Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (65K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (23)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Shepard, A. R.
Right arrow Articles by Rae, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shepard, A. R.
Right arrow Articles by Rae, J. L.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 1997 Oxford University Press 3183-3185

Magnetic bead capture of cDNAs from double-stranded plasmid cDNA libraries

Magnetic bead capture of cDNAs from double-stranded plasmid cDNA libraries Allan R. Shepard and James L. Rae*

Departments of Physiology/Biophysics and Ophthalmology, Mayo Foundation, 200 1st Street SW, Rochester, MN 55905, USA

Received April 22, 1997; Revised and Accepted June 16, 1997

ABSTRACT

We have developed a cDNA library screening method which allows the simultaneous screening of >1012 double-stranded plasmid cDNA molecules with minimal a priori sequence knowledge. A biotinylated, gene-specific oligonucleotide probe along with abutting `blocking' oligos is hybridized to the plasmid cDNA library and the target plasmid retrieved with paramagnetic streptavidin beads and transformed into Escherichia coli. Multiple rounds of enrichment with a target plasmid represented at 0.002-0.0001% resulted in over one-third positive clones. Our method will be useful for isolating even the rarest cDNAs starting from ESTs, isolated exons or homologous sequence information.

Current cDNA enrichment procedures available include traditional in situ hybridization (1 ) and the recently developed GenetrapperTM cDNA positive selection system (Life Technologies, Gaithersburg, MD, USA). These methods are capable of isolating the cDNA of interest but may suffer from one or more of the following disadvantages: time-consumption, inefficiency, use of radioactivity, laboriousness, expense, requirement for single-stranded DNA, or requirement for additional enzymatic manipulation of the DNA beyond that used to construct the library. Our method is only limited by the amount of starting sequence information required.

We have developed a rapid, non-radioactive and inexpensive method for the isolation of cDNAs from double-stranded plasmid cDNA libraries based on the principles of streptavidin-coated magnetic bead capture of biotin-labeled probe hybridized to DNA (2 -4 ) (GenetrapperTM cDNA positive selection system, Life Technologies, Gaithersburg, MD, USA). In our method, denatured double-stranded plasmid DNA is hybridized with a single-stranded, gene-specific 5'-biotinylated oligonucleotide probe (25 nt; Fig. 1 ). A key feature of our method is the use of `blocking' oligos (40 nt) directly abutting either side of the probe. The blocking oligos function to reduce re-zippering of the denatured plasmid DNA as demonstrated in a fluorescence polarization based DNA detection method (PanVera Corp., Madison, WI, USA). Our method requires no more than 105 nt of sequence `tag' information to enrich even the rarest cDNAs directly from complex libraries. Captured plasmids are directly electrotransformed into DH10B Escherichia coli, plated on LB agar, and positive clones identified by colony PCR (5 ).


Figure 1. Schematic representation of the magnetic bead capture procedure. Plasmids are represented as concentric circles, oligonucleotides as solid lines, biotin as an asterisk, a streptavidin-coated paramagnetic bead as a solid-filled ball, and the magnet as a cross-hatched rectangle.

We optimized the method using a chloramphenicol- and ampicillin-resistant target plasmid (pSPORT1-CAT, Life Technologies, Gaithersburg, MD, USA) spiked at a known abundance into the background of an ampicillin-resistant plasmid cDNA library. The sense strand biotinylated CAT gene probe and 5' and 3' sense strand blocking oligonucleotide sequences were as follows:

Probe: biotinGACCGTTCAGCTGGATATTACGGCC;

5' block: TTGAGGCATTTCAGTCAGTTGCTCAATGTACCTATAACCA;

3' block:TTTTTAAAGACCGTAAAGAAAAATAAGCACAAGTTTTATC.

In our method, 5 [mu]g ([approx]1012 copies) of double-stranded plasmid cDNA library was mixed with 80 ng of the 5'-biotinylated (Biotin-ONTM Phosphoramidite; Clontech, Palo Alto, CA, USA) probe, and 80 ng of the 5' and 3' neighboring unbiotinylated blocking oligos in a total volume of 9 [mu]l in a 1.5 ml microfuge tube. The oligos may be designed to the sense or antisense strand of the desired cDNA but should be used at the indicated optimized relative concentrations and should be contiguously arrayed. It may be possible to use shorter blocking and probe oligos than outlined in our method, but our results with shortened oligos have been more variable and less efficient (data not shown). The plasmid DNA was denatured by adding 1 [mu]l of 1 N NaOH (0.1 N final) and incubating at room temperature for 5 min. No heat was used in the denaturation since this may nick and linearize the DNA resulting in decreased transformation efficiency (data not shown). The denaturation reaction was neutralized by the addition of 100 [mu]l pre-warmed Tris-hybridization solution (6* SSPE, 0.1% Tween 20, 50 mM Tris-HCl, pH 7.4) and incubated at 37oC for 1 h.

During the hybridization reaction, streptavidin-coated magnetic beads (Dynabeads M-280 Streptavidin; Dynal A.S., Oslo, Norway) were prepared by transferring 20 [mu]l (200 [mu]g) to a 1.5 ml microfuge tube and washing three times with an equal volume of TE buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) and finally resuspending in an original volume of Tris-hybridization solution.

At the end of the hybridization reaction, the 20 [mu]l of washed magnetic beads were transferred to the 110 [mu]l hybridization tube. Probe-hybridized plasmids were captured by incubation for 30 min at room temperature with the beads kept in suspension by taping the tube upright to a Fisher Vortex Genie 2TM (Bohemia, NY, USA) and shaking at a setting of 2 [alternatively a microcentrifuge tube accessory starter set (Fisher Cat. #12-812A) may be used to hold the tube]. The beads were collected with a magnet (Dynal MPC; Dynal A.S., Oslo, Norway) and washed six times with 200 [mu]l wash buffer (2* SSPE pH 7.4, 0.1% Tween 20) and once with 200 [mu]l H2O (in a fresh tube). Beads were resuspended at each step by pipetting up and down twice and the tube subsequently held on the magnet for 15 s. More frequent or stringent washes failed to enhance the recovery of the target plasmid (data not shown). The beads were finally resuspended in 10 [mu]l 0.5* TE buffer and the tube incubated at 80oC for 3 min to thermally release the captured plasmids from the oligos and streptavidin-coated magnetic beads. The beads were immobilized on a magnet for a few seconds and the supernatant promptly transferred to a fresh tube. No further purification of the captured plasmid DNA was necessary since the released blocking oligos do not interfere with the transformation frequency; elimination of the oligos by Microcon spin column (Amicon, Inc., Beverly, MA) purification (Table 1, rows 5a and 5b) does not alter the transformation efficiency.


Table 1 Enrichment of the pSPORT1-CAT target plasmid from a heterologous plasmid cDNA library using our magnetic bead capture procedure with comparison to the Genetrappertm cDNA positive selection system
aFold enrichment is given relative to the starting target:plasmid ratio.

Captured plasmid DNA was electrotransformed into commercially available electrocompetent DH10B E.coli (Life Technologies, Gaithersburg, MD, USA) according to the manufacturer's instructions. Each transformation consisted of 20 [mu]l DH10B and 2 [mu]l captured plasmid. Aliquots of the transformation mixture were subsequently plated on LB agar dishes containing 100 [mu]g/ml carbenicillin (Cb) +- 7.5 [mu]g/ml chloramphenicol (Cm) in order to determine the total colony number and the fraction of pSPORT1-CAT positive colonies.

Depending on the relative abundance of the desired cDNA clone in the library, two or more rounds of enrichment may be necessary. For extremely rare messages (e.g. 0.0001%), we transformed the entire 10 [mu]l of first round captured DNA in 5* 2 [mu]l transformations, plated each transformation on an individual LB + Cb plate, harvested total colonies on each dish for SNAPTM mini-prep DNA isolation (Invitrogen, San Diego, CA), and pooled 1 [mu]g from each mini-prep (5 [mu]g total) for the next round of enrichment. Subsequent rounds were performed transforming with only 2 [mu]l of the 10 [mu]l captured DNA and plating the entire transformation on an individual LB + Cb plate for SNAPTM mini-prep DNA isolation. After the desired number of rounds, transformed bacteria were plated at an appropriate density to yield well-separated individual colonies for colony PCR screening.

We tested several variables in the magnetic bead capture procedure, as shown in Table 1, including the method of denaturing the plasmid double-strand cDNA library (rows 1a-1d), the number of washes with wash buffer (rows 2a-2c), the number and location of the biotin moiety on the probe (rows 3a-3c), the number of rounds of screening (rows 4a-4b), the requirement for blocking oligos (rows 8a-8d) and the sensitivity of the assay (rows 6, 7 and 9a-9c). Optimized conditions from the experiments featured in this table and from experiments not shown were assimilated into the final protocol as outlined above. As proof of concept, we have successfully used the magnetic bead capture procedure to isolate two low-abundance, novel delayed rectifying-like potassium channel cDNAs from a human lens epithelium plasmid cDNA library (manuscripts in preparation).

Our method is comparable in sensitivity and time scale to the Genetrapper method (Table 1, rows 10-13) but requires no enzymatic manipulation of the plasmid cDNA library thus avoiding the single strand intermediate which can cause deletions and rearrangements and avoids the purchase of a relatively expensive kit and its proprietary reagents. A target plasmid represented as one part in 50 000 resulted in, on average, a 1000-fold enrichment after a single round and a 50 000-fold enrichment after two rounds. A target plasmid present as one part in 106 can be enriched 340 000-fold after just three rounds. Thus, even the rarest cDNA clones may be easily identified after multiple rounds of enrichment using our method. Given that each round requires only 1 day to perform, that no radioactivity is used, and that the procedure can be accomplished with readily obtainable materials, we feel our method will be of general use for isolating cDNA clones based on EST, isolated exons or homologous sequence information.

ACKNOWLEDGEMENTS

We thank Sara Braun, Jerry Dewey, Helen Hendrickson and Joan Rae for technical support and Kristy Zodrow for secretarial assistance. Supported by NIH grants EY06005 and EY03282 and by the Mayo Foundation.

REFERENCES

1 Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

2 Pippin,J., Contractor,V. and Ambrus,J.L.,Jr (1994) Biotechniques, 16, 676-678, 680. MEDLINE Abstract

3 Tagle,D.A., Swaroop,M., Lovett,M. and Collins,F.S. (1993) Nature, 361, 751-753. MEDLINE Abstract

4 Rosenthal,A., Platzer,M. and Charnock-Jones,S. (1994) In Mullis,K.B., Ferre,F. and Gibbs,R.A. (eds), The Polymerase Chain Reaction. Birkhauser, Boston, pp. 222-229.

5 Sandhu,G.S., Precup,J.W. and Kline,B.C. (1989) Biotechniques, 7, 689-690.

&form=6&uid=90211903&Dopt=r">MEDLINE Abstract

RELATED PAPERS RECENTLY PUBLISHED IN NUCLEIC ACIDS RESEARCH

Hakvoort,T.B., Spijkers,J.A., Vermeulen,J.L. and Lamers,W.H. (1996) Preparation of a differentially expressed full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments. Nucleic Acids Res., 24, 3478-3480.

Kato,K. (1995) Description of the entire mRNA population by a 3' end cDNA fragment generated by class IIS restriction enzymes. Nucleic Acids Res., 23, 3685-3690.

Ivanova,N.B. and Belyavsky,A.V. (1995) Identification of differentially expressed genes by restriction endonuclease-based gene expression fingerprinting. Nucleic Acids Res., 23, 2954-2958.

*To whom correspondence should be addressed. Tel: +1 507 284 8127; Fax: +1 507 284 8566; Email: rae.james@mayo.edu
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 GeneticsHome page
E. Hamilton, P. Bruns, C. Lin, V. Merriam, E. Orias, L. Vong, and D. Cassidy-Hanley
Genome-Wide Characterization of Tetrahymena thermophila Chromosome Breakage Sites. I. Cloning and Identification of Functional Sites
Genetics, August 1, 2005; 170(4): 1611 - 1621.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
G. L. Lyford, P. R. Strege, A. Shepard, Y. Ou, L. Ermilov, S. M. Miller, S. J. Gibbons, J. L. Rae, J. H. Szurszewski, and G. Farrugia
alpha 1C (CaV1.2) L-type calcium channel mediates mechanosensitive calcium regulation
Am J Physiol Cell Physiol, September 1, 2002; 283(3): C1001 - C1008.
[Abstract] [Full Text] [PDF]

Home page
 MicrobiologyHome page
L. D. Bowler, M. Hubank, and B. G. Spratt
Representational difference analysis of cDNA for the detection of differential gene expression in bacteria: development using a model of iron-regulated gene expression in Neisseria meningitidis
Microbiology, December 1, 1999; 145(12): 3529 - 3537.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
A. R. Shepard and J. L. Rae
Electrically silent potassium channel subunits from human lens epithelium
Am J Physiol Cell Physiol, September 1, 1999; 277(3): C412 - C424.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
R. A. Chavez, A. T. Gray, B. B. Zhao, C. H. Kindler, M. J. Mazurek, Y. Mehta, J. R. Forsayeth, and C. S. Yost
TWIK-2, a New Weak Inward Rectifying Member of the Tandem Pore Domain Potassium Channel Family
J. Biol. Chem., March 19, 1999; 274(12): 7887 - 7892.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
N. O. Bukanov, V. V. Demidov, P. E. Nielsen, and M. D. Frank-Kamenetskii
PD-loop: A complex of duplex DNA with an oligonucleotide
PNAS, May 12, 1998; 95(10): 5516 - 5520.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. I. Muir, L. Chamberlain, N. A. Elshourbagy, D. Michalovich, D. J. Moore, A. Calamari, P. G. Szekeres, H. M. Sarau, J. K. Chambers, P. Murdock, et al.
AXOR12, a Novel Human G Protein-coupled Receptor, Activated by the Peptide KiSS-1
J. Biol. Chem., July 27, 2001; 276(31): 28969 - 28975.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (65K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (23)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Shepard, A. R.
Right arrow Articles by Rae, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shepard, A. R.
Right arrow Articles by Rae, J. L.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?