. Stability of duplexes with RNA and DNA is significantly reduced.
INTRODUCTION
The synthesis of modified oligonucleotides is of great interest in the area of antisense therapeutics as well as for use as tools to study the functions of specific gene products in cells. As natural oligodeoxynucleotides cannot serve as antisense agents, an extensive search for modified substitutes has been carried out. Despite the huge numbers of modified analogues made so far, it is not possible to pinpoint the optimal chemical class of compounds for the desired therapeutic application. As even the most promising candidates suffer from certain drawbacks, there still is a need for new constructs. Previous studies conducted with acyclic nucleosides (1 ), pyranose oligonucleotides (2 ), `bicyclo' oligonucleotides (3 ) and hexitol nucleic acids (4 ) have shown the importance of conformational pre-organization for the hybridization process. Natural nucleic acids have a ribofuranose-phosphate backbone which assures a certain flexibility by altering the puckering mode and through rotation around the phosphorylated CH2OH functions. Here we present the synthesis and hybridization of `inverse oligonucleotides', where the backbone consists of a phosphorylated cyclopentanediol moiety and the heterocyclic base is bound via a flexible ethylene linkage. Compared with the acyclic analogues with a 3(S)-dihydroxypentyl moiety (1 ), the cyclopentylethyl-modified single-stranded oligonucleotide has a more constrained carbocyclic backbone which may minimize entropy loss during duplex formation. Moreover, the ethylene linkage allows the base part to alter position, possibly enabling base pairing with natural nucleic acids (Fig. 1 ). These new oligonucleotides we name `inverse oligonucleotides', as the five membered ring is now placed between the repeating phosphodiester bonds.
RESULTS AND DISCUSSION
The synthesis of the monomeric building block is performed starting from cyclopentanone 1 (Scheme 1 ). The hydroxyethyl dioxabicyclic intermediate 2 can be synthesized in 10 steps following a published procedure (5 -7 ). The enantiomeric pure alcohol 2 is obtained through enzymatic resolution of the racemic ester by hog liver esterase, followed by LiAlH4 reduction as described. The primary alcohol was then protected as its benzoyl derivative 3. The enantiomeric purity of 3 was verified using capillary electrophoresis. Initial experiments using carboxymethylated [beta]-cyclodextrin as a chiral electrolyte modifier showed that baseline separation of enantiomers could be obtained.
However, the minor optical component eluted after the major component and peak tailing prevented reliable determination of the enantiomeric excess. The additional inclusion of hydroxypropyl [beta]-cyclodextrin in the electrolyte resulted in a reversed migration of the enantiomers, allowing improved determination of the minor component in the experimental samples. Typical electropherograms obtained under optimized conditions are shown in Figure 2 and illustrate that 3 could be considered as enantiomerically pure (<1% of the optical antipode).
Following deprotection of the isopropylidene group, deoxygenation of the hydroxyl group at the 2-position of 4 proved difficult. Several strategies were tried out and the most suitable proved to be a Barton-type reduction of the cyclic thiocarbonate 5, yielding 31% of the desired 3-hydroxycyclopentyl derivative 6 and 45% of the 2-hydroxycyclopentyl congener. The resulting secondary hydroxyl group was protected as its dimethoxytrityl ether using the reactive dimethoxytrityl triflate (8 ). Alternative strategies, like selective protection of one of the hydroxyl groups of the diol functionality, either with a silyl moiety or directly with the DMTr group, followed by Barton-type reduction of the remaining secondary hydroxyl group, were not successful. The benzoyl group of 7 was removed by basic treatment and replaced with a tosyl moiety, affording 9. The base moiety was introduced by nucleophilic substitution and the adenine derivative 10 was protected as its n-butylamino formamidine derivative (9 ) to obtain 12 (Scheme 2). Compound 9 was, likewise, used to synthesize the thymine derivative 11 using the lithium salt of the base.
Synthesis of oligonucleotides
Thermal stability of modified oligonucleotides
The synthesized oligonucleotides are shown in Tables 1 and 2 .
The cyclopentylethyl nucleotides were incorporated into a homo-oligomer, affording (dA)6[middot]A*(dA)6 and (dT)6[middot]T*(dT)6 oligonucleotides, where A* and T* represent the modified nucleotide. The melting transitions demonstrate that although the modified adenine and thymine nucleotides maintain discriminatory capacity, hybridizing best with dT and dA respectively, stability of the duplexes is significantly decreased ([Delta]Tm of 4.3 and 11oC). The influence of the modified nucleotide on duplex stability was further investigated using a mixed sequence and the results were compared with those of the acyclic open chain analogues A[=/=] and T[=/=] (Table 2 ). Likewise, stability of the duplex containing natural nucleotides was higher than of duplexes containing the cyclopentylethyl nucleotides. The selectivity of base pairing within this sequence changed for the adenine derivative from AT > AG > AA > AC to A*G > A*T > A*A > A*C, as was also observed before with pyranose nucleosides (11 ) and to a lesser extent with the open chain acyclic nucleosides (1 ) (for structures see Fig. 4 ). This may reflect the preferential formation of purine-purine base pairs when the duplex is locally opened.
Where `bicyclo' oligonucleotides suffered from too much constraint (3 ), we believed the acyclic oligonucleotides (B[=/=]) to be too flexible (1 ). The hybrid structure proposed here (B*) was expected to overcome the disadvantages of the former two. Whereas improved hybridization was therefore expected for the newly described cyclopentylethyl nucleoside analogues B* in comparison with the open chain congeners B[=/=], the stability of all obtained duplexes containing inverse nucleoside analogues proved to be lower (A* < A[=/=], T* < T[=/=]). Analogous results were obtained when evaluated versus a RNA complementary sequence, but determination of the melting temperature displayed a much broader curve.
Thermodynamic calculations were therefore carried out using the `all or none' two state model developed by Gralla and Crothers (12 ; Table 3 ). Although only single incorporations have been accomplished, analysis of the obtained melting curves gives a possible explanation for the obtained results. For the mixed sequence oligonucleotide, as within an A13-T13 homopolymer context, the enthalpy change is consistently lower for oligonucleotides containing an inverse nucleoside analogue (B*) compared with an acyclic one (B[=/=]). The results obtained for the hybrid DNA-RNA duplexes confirm these observations.
Melting temperatures (oC) of hetero-oligomers containing the constraint nucleoside analogues with their complementary sequences
5'-GGCGCCGYCGGTG-3'
3'-CCGCGGCXGCCAC-5'
X
Y
A
T
G
C
T
70.3
59.0
65.0
56.5
T*
62.7
59.1
60.1
54.7
T[=/=]
64.6
59.6
60.7
55.6
A
61.5
70.0
67.0
58.3
A*
60.1
64.3
65.2
56.3
A[=/=]
60.8
65.8
66.7
58.0
As expected, the loss in entropy upon duplex formation is likewise lower for oligonucleotides containing a pre-organized nucleoside analogue, but the difference is insufficient to compensate for the lower enthalpy contribution. The lack of hybridization capabilities therefore is mainly a consequence of reduced base pairing with the natural DNA chain, probably caused by insufficient positioning of the heterocyclic base opposite its complement and by rendering a more hydrophobic character to the duplex at the insertion site.
MATERIALS AND METHODS
Melting points were determined in capillary tubes with a Büchi- Tottoli apparatus and are uncorrected. UV spectra were recorded with a Philips PU 8700 UV/Vis spectrophotometer. The 1H NMR and 13C NMR spectra were determined with a Varian Gemini 200 MHz spectrometer with tetramethylsilane as internal standard for the 1H NMR spectra and CDCl3 (76.9 p.p.m.) for the 13C NMR spectra. 31P NMR spectra were obtained in CDCl3 solution and chemical shifts are reported relative to 85% phosphoric acid/D2O (external standard). (s, singlet; d, doublet; dd, doublet of doublet; t, triplet; br s, broad signal; m, multiplet.) Liquid secondary ion mass spectra (LSIMS) were obtained using a KRATOS Concept IH mass spectrometer. Samples were dissolved in 3-nitrobenzyl alcohol (nba), 2-nitrophenyl octyl ether (npoe), thioglycerol (Thgly) or thioglycerol doped with sodium acetate (Thgly-NaOAc). Electrospray ionization mass spectra were run on a VG Quattro II triple quadrupole system (Micromass, Manchester, UK). The oligonucleotide samples were prepared in an acetonitrile:water (1:1 v/v) mixture containing 0.01 M NH4OAc. The final concentration of the oligonucleotides in the samples was ~20 pmol/[mu]l. Capillary electrophoresis was performed on a Waters 4000 CE system (Waters, Milford, MA). Carboxymethylated [beta]-cyclodextrin polymer and hydroxypropyl [beta]-cyclodextrin were obtained from Cyclolab (Budapest, Hungary) and Amaizo (Hammond, IN) respectively. Other chemicals used were 4-[morpholino]ethane sulfonic acid (MES; Sigma, St Louis, MO), phosphoric acid (UCB, Leuven, Belgium) and HPLC grade methanol (Biosolve, The Netherlands). All compounds were used as received. Water used was obtained from a Milli-Q water purification system (Millipore, Bedford, MA). Column chromatography was performed on Janssen Chimica silica gel (0.060-0.200 nm). Anhydrous solvents were obtained as follows: dichloromethane, pyridine and acetonitrile were stored on calcium hydride, refluxed and distilled; tetrahydrofuran was refluxed overnight on lithium aluminium hydride and distilled. Melting temperatures were determined at 4 [mu]M each strand in 0.1 M NaCl containing 0.02 M potassium phosphate, pH 7.5, and 0.1 mM EDTA. For thermodynamic calculations, absorbance values were sampled at a rate of 2 points/min with an increase in temperature of 0.2oC/min. The derivative at each point on the curve was determined by fitting a regression line to the point in a dynamically specified window containing 40 points (4oC). The transition enthalpy can be calculated from the equation [Delta]H = -18.28/(1/T½ - 1/T¾), as discussed in Loakes and Brown (13 ) and Habener et al. (14 ).
Benzoyl chloride (0.19 ml, 1.6 mmol) was added dropwise to a solution of 2 (0.3 g, 1.5 mmol) in 15 ml dry pyridine at 0oC. The reaction mixture was stirred for 2 h at room temperature, evaporated, dissolved in CH2Cl2 and washed twice with saturated NaHCO3 and brine. The organic layer was dried, evaporated and the resulting solid was used in the next step without further purification. A small sample was purified by column chromatography (hexane: EtOAc 7:1) for analytical purposes.
Crude 3 (starting from 7.5 g, 37 mmol 2) was dissolved in 500 ml 0.06 N HCl:dioxane (1:1) and stirred at 65oC for 3 h. The reaction mixture was cooled to room temperature, neutralized with solid NaHCO3 and concentrated. The residue was extracted with CH2Cl2. Chromatographic purification on silica gel (1, CH2Cl2; 2, CH2Cl2/MeOH, 8:2) yielded 8.45 g (32 mmol, 86%) of a colourless oil.
. Melting temperature (oC) and thermodynamic data for the annealing of tridecadeoxynucleotide duplexes at 4 [mu]M in 0.1 M NaCl
Duplex
Tm (oC)
-[Delta]Ho (KJ/mol)
-[Delta]So (K/mol K)
-[Delta]Go310 (KJ/mol)
3'-GTG GCT GCC GCG G-5'
5'-CAC CGA CGG CGC C-3'
70.1
407.0
1076
73.4
5'-CAC CGA*CGG CGC C-3'
64.3
377.2
1008
64.7
5'-CAC CGA0CGG CGC C-3'
65.8
383.8
1023
66.8
3'-r(GUG GCU GCC GCG G)-5'a
5'-CAC CGA CGG CGC C-3'
61.9
259.5
664.8
53.4
5'-CAC CGA*CGG CGC C-3'
57.0
225.4
573.0
47.8
5'-CAC CGA0CGG CGC C-3'
58.4
235.4
600.3
49.3
3'-GTG GCA GCC GCG G-5'
5'-CAC CGT CGG CGC C-3'
70.0
402.2
1062
72.9
5'-CAC CGT*CGG CGC C-3'
63.0
358.8
958
61.9
5'-CAC CGT0CGG CGC C-3'
64.6
367.0
977
64.2
d(T)13/d(A)13
34.6
321.2
934
31.7
d(T)6T* d(T)6/d(A)13
23.6
294.5
883
20.9
d(T)6T0d(T)6/d(A)13
26.3
320.1
959
22.7
d(A)6A* d(A)6/d(T)13
30.2
318.5
940
27.0
d(A)6A0d(A)6/d(T)13
29.7
320.1
947
26.4
aA 22mer RNA complementary sequence was used with an overhang of five and four bases at the 3'- and 5'-end respectively: 3'-r(CGGGUGUGGCUGCCGCGGGUGG)-5'.
Thiocarbonyl diimidazole (6.22 g, 34.8 mmol) was added to a solution of 4 (8.45 g, 31.7 mmol) in 250 ml dry CH3CN. The reaction mixture was refluxed for 20 h at 120oC. After evaporation under reduced pressure, the residue was purified by column chromatography (hexane:EtOAc, 8:2-1:1), affording 8.8 g (94%) of a colourless oil.
A nitrogen purged solution of tri-n-butyltin hydride and AIBN in 75 ml anhydrous toluene was added dropwise to a refluxing solution of 5 (0.47 g, 1.6 mmol) dissolved in 70 ml anhydrous toluene. After 30 min the solvent was evaporated and the residue purified by column chromatography (hexane:EtOAc, 8:2-2:8), affording 110 mg (30%) of the title compound and 170 mg of the 2'-hydroxy derivative (43%).
Dimethoxytriphenylmethyl triflate (8 ) (0.55 g, 1.2 mmol) was added to a solution of 6 (0.25 g, 0.23 mmol) in 30 ml dry pyridine. The reaction mixture was stirred at room temperature overnight, quenched by addition of a saturated solution of NaHCO3 and extracted with dichloromethane. The organic layer was dried and evaporated under reduced pressure. The residue was purified by column chromatography, affording 0.44 g of a colourless oil (83%).
Compound 7 (0.24 g, 0.44 mmol) was dissolved in 100 ml methanolic ammonia and kept at room temperature for 2 days. After evaporation the residue was purified on a silica gel column eluting with hexane:EtOAc:Et3N (30:70:0.5)/EtOAc (3:7) + 0.5% TEA, affording 0.190 g of a colourless oil (96%).
p-Toluenesulfonyl chloride (0.060 g, 0.31 mmol) was added to a solution of 8 (0.13 g, 0.23 mmol) in anhydrous pyridine and stirred at room temperature overnight. The reaction mixture was concentrated and the residue dissolved in dichloromethane and washed with saturated NaHCO3 and brine. The organic phase was evaporated under reduced pressure and the residue was submitted to the following step without purification.
A mixture of adenine (0.43 g, 3.18 mmol) and LiH (24.3 mg, 6 mmol) in 2 ml dry DMF was stirred at 110oC for 30 min. A solution of the tosyl derivative 9 (0.7 g, 1.16 mmol) in 10 ml DMF was slowly added to this suspension. The reaction mixture was stirred at 110oC for 30 min, cooled to room temperature and evaporated under reduced pressure. The residue was dissolved in ethylacetate and washed with saturated NaHCO3 and with brine. The organic phase was evaporated under reduced pressure and the residue purified by column chromatography (CH2Cl2 to CH2Cl2:5% MeOH in the presence of 0.5% pyridine), affording 0.4 g (62%) of a white foam. UV (MeOH) [lambda]max 262 nm ([epsilon] = 13 300).
A solution of 10 in 2 ml anhydrous MeOH was treated with N,N-di-n-butylformamide dimethyl acetal. The reaction mixture was stirred at room temperature for 4 h. After evaporation under reduced pressure the residue was purified by silica gel column chromatography eluting with CH2Cl2 to CH2Cl2:5% MeOH in the presence of 5% pyridine, affording 0.35 g (82%) of a white foam.
LiH (16.5 mg, 2 mmol) was added to a solution of thymine (0.27 g, 2 mmol) in 2 ml dry DMF. The suspension was stirred at 110oC for 30 min. The tosyl derivative 9, dissolved in 10 ml DMF, was slowly added dropwise to this suspension. The reaction mixture was stirred at 110oC for 30 min and then cooled to room temperature. After evaporation under reduced pressure the residue was dissolved in EtOAc and washed with a saturated solution of NaHCO3 and brine. The organic phase was evaporated under reduced pressure and the residue purified by column chromatography on SiO2 (CH2Cl2 to CH2Cl2:5% MeOH in the presence of 5% pyridine), affording 0.35 g (60%) of a white foam.
General procedure for synthesis of the phosphoramidite derivatives
A mixture of the protected nucleosides 11 and 12, 3 equiv. dry N,N-diisopropylethylamine and 1.5 equiv. cyanoethyl-N,N-diisopropylchlorophosphoramidite in 3 ml dry dichloromethane was stirred at room temperature for 2 h. After addition of 1 ml EtOH and further stirring for 25 min, the mixture was poured into 25 ml dichloromethane and washed with a 5% aqueous NaHCO3 solution and with a saturated NaCl solution, dried and evaporated. Column chromatography on silica gel with n-hexane:acetone:Et3N as eluent afforded the amidite as a foam which was dissolved in a minimal volume of dry dichloromethane and added dropwise to 100 ml cold (-50oC) n-hexane. The precipitate was isolated, washed with n-hexane, dried and used as such for DNA synthesis.(1S,3R)-1-[1'-[N6-((Di-n-butylamino)methylene)adenin-9-yl]- ethyl]-3'-O-(dimethoxytrityl)-1,3-cyclopentanediol-1-cyanoethyl- diisopropyl phosphoramidite (13). Yield 83%. 31P NMR (CDCl3) [delta]: 141.17, 141.56 (d). LSIMS (nba) [M+H]+ 905.(1S,3R)-1-[1'-[Thymin-1-yl)ethyl]-3'-O-(dimethoxytrityl)-1,3- cyclopentanediol-1-cyanoethyl diisopropylphosphoramidite (14). Yield 79%. 31P NMR (CDCl3) [delta]: 141.26, 141.59 (d). LSIMS (npoe) [M-H]- 755.
General procedure for synthesis of the H-phosphonate derivatives
To a solution of the phosphoramidite derivatives 15 and 16 in 5 ml dry acetonitrile was added a solution (0.5 M) of tetrazole in acetonitrile (15 equiv.) followed after 2 min by 4 ml water. After 15 min the reaction mixture was evaporated and than co-evaporated with dioxane. The resultant crude product was dissolved in dry acetonitrile and submitted to [beta] elimination of the cyanoethyl moiety by addition of DBU (10 equiv.). After 15 min stirring at room temperature, the reaction mixture was neutralized with concentrated acetic acid, poured into dichloromethane and washed with TEAB. The organic phase was dried and concentrated under reduced pressure. Purification was performed on silica gel using a MeOH gradient in CH3Cl3:2% TEA as mobile phase.(1S,3R)-1-[1'-[N6-((Di-n-butylamino)methylene)adenin-9-yl]- ethyl]-3'-O-(dimethoxytrityl-1,3-cyclopentanediol-1-H-phosphonate (15). 1H NMR (CDCl3)[delta]: 0.9-0.99 (m, 6H, 2 * CH3); 1.2-2.7 [m, 8H, CH2(2), CH2(4), CH2(5), CH2(2')]; 3.42 (t, 2H, J = 7.3 Hz, H2CN); 3.71 (t, 2H, J = 7.7 Hz, H2CN); 3.78 (s, 6H, 2 * CH3O); 4.22-4.62 [m, 3H, H-3, CH2(1')]; 5.28 (P-H); 6.7, 6.8, 7.1-7.4 (m, 10H, aromatic H); 8.04 (s, 1H, H-2); 8.38 (P-H, J = 620 Hz); 8.5 (s, 1H, H-8); 9.12 (s, H-C=N-). 13C NMR (CDCl3)[delta]: 13.63 and 13.85 (CH3), 19.71 and 20.13 (CH2 n-Bu), 29.18 and 30.84 (-CH2-CH2-N-); 31.65 (C-4); 36.60 (C-5, d, J = 5.29 Hz); 40.2 (C-2', d, J = 8.19 Hz); 45.29 (CH2-N); 46.58 (C-2, d, J = 4.1 Hz); 52.05 (CH2-N); 55.14 (CH3O); 74.12 (C-3); 86.40 (C); 86.63 (C-1, d, J = 7.17 Hz); 125.12 (C-5); 113, 126.58, 127.72, 128.21, 130.04, 137.17 (aromatic C); 142.67 (C-8); 145.87 (aromatic C); 150.69 (C-4); 158.32 (aromatic C); 159.13 (N=CH-N-). 31P NMR (CDCl3)[delta]: -1.69 (d), J = 616.43. LSIMS (Thgly) exact mass calculated for C42H52O6N6P [M-H]- 767.3686; found 767.3676.(1S,3R)-1-[1'-[Thymin-1-yl)ethyl]-3'-O-(dimethoxytrityl)-1,3- cyclopentanediol-1-H-phosphonate (16). 1H NMR(CDCl3)[delta]: 1.4-2.35 [m, 11H, CH2(2), CH2(4), CH2(5), CH2(2'), CH3]; 3.8 (s, 6H, CH3O); 3.92 [m, 2H, CH2(1')]; 5.41 ( m, 1H, H-3); 6.8, 7.11-7.53 (m, 14H, aromatic H); 5.2 and 8.3 (d, 1H, J = 611 Hz, H-P). 13C NMR (CDCl3)[delta]:11.99 (CH3); 31.30 (C-4); 36.4 (d, J = 3.9 Hz, C-5); 38.61 (C-1'); 44.31 (C-2'); 46.54 (d, J = 5.3 Hz, C-2); 54.98 (CH3O); 74.06 (C-3); 86.16 (C-1); 86.32 (C); 109.91 (C-5 of thymine); 112.83, 126.35, 127.5, 128.04, 129.8 (aromatic C); 137.03 (C-6 of thymine); 145.7, 141.29, 137.14 (aromatic C); 150.79 (C-2); 158.11 (aromatic C); 164.36 (C-4). 31P NMR (CDCl3)[delta]: -1.87 (d), J = 614.6 Hz. LSIMS (Thgly-NaOAc) calculated for C33H36N2O8PNa2 [M-H+2Na]+ 665.2005; found 665.2038.
CE operation
Enantiomeric purity of 3 was verified by capillary electrophoresis using a Waters Quanta 4000 CE system (Waters, Milford, MA). Detection occurred with a fixed wavelength UV detector equipped with a mercury lamp and a 185 nm filter. The system was operated at room temperature (21oC) at a constant voltage of 30 kV using the normal polarity mode with detection towards the cathodic end of the capillary. A fused silica capillary of 50 [mu]m internal diameter and 90 cm length was used. The column was stored overnight filled with water. Each day operation was started with a vacuum purge with 0.5 M NaOH followed by water. All runs were preceded by a 4 min purge with the electrolyte. Samples were introduced by gravity-induced siphoning ([Delta]h = 10 cm, 60 s injection time). The electrolyte consisted of 10 mM MES containing 1% hydroxypropyl [beta]-cyclodextrin and 1.5% carboxymethylated [beta]-cyclodextrin polymer; the pH of the electrolyte was adjusted to 6.0 with 1 M H3PO4. The electrolyte was filtered and degassed immediately before use. Data were recorded using the Waters Baseline software.
ACKNOWLEDGEMENTS
We are indebted to Guy Schepers for synthesis of the oligonucleotides and to Mieke Vandekinderen for editorial help. Thanks to E.Esmans and W.Van Dongen for help in obtaining ESI spectra. Dr A.Van Aerschot is a research associate of the Fund for Scientific Research of Flanders. This work has been supported by a grant from the Belgian F.G.W.O. (Fonds voor Geneeskundig Wetenschappelijk Onderzoek, project 3.0105.94), from the Katholieke Universiteit Leuven (GOA 97/11) and from the European Community (Biomed 2-BMH-4-CT96-1439).
REFERENCES
1 Vandendriessche,F., Augustyns,K., Van Aerschot,A., Busson,R., Hoogmartens,J. and Herdewijn,P. (1992) Tetrahedron, 49, 7223-7238, and references therein.
