Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (289K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (69)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Girard, P. M.
Right arrow Articles by Boiteux, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Girard, P. M.
Right arrow Articles by Boiteux, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 1995 Oxford University Press 3204-3211

The Ogg1 protein of Saccharomyces cerevisiae: a 7,8-dihydro-8-oxoguanineDNA glycosylase/AP lyase whose lysine 241 is a critical residue for catalytic activity

The Ogg1 protein of Saccharomyces cerevisiae : a 7,8-dihydro-8-oxoguanine DNA glycosylase/AP lyase whose lysine 241 is a critical residue for catalytic activity Pierre-Marie Girard, Nathalie Guibourt and Serge Boiteux*

Laboratoire de Radiobiologie du DNA, CEA/DSV, UMR217 Centre National de la Recherche Scientifique, Département de Radiobiologie et Radiopathologie, BP6, F-92265 Fontenay aux Roses, France

Received May 28, 1997; Revised and Accepted June 27, 1997

ABSTRACT

The OGG1 gene of Saccharomyces cerevisiae codes for a DNAglycosylase that excises 7,8-dihydro-8- oxoguanine (8-OxoG) and 2,6-diamino-4-hydroxy-5-N-methylformamidopyrimidine (Fapy) from damaged DNA. In this paper, we have analysed the substrate specificity and the catalytic mechanism of the Ogg1 protein acting on DNA subtrates containing 8-OxoG residues or apurinic/apyrimidinic (AP) sites. The Ogg1 protein displays a marked preference for DNA duplexes containing 8-OxoG placed opposite a cytosine, the rank order for excision of 8-OxoG and cleavage efficiencies being 8-OxoG/C > 8-OxoG/T >> 8-OxoG/G and 8-OxoG/A. The cleavage of the DNA strand implies the excision of 8-OxoG followed by a [beta]-elimination reaction at the 3'-side of the resulting AP site. The Ogg1 protein efficiently cleaves a DNA duplex where a preformed AP site is placed opposite a cytosine (AP/C). In contrast, AP/T, AP/A or AP/G substrates are incised with a very low efficiency. Furthermore, cleavage of 8-OxoG/C or AP/C substrates implies the formation of a reaction intermediate that is converted into a stable covalent adduct in the presence of sodium borohydre (NaBH4). Therefore, the Ogg1 protein is a eukaryotic DNA glycosylase/AP lyase. Sequence homology searches reveal that Ogg1 probably shares a common ancestor gene with the endonuclease III of Escherichia coli. A consensus sequence indicates a highly conserved lysine residue, K120 of endonuclease III or K241 of Ogg1, respectively. Mutations of K241 to Gln (K241Q) and Arg (K241R) have been obtained after site directed mutagenesis of OGG1. Mutation K241Q completely abolishes DNA glycosylase activity and covalent complex formation in the presence of NaBH4. However, the K241Q mutant still binds DNA duplexes containing 8-OxoG/C. In contrast, K241R mutation results in a catalytically active form of Ogg1. These results strongly suggest that the free amino group of Lys241 is involved in the catalytic mechanism of the Ogg1 protein.

INTRODUCTION

Free radicals and reactive oxygen species (ROS) can attack DNA causing base and sugar damage (1 ). Oxidative DNA damage has been suggested to play a role in the etiologies of degenerative pathologies in man such as cancer and aging (2 -4 ). Several lines of evidence suggest that an oxidatively damaged form of guanine, 7,8-dihydro-8-oxoguanine (8-OxoG), is a highly mutagenic DNA lesion (5 ,6 ). Escherichia coli possesses two DNA glycosylases that prevent mutagenesis by 8-OxoG: the Fpg protein which excises 8-OxoG in damaged DNA and the MutY protein which excises the adenine residues incorporated by DNA polymerases opposite 8-OxoG (5 -7 ). Inactivation of both the fpg (mutM) and mutY (micA) genes of E.coli results in a strong GC -> TA mutator phenotype (8 -10 ). In Saccharomyces cerevisiae, the OGG1 gene encodes a protein of 376 amino acids, the Ogg1 protein, which possesses a DNA glycosylase activity that catalyses the removal of 8-OxoG and Fapy residues from damaged DNA (11 ). Recently, we have demonstrated that Ogg1-deficient strains of S.cerevisiae exhibit a mutator phenotype and specifically accumulate GC -> TA transversions (12 ). These results show that base excision repair of 8-OxoG, by proteins like Fpg or Ogg1, protects genomes from the deleterious action of ROS in prokaryotes or in eukaryotes (13 ).

The Fpg protein of E.coli was initially isolated as a DNA glycosylase which excises Fapy residues in alkylated DNA (14 ,15 ). The Fpg protein also releases other damaged purines such as 2,6-diamino-4-hydroxy-5-formamidopyrimidine (Fapy-G), 4,6-diamino-5-formamidopyrimidine (Fapy-A) and 8-oxoG (16 -19 ). Besides its DNA glycosylase activity, the Fpg protein has a physically associated activity which incises DNA at apurinic/ apyrimidinic (AP) sites and another activity which removes 5'-terminal deoxyribose-phosphate from DNA (20 -22 ). The AP nicking mechanism implies successive [beta]- and [delta]-elimination reactions leaving a single nucleoside gap in DNA (20 ,23 ).

The Ogg1 protein of S.cerevisiae which excises Fapy and 8-OxoG is also endowed with an AP nicking activity (11 ). It was proposed that the strand cleavage at the 3' side of an AP site occurs via a [beta]-elimination reaction (11 ,24 ). Several studies have led to the emergence of a unified catalytic mechanism for DNA glycosylases/AP lyases such as Fpg protein or endonuclease III of E.coli (25 ,26 ). These enzymes proceed by a nucleophilic attack at the sugar of the damaged base nucleotide using an imino group as the attacking nucleophile. The consequence is the formation of an imino enzyme-DNA intermediate as the product of the glycosylase step. Sodium borohydride has been used to trap this intermediate in reactions catalysed by DNA glycosylases/AP lyases (24 -27 ).

In this study, we report an analysis of the substrate specificity and of the catalytic mechanism of the Ogg1 protein of S.cerevisiae. The results show that the Ogg1 protein has a marked preference for lesions, either 8-OxoG or AP sites, placed opposite a cytosine in DNA. The mechanisms of strand cleavage for both 8-OxoG/C and AP/C duplexes imply the formation of a Schiff base intermediate which can be converted into a stable adduct in the presence of NaBH4. The results also show that lysine 241 is a crucial residue for the catalytic activities of the Ogg1 protein but not for DNA binding.

MATERIALS AND METHODS

Bacterial strains, plasmids and enzymes

Escherichia coli strains BH410 (fpg::Kanr) and PR195 (fpg::Kanr mutY::Kanr) and plasmid pYSB10 containing the OGG1 gene of S.cerevisiae were from our laboratory (11 ,28 ,29 ). Endonuclease III (Nth), endonuclease IV (Nfo), uracil DNA glycosylase and Fpg protein from E.coli were purified from overproducing strains. Restriction endonucleases, DNA polymerases, T4 polynucleotide kinase and T4 DNA ligase were from commercial sources.

Recombinant DNA methods

Plasmid pYSB10 was used as a template in a PCRreaction to amplify OGG1. Primer 1 was used to engineer an EcoRI restriction site at the beginning of OGG1 (start codon is in bold). Primer 2 was used to introduce a HindIII restriction site at the end of OGG1 (stop codon is in bold).

Primer 1: 5'-CCGGAATTCATGTCTTATAAATTCGG-3'

Primer 2: 5'-GCCCAAGCTTCTAATCTATTTTTGCTTC-3'

The amplified fragment containing the OGG1 gene was cloned into plasmid pKK223-3 (Pharmacia) after digestion by EcoRI and HindIII restriction enzymes yielding the pYSB160 plasmid. The sequence of the OGG1 gene in pYSB160 does not reveal mutations when compared with the published sequence of the OGG1 gene (11 ).

Site-directed mutagenesis

The Altered site II Systems (Promega) was used to introduce single base pair mutations in the OGG1 gene. For this purpose, OGG1 from pYSB160 was cloned in the pALTER-1 vector between the EcoRI and HindIII sites. The following oligonucleotides were used to generate the mutant Ogg1 proteins where the base resulting in the Lys (K) -> Gln (Q) or Lys -> Arg (R) substitutions are indicated in bold type and underlined: K241Q protein, GGTGTAGGCCCCCAAGTTGCTGATTGC; K241R protein, GGTGTAGGCCCCAGAGTTGCTGATTGC. Following mutagenesis, the sequences were verified and the EcoRI/HindIII fragments were inserted into the pKK223-3 vector yielding the pYSB161(K241Q) and pYSB162(K241R) plasmids, respectively.

Purification of the Ogg1 protein

The Ogg1 protein was purified from isopropyl [beta]-d-thiogalactopyranoside (IPTG)-induced E.coli BH410 (fpg-) hosting pYSB160. The cells (29 g) were resuspended in 200 ml of Buffer A (25 mM Tris-HCl pH 7.6, 2 mM Na2EDTA and 5% glycerol) containing 250 mM NaCl. The cell suspension was supplemented with lysozyme (1 mg/ml) and incubated at 0oC for 20 min, followed by 15 min at 37oC and 15 min at -80oC. The resulting lysate was centrifuged at 130 000 g for 45 min at 4oC. The supernatant fraction was taken as crude extract (fraction I: 200 ml). Fraction I was loaded onto a QMA-Acell anion exchange column (Waters) equilibrated with Buffer A containing 250 mM NaCl. The Fapy DNA glycosylase activity was not retained under these conditions (fraction II: 380 ml). Fraction II was dialysed against Buffer A containing 50 mM NaCl and applied to a Phospho-Ultrogel A6 column (IBF-LKB). Proteins were eluted with a linear salt gradient (50-600 mM NaCl). Fractions containing the activity eluted at 350 mM NaCl (fraction III: 130 ml). Fraction III was precipitated using ammonium sulfate, 500 g/l (w/v). The precipitate was collected by centrifugation and resuspended in Buffer A containing 1 M NaCl and loaded onto an AcA54 gel filtration column (IBF-LKB). Fractions containing the activity (fraction IV: 43 ml) were dialysed against Buffer A containing 100 mM NaCl and loaded onto a double-stranded DNA cellulose column (Sigma). Proteins were eluted with a linear salt gradient (100-800 mM NaCl). The active fractions eluted at 500 mM NaCl (fraction V: 12 ml). Fraction V was dialysed against Buffer A containing 100 mM NaCl and loaded onto a MonoS HR5/5 (FPLC, Pharmacia). Proteins were eluted with a salt gradient (100-800 mM NaCl). Fractions containing the activity eluted at 450 mM NaCl (fraction VI: 4 ml). Protein concentration was measured according to Bradford (30 ).

Fapy DNA glycosylase activity assay

The [3H]Fapy-poly(dG-dC) was prepared as previously described (31 ). The assay mixture (100 [mu]l) was composed of 25 mM Tris-HCl pH 7.6, 100 mM KCl, [3H]Fapy-poly(dG-dC) and Ogg1 protein. The reaction was carried out at 37oC for 15 min. Ethanol-soluble radioactive material was quantitated and the chemical nature of this material was monitored by HPLC (31 ).

8-OxoG DNA glycosylase assay

The assay mixture (50 [mu]l) contained 25 mM Tris-HCl pH 7.6, 100 mM KCl, 10 pmol 8-OxoG/N duplex (34mer DNA duplexes containing a single 8-OxoG placed opposite each of the four DNA bases in the complementary strand) and Ogg1 protein. The reaction was carried out at 37oC for 15 min. The products of the reaction were analysed by HPLC with electrochemical detection as previously described (11 ).

Assay for nicking activity at 8-OxoG

The 34mer oligonucleotide containing a single 8-oxoG was synthesized as previously described (32 ): 5'-GGCTTCATCGTTATT(8-OxoG)ATGACCTGGTGGATACCG-5'*. Complementary sequences with a C, T, G or A placed opposite 8-OxoG after hybridization were also synthesized. The nucleotide at the 3'-end was inverted yielding a 5'-(N)n-3'-P-3'-N-5'* sequence with two 5'-ends (33 ). Thus, the 34mer containing 8-OxoG was labelled at both ends using [[gamma]-32P]ATP (3000 Ci/mmol) and T4 polynucleotide kinase (32 ,33 ). The labeled strand was hybridized with a complementary sequence yielding 8-OxoG/N duplexes. The assay mixture (20 [mu]l) contained 25 mM Tris-HCl pH 7.6, 2 mM Na2EDTA, 100 mM KCl, 50 fmol of 32P-labeled 8-OxoG/N duplex and Ogg1 protein. The reactions were performed at 37oC for 15 min. The products of the reactions were separated by 20% PAGE containing 7 M urea. Cleavage was quantitated after scanning of the autoradiographs using the NIH V1.59 software.

Assay for nicking activity at AP sites

The 30mer oligonucleotide containing a single uracil residue and the four complementary sequences with C, T, G or A placed opposite the uracil after hybridization were of commercial origin: 5'-TACGGATCGCAG(U)TGGGTTAGGGAAGTTGG-3'. This 30mer oligonucleotide was 32P-labeled at the 5'-end and annealed with one of the four complementary sequences yielding U/N duplexes. To generate AP sites, 500 fmol of each U/N duplex was incubated with 20 ng of purified uracil DNA glycosylase for 15 min at 37oC yielding the AP/N duplexes (30mer DNA duplexes containing a single AP site placed opposite each of the four DNA bases in the complementary strand). Assay conditions are as described for 8-OxoG/C nicking assay.

Formation of enzyme-DNA covalent complexes (trapping assay)

The trapping assays were performed using either 8-OxoG/N (Reaction 1) or AP/N (Reaction 2) duplexes as substrates. Reaction 1 (20 [mu]l) contained 25 mM Tris-HCl pH 7.6, 2 mM Na2EDTA, 100 fmol labelled 8-OxoG/N duplex and 50 mM of either NaBH4, NaCNBH3 or NaCl. Finally, 50 ng of either Ogg1 or Fpg protein was added to the mixture. The reaction was carried out at 37oC for 20 min. Reaction 2 (20 [mu]l) contained 25 mM Tris-HCl buffer pH 7.6, 2 mM Na2EDTA and 100 fmol labeled AP/N duplex, 50 mM NaBH4 and 50 ng of Ogg1 protein. Immediately before the reaction, the Ogg1 protein was premixed with NaBH4 and added to the rest of the assay mixture. The reaction was carried out at 4oC for 20 min followed by 5 min at 37oC. The reactions were stopped by addition of 10 [mu]l SDS-PAGE loading buffer/formamide blue dye and heating at 90oC for 3 min. The products of the reactions were separated onto 10-20% gradient SDS-PAGE and analysed as previously described.

Gel retardation assay with bacterial crude extracts

Binding reactions were performed at 4oC for 20 min. The reaction mixture (20 [mu]l) contained 50 mM Tris-HCl pH 7.6, 100 mM KCl, 2 mM Na2EDTA, 5% glycerol, 0.2 mg/ml poly(dI-dC), 100 pM (8000 c.p.m.) of 32P-labelled 8-OxoG/C oligonucleotide duplex and 10 [mu]g of proteins from bacterial crude lysate. The samples were analysed using non-denaturing 10% PAGE as described by Castaing et al. (34 ).

Antibody preparation and immunoblotting

Polyclonal antibodies against Ogg1 were obtained after immunisation of female New Zealand rabbits. Antibodies were purified from the antiserum and the resulting preparation was referred to as BCE-1691.Total proteins from bacterial extracts were separated using 12.5% SDS-PAGE and transferred to Hybond-C membranes (Amersham). Western blots were performed using BCE-1691 at a dilution of 1:10 000 in phosphate buffered saline-0.1% Tween 20 (pH 7.4). Western blots were then developed using an anti-rabbit horseradish peroxidase-conjugated (Amersham) and detected with the BM chemiluminescence blotting substrate (POD) system (Boehringer).

Determination of mutation frequencies in E.coli

PR195 cells harbouring either the pKK223-3, pYSB160, pYSB161 or pYSB162 vectors were grown in LB broth containing 100 [mu]g/ml ampicillin and 0.5 mM IPTG. To determine the spontaneous frequencies of rifampicin-resistant mutants and lactose revertants, appropriate dilutions of at least 10 overnight cultures, originally inoculated with 103 cells, were plated on either LB agar, LB agar with rifampicin (100 [mu]g/ml), or minimal lactose (0.2%) agar. Colonies were counted the following day in the case of the LB plates and 48 h after plating for the minimal lactose plates.

RESULTS

Purification of the Ogg1 protein

To overproduce the Ogg1 protein, the coding sequence of the OGG1 gene of S.cerevisiae was PCR-amplified and cloned in the expression vector pKK223-3 yielding the pYSB160 plasmid. The Ogg1 protein was purified from IPTG-induced E.coli BH410 (fpg::Kanr) cells harbouring pYSB160 (Table 1 ). The release of Fapy residues from [3H]Fapy-poly(dG-dC) was used as an activity assay during the course of the purification. The purity of the final fraction VI was assessed by the observation of a single protein band on a SDS-PAGE with a molecular weight of 43 kDa (Fig. 1 ). This 43 kDa polypeptide was transfered to a membrane and the N-terminal sequence was determined. The unique N-terminal sequence for the 10 first amino acids was (Ser-Tyr-Lys-Phe-Gly-Lys-Leu-Ala-Ile-Asn). This sequence is identical to that deduced from the nucleotide sequence of OGG1 which is confirmed as the structural gene coding for the Ogg1 protein.


Figure 1. SDS-PAGE analysis of the Ogg1 protein purification fractions. Lane M, molecular weight markers (Pharmacia); lanes I-VI, purification steps of the Ogg1 protein (Fig. 1). The amounts of protein loaded on the gel are: lanes I and II, 50 [mu]g; lanes III and IV, 10 [mu]g; lanes V and VI, 2 [mu]g. The gel was 15% acrylamide, 0.4% bis-acrylamide and stained with Coomassie brilliant blue.

Repair of 8-OxoG/N substrates by the Ogg1 protein and probing for imino enzyme-DNA intermediate

The substrate specificity of the Ogg1 protein was investigated using as substrates 34mer oligonucleotides containing a single 8-OxoG placed opposite each of the four DNA bases. The release of 8-OxoG as a free base was determined using HPLC with electrochemical detection (11 ). Figure 2 a shows that the Ogg1 protein preferentially excises 8-OxoG placed opposite a cytosine as compared to the three other mismatches, the efficiency order being 8-OxoG/C > 8-OxoG/T >> 8-OxoG/G and 8-OxoG/A. We have also analysed the cleavage of 8-OxoG/N duplexes by the purified Ogg1 protein. Figure 2 b shows that Ogg1 cleaves efficiently 8-OxoG/C duplex as compared to 8-OxoG/T. Furthermore, the incision of 8-OxoG/G and 8-OxoG/A duplexes occurs at a very slow rate (Fig. 2 b) as previously described (11 ,24 ).


Figure 2. Repair by the Ogg1 protein of 34mer DNA duplexes containing a single 8-OxoG residue placed opposite each of the four DNA bases. Each 8-OxoG/N duplex was incubated with purified Ogg1 protein for 15 min at 37oC and the products of the reaction were separated (a) by HPLC and analysed with electrochemical detection (b) on denaturing 20% PAGE containing 7 M urea.

Table 1 Purification of the Ogg1 protein
Step

Protein

Specific activity

Yield

Purification

 

(mg)

(U/mg)

%

(fold)

I. Crude extract

2080

23

100

1

II. QMA-Acell

1976

30

100

1

III. Phospho-Ultrogel

248

159

82

7

IV. Ultrogel AcA54

48

645

65

28

V. DNA-cellulose

10

1260

26

55

VI. MonoS-FPLC

2.6

2365

13

103

The Ogg1 protein was purified from 29 g of IPTG-induced E.coli BH410 (fpg-) harboring the pYSB160 plasmid. The Fapy DNA glycosylase activity was measured using [3H]Fapy-poly(dG-dC) as substrate. One unit releases 1 pmol of Fapy in 15 min at 37oC. Purification steps are as described in Materials and Methods.


Figure 3. Analysis of the reaction products of the incision by the Fpg or the Ogg1 proteins of a 34mer oligonucleotide substrate containing a single 8-OxoG placed opposite a cytosine. The 8-OxoG containing strand was labeled at both ends and annealed with a complementary sequence with a cytosine opposite the lesion. The 8-OxoG/C duplex was incubated for 15 min at 37oC in the presence of 1 ng of Ogg1 or Fpg proteins. The enzymes were inactivated by heating for 5 min at 50oC. Reaction mixtures were then incubated with 10 ng of either endonuclease III (Nth) or endonuclease IV (Nfo). Hot piperidine (Pip) treatment was with 1 M of piperidine for 90 min at 90oC. The products were separated by denaturing 20% PAGE containing 7 M urea. PPRD1, PPRD2, P3 and P4 bands are described in the Results section.
>

Our understanding of the mechanism of strand cleavage by the Ogg1 protein required the identification of the 3'- and 5'-ends of the DNA fragments resulting from the incision of the 8-OxoG/C duplex. Figure 3 shows an analysis of the 8-OxoG/C substrate reacted with either Ogg1 or Fpg protein. The Fpg protein (lane 1) generates two fragments which are identical to those generated by hot piperidine treatment (lane 5), namely PPRD1 (5'-P-[N17]-3'-P- 3'-N-[32P]-5') and PPRD2 (5'-[32P]-[N15]-3'-P) (32 ,35 ). These two fragments are the products of successive [beta]- and [delta]-elimination reactions at the AP site resulting from the excision of the 8-OxoG lesion, leaving a single nucleoside gap limited by 3'- and 5'-phosphate ends in DNA. (7 ,20 ,23 ). As expected, the products generated by the Fpg protein are not modified by endonuclease III (Fig. 3 , lane 2). On the other hand, the PPRD2 product generated by Fpg is converted into the P4 product (5'-[32P]-[N15]-3'-OH) after removal of phosphorus at the 3'-end of PPRD2 by the Nfo protein (Fig. 3 , lane 3). The Ogg1 protein generates a DNA fragment which comigrates with PPRD1 and another product which migrates as a doublet, P3 (5'-[32P]- [N15]-3'-P-dR) (Fig. 3 , lane 6). Similarly, a doublet has been observed after nicking at the 3'-side of an AP site by the endonuclease III of E.coli leaving an unsaturated sugar at the 3'-end of the 5'-DNA fragment (20 ). These results imply that the Ogg1 protein, as in the case of endonuclease III, catalyses a [beta]-elimination reaction. To reinforce this conclusion, the cleavage products generated by the Ogg1 protein were incubated in the presence of other repair enzymes or hot piperidine. The addition of the endonuclease III (Nth) after Ogg1 does not result in alteration of cleavage products nor additional cleavage of the 34mer (Fig. 3 , lane 7). This observation suggests that the Ogg1 protein possesses an AP nicking activity which is not limiting in our assay conditions. The addition of endonuclease IV (Nfo) after cleavage by the Ogg1 protein results in a quantitative convertion of the P3 product yielding the P4 product (5'-[32P]-[N15]-3'-OH) (Fig. 3 , lane 8). The P4 product is probably generated by the release of the deoxyribose-phosphate at the 3'-end of the P3 fragment by the Nfo protein (Fig. 3 , lane 8). Finally, treatment of the DNA products generated by the Ogg1 protein with 1 M piperidine provokes the modification of the P3 product to yield PPRD2 (Fig. 3 ; lane 9). It can be seen that the PPRD1 fragment is not modified by any treatment (Fig. 3 ). These results strongly suggest that the mechanism of strand cleavage by the Ogg1 protein implicates the release of the 8-OxoG residue followed by a [beta]-elimination reaction at the 3'-side of the resulting AP site.


Figure 4. Formation by NaBH4 or NaCNBH3 reduction of a covalent complex between Ogg1 or Fpg protein and a 34mer DNA duplex containing a single 8-OxoG. Fifty nanograms of Ogg1 (1.16 pmol) or Fpg (1.66 pmol) proteins were allowed to react with 0.1 pmol of a labeled 34mer duplex containing a single 8-OxoG paired with a cytosine in the presence of 50 mM NaCl, NaBH4 or NaCNBH3 as described in Materials and Methods. The products of the reactions were analysed using a 10-20% polyacrylamide gradient SDS-PAGE allowing the identification of intact DNA, cleavage products and DNA-protein complexes (trapped complex). The molecular weight marker is as in the legend of Figure 1.

Themechanism of DNA strand cleavage after excision of base damage has been established for T4 endonuclease V, Micrococcus luteus UV-endonuclease, endonuclease III and Fpg proteins from E.coli. These proteins use an amino group as a nucleophile to attack at the C-1' of the sugar moiety leading to the formation of an enzyme-DNA Schiff base intermediate (26 ,27 ,36 ,37 ). To probe for such an intermediate, the Ogg1 protein was allowed to react with a labeled 8-OxoG/C substrate in the presence of reducing agents such as NaCNBH3 or NaBH4 and the products of the reactions were analysed by SDS-PAGE. Figure 4 shows that NaBH4 or NaCNBH3 in the assay mixture results both in the inhibition of the cleavage activity of the Ogg1 protein and in the formation of a shifted band (trapped complex) with an apparent molecular weight of between 55 and 60 kDa (Fig. 4 , lanes 4 and 6). The Ogg1-DNA complex can be digested with proteinase K to yield a product which co-migrates with free DNA (data not shown). Control experiments show the cleavage of the 8-OxoG/C substrate by the Ogg1 protein in the presence of NaCl (Fig. 4 , lane 8). Figure 4 also shows the formation of an Fpg-DNA complex with an apparent molecular weight of between 40 and 45 kDa (lanes 5 and 7) confirming other studies (26 ,27 ). These results suggest that the Ogg1 protein forms a transient Schiff base intermediate which is converted into a covalent protein-DNA adduct in the presence of NaBH4. Furthermore, we used the four 8-OxoG/N substrates for Ogg1-DNA trapping assay. Indeed, the rank order for Ogg1 mediated DNA trapping efficiency was as follows, 8-OxoG/C >> 8-OxoG/T >> 8-OxoG/G or 8-OxoG/A (data not shown), paralleling the cleavage efficiency. These conclusions are fully in accord with a recent independent study (24 ).

Cleavage of AP/N substrates by the Ogg1 protein and probing for an imino enzyme-DNA intermediate

Our study shows that the Ogg1 protein is a DNA glycosylase/AP lyase that cleaves DNA after the removal of a damaged base. However, we have not demonstrated that the Ogg1 protein possesses an activity that nicks DNA at preformed AP sites. Therefore, we have prepared 30mer DNA substrates, AP/N, in which a single AP site was placed opposite each of the four DNA bases. Figure 5 shows that the Ogg1 protein very efficiently cleaves the AP/C duplex where a cytosine was placed opposite the AP site. Indeed the cleavage efficiency of the AP/C substrate is similar to that of the 8-OxoG/C in a parallel reaction (Fig. 5 , insert). In contrast, the AP/T duplex is a very poor substrate for the Ogg1 protein and AP/G and AP/A duplexes are not incised at all (Fig. 5 ). Furthermore, the reduction of the AP site with NaBH4 before the reaction with Ogg1 makes the AP/C duplex resistant to cleavage by the Ogg1 protein (data not shown). These results strongly suggest that the Ogg1 protein possesses an intrinsic AP lyase activity.


Figure 5. Cleavage of 30mer DNA duplexes containing a single AP site placed opposite each of the four DNA bases by the Ogg1 protein. The 30mer sequence used is reported in Materials and Methods. The AP site results from the excision of U13 by the uracil DNA glycosylase from E.coli. The AP site containing strand was 32P-labeled at the 5'-end and annealed with each of the four possible complementary sequences. Each AP/N duplex was incubated with purified Ogg1 protein for 15 min at 37oC and the products of the reaction were separated on denaturing 20% PAGE containing 7 M urea. The insert shows the cleavage of 8-OxoG/C duplex in a parallel experiment.

To analyse the mechanism of strand cleavage at AP sites, the Ogg1 protein was allowed to react with AP/N duplexes in the presence of NaBH4. The reaction was performed at 4oC and the reaction products were analysed by SDS-PAGE. Figure 6 shows that the Ogg1 protein forms a stable covalent complex with a duplex DNA containing an AP site. The complex formation is strictly dependent upon the presence of the Ogg1 protein and of NaBH4. Figure 6 also shows that the Ogg1 protein reacts very efficiently with an AP/C substrate as compared with the other AP/N duplexes. The rank order for trapping efficiency is AP/C >> AP/T >> AP/G or AP/A paralleling the cleavage efficiency order at AP sites or 8-OxoG (Figs 2 , 5 and 6 ). These results show that the catalytic mechanism for strand cleavage at preformed AP sites by the Ogg1 protein also involves the formation of a transient imino enzyme-DNA intermediate.

Functional analysis of mutant Ogg1 proteins: Lys241 -> Gln241 (K241Q) and Lys241 -> Arg241 (K241R)

The Ogg1 protein belongs to a family of base-excision repair proteins related to the endonuclease III of E.coli (24 ). The sequence similarity between these two proteins is limited to a region spanning amino acid residues 232-265 and 111-143 of Ogg1 and endonuclease III, respectively. This region corresponds to the helix-hairpin-helix (HhH) structural motif and to the catalytic active site of the E.coli endonuclease III (38 ). Sequence alignment suggests that lysine 241 of Ogg1 corresponds to lysine 120 of endonuclease III (24 ). On these basis, lysine 241 of Ogg1 was used as a target for substitution to yield the K241Q (lysine -> glutamine) and K241R (lysine -> arginine) mutants. The various Ogg1 proteins were expressed in E.coli BH410 from pYSB160 (K241W.T.), pYSB161(K241R) or pYSB162 (K241Q) plasmids, respectively. Figure 7 shows that cell free extracts containing the wild-type Ogg1 or the K241R mutant cleave the 8-OxoG/C duplex and form a high molecular weight covalent complex in the presence of NaBH4 (Fig. 7 a and b). In contrast, cell free extracts containing K241Q mutants do not incise nor form retardation complexes with 8-OxoG/C (Fig. 7 a and b). Western-blot analysis using BCE-1691 antibodies shows that the wild-type and the two mutant Ogg1 proteins are present in similar amounts in cell free extracts (Fig. 7 c). These results strongly suggest that the replacement of Lys241 by Arg241 generates a catalytically functional protein, perhaps less active. In contrast, replacement of Lys241 by Gln241 results in a protein without catalytic activity. The expression vectors pKK223-3, pYSB160 (K241W.T.), pYSB161 (K241Q) and pYSB162 (K241R) were transformed in E.coli PR195 which displays a strong spontaneous mutator phenotype. The frequencies of either mutation to rifampicine resistance or reversion to lac+ were determined. The results shown in Table 2 demonstrate that expression of wild-type Ogg1 protein (K241W.T.) and K241R mutant in PR95 E.coli strain reduces the mutation frequencies for both markers analysed whereas expression of K241Q mutant does not. Thus, the cleavage and trapping efficiency of K241W.T., K241R and K241Q proteins parallels the antimutator effect of these proteins. Nevertheless, the lack of activity of the K241Q mutant could be due either to a defect in the catalytic mechanism or to an incapacity to bind modified DNA. Figure 8 shows that the wild-type as well as the mutant K241R or K241Q Ogg1 proteins bind the 34mer 8-OxoG/C duplex. The shifted bands were found to migrate at the same position either with purified Ogg1 protein or with the various cell extracts containing wild-type or mutant Ogg1 proteins (Fig. 8 ). These latter observations suggest that lysine 241 has a functional role rather than a structural role in the catalytic activities of Ogg1 protein.


Figure 6. Formation by NaBH4 reduction of a covalent complex between the Ogg1 protein and a 30mer DNA duplex containing a single AP site placed opposite each of the four DNA bases. Fifty nanograms of Ogg1 protein (1.16 pmol) was allowed to react with each of the four 30mer AP/N duplexes in the presence of 50 mM NaBH4 as described in Materials and Methods. The products of the reactions were analysed using a 10-20% polyacrylamide gradient gel SDS-PAGE.


Figure 7.Comparison of the properties of the wild-type and mutant forms, K241R or K241Q, of the Ogg1 protein. Cell free extracts (10 [mu]g-total protein) of E.coli BH410 harboring the various plasmids were used in the different reactions. pKK: plasmid pKK223-3 does not express Ogg1. K241W.T., wild-type Ogg1; K241R and K241Q, mutant forms of Ogg1 at Lys241. (a) Cleavage of 8-OxoG/C duplex (see Fig. 3). (b) Trapping assay in the presence of NaBH4 (see Fig. 4). (c) Western blot analysis. Lane Ogg1 contained 100 ng of purified Ogg1 protein.

Table 2 Spontaneous mutagenesis of the mutant strain E.coli fpg mutY (PR195) harboring the pKK223-3, pYSB160, pYSB161 or pYSB162 vectors
Vector Cloned gene Rifr/108 Lac+/108
pKK223-3 none 118 +- 18 2027 +- 263
pYSB160 OGG1 13 +- 1 83 +- 7
pYSB161 OGG1K241Q 185 +- 61 1698 +- 300
pYSB162 OGG1K241R 12 +- 3 620 +- 132

DISCUSSION

In this study, we have purified theOgg1 protein of S.cerevisiae from E.coli (fpg-) cells harboring the overproducing plasmid pYSB160. The Ogg1 protein is a monomer of 43 kDa which is endowed with two enzymatic activities, (i) a DNA glycosylase activity which excises Fapy and 8-OxoG, and (ii) an AP lyase activity which incises DNA at AP sites either preformed or resulting from the excision of a damaged base. The catalytic mechanism of the Ogg1 protein for the cleavage of DNA substrates containing either 8-OxoG or an AP site implies the formation of a transient enzyme-DNA intermediate which can be converted into a stable covalent adduct in the presence of NaBH4. This is the first demonstration of a covalent intermediate between a DNA glycosylase and a preformed AP site. Therefore, these results suggest a unique mechanism for cleavage of DNA by the Ogg1 protein, (i) after excision of a damaged base and (ii) at a preformed AP site. Our data also show that the Ogg1 protein reacts preferentially with 8-OxoG and AP sites placed opposite a cytosine. This strong bias in favor of lesions placed opposite a cytosine is a hallmark of the Ogg1 protein and could reflect the biological properties of the Ogg1 protein that is required to repair endogenous mutagenic DNA damage thus preventing G.C -> T.A transversions (12 ). It is worth noting that the Fpg protein, which is the functional homologue of the Ogg1 protein in bacteria, incises AP/N duplexes at approximatively the same rate (unpublished results). On the other hand, the rank order for cleavage efficiency by the Fpg protein is as follows, 8-Oxo/C = 8-OxoG/T > 8-OxoG/G >> 8-OxoG/A (32 ). Furthermore, the mechanism of strand cleavage at AP sites is also different since Ogg1 proceeds via a [beta]-elimination reaction whereas Fpg proceeds via [beta]- and [delta]-elimination reactions, respectively. To conclude, the substrate specificities and the catalytic mechanism of Fpg and Ogg1 are significantly different which, in turn, may suggest that these two proteins are not closely related.


Figure 8. Binding of the 8-OxoG/C duplex by bacterial crude extracts containing either the wild type, K241R or K241Q mutant Ogg1 proteins. Cell free extracts were prepared from BH410 hosting various plasmids (see Fig. 7). Control, 32P-labelled 8-OxoG/C duplex alone; Ogg1, 8-OxoG/C plus 50 ng of purified Ogg1. Other reactions contained 10 [mu]g of total proteins from BH410 hosting pKK223-3 (pKK), pYSB160 (K241W.T.) or pYSB161 (K241R) or pYSB162 (K241Q). The products of the reactions were loaded onto non- denaturing PAGE for retardation analysis.

The fact that Ogg1 is a DNA glycosylase/AP lyase prompted us to search for sequence homology between the Ogg1 protein and other proteins catalysing similar reactions. Indeed, sequence alignment amongst DNA glycosylases/AP lyases reveals sequence similarity between the Ogg1 protein and proteins related to the endonuclease III of E.coli rather than to the Fpg protein. The homology between the Ogg1 protein and the endonuclease III is limited to a region that includes a structural HhH motif found in the crystal structure of endonuclease III (38 ). Using this sequence, we have been able to align Ogg1 with other proteins suh as the UV-endonuclease of M.luteus (37 ), the Ntg1 protein of S.cerevisiae (39 ) and the Spo-Nth protein of Schizosaccharomyces pombe (40 ). A consensus sequence emerged from these comparison. It spans two blocks of conserved residues [(L/Y)(P/N) GVG(P/R)K] and [(V/I)XVD(V/T)H] separated by 14 or 15 amino acids. Two amino acids, K120 and D138 of E.coli endonuclease III, are conserved in all sequences (24 ,38 ). These residues correspond to K241 and D260 of the Ogg1 protein. The replacement of Lys241 of Ogg1 by an Arg (K241R) results in a catalytically active protein. In contrast, the K241Q mutation completely abolish the catalytic activity. However, both K241R and K241Q mutants bind to damaged DNA. These results are identical to those obtained with the K120Q mutant of the endonuclease III of E.coli (38 ) and confirm that sequence homologies between Ogg1 and endonuclease III reflect functional and/or structural similarities. Therefore, our results reinforce the concept that these proteins may have a common ancestor gene which may be the ancestor of most if not all eukaryotic DNA glycosylases/AP lyases. It is important to notice that neither the Fpg protein nor the T4 UV-endonuclease are included in this list of proteins. Indeed, Fpg proteins are highly conserved amongst eubacteria but no eukaryotic homologue has been so far identified.

Finally, studies of proteins like Ogg1 in the simple eukaryote S.cerevisiae are important to understand the biological impact of base excision repair in mammalian cells. Indeed, based on sequence similarity, the human homolog (hOGG1) of the OGG1 gene of S.cerevisiae has been cloned recently (29 ,41 ).

ACKNOWLEDGEMENTS

The authors thank the Commissariat l'Energie Atomique and the Centre National de la Recherche Scientifique UMR217. This work was supported by the ACC-SV8 (S.B.) and the Comit de Radioprotection of EDF (RB96-09). The authors thank Drs J.Laval and T.R.O'Connor (Villejuif, France) for the kind gift of uracil DNA glycosylase and endonuclease IV of E.coli and Dr P.Nehls (Essen, Germany) for the kind gift of the oligonucleotide containing 8-OxoG. We thank P.Auffret van der Kemp and C.Dherin for their excellent technical assistance.

REFERENCES

1 Demple,B. and Harrisson,L. (1994) Annu. Rev. Biochem., 63, 915-948. MEDLINE Abstract

2 Breimer,L.H. (1990) Mol. Carcinogenesis, 3, 188-197. MEDLINE Abstract

3 Ames,B.N., Shinegawa,M.K. and Hagen,T.M. (1993) Proc. Natl. Acad. Sci. USA, 90, 7915-7922. MEDLINE Abstract

4 Feig,D.I., Reid,T.M. and Loeb,L.A. (1994) Cancer Res., 54 (supplement), 1890-1894.

5 Michaels,M.L. and Miller,J.H. (1992) J. Bacteriol., 174, 6321-6325. MEDLINE Abstract

6 Grollman,A.P. and Moriya,M. (1993) Trends Genet., 9, 246-249. MEDLINE Abstract

7 Boiteux,S. (1993) Photochem. Photobiol. B, 19, 87-96. MEDLINE Abstract

8 Michaels,M.L., Cruz,C., Grollman,A.P. and Miller,J.H.(1992) Proc. Natl. Acad. Sci. USA, 89, 7022-7025. MEDLINE Abstract

9 Duwat,P., De Oliveira,R., Ehrlich,D.S. and Boiteux,S. (1995) Microbiology, 141, 411-417. MEDLINE Abstract

10 Tajiri,T., Maki,H. and Sekiguchi,M. (1995) Mutation Res., 336, 257-267. MEDLINE Abstract

11 Auffret van der Kemp,P., Thomas,D., Barbey,R., De Oliveira,R. and Boiteux,S. (1996) Proc. Natl. Acad. Sci. USA, 93, 5197-5202.

12 Thomas,D., Scott,A., Barbey,R., Padula,M. and Boiteux,S. (1996) Mol. Gen. Genet., 254, 171-178.

13 Lindahl,T. (1993) Nature, 362, 709-715. MEDLINE Abstract

14 Chetsanga,C.J. and Lindahl,T. (1979) Nucleic Acids Res., 6, 3673-3684. MEDLINE Abstract

15 Boiteux,S., O'Connor,T.R. and Laval,J. (1987) EMBO J., 6, 3177-3183. MEDLINE Abstract

16 Breimer,L.H. (1984) Nucleic Acids Res., 12, 6359-6367. MEDLINE Abstract

17 Tchou,J., Kasai,H., Shibutani,S., Chung,M.H., Laval,J., Grollman,A.P. and Nishimura,S. (1991) Proc. Natl. Acad. Sci. USA, 88, 4690-4694. MEDLINE Abstract

18 Boiteux,S., Gajewski,E., Laval,J. and Dizdaroglu,M. (1992) Biochemistry, 31, 106-110. MEDLINE Abstract

19 Tchou,J., Bodepudi,V., Shibutani,S.,Antoshechkin,I., Miller,J.H., Grollman,A.P. and Johnson,F. (1994) J. Biol. Chem., 269, 15318-15324. MEDLINE Abstract

20 Bailly,V., Verly,W.G., O'Connor,T.R. and Laval,J. (1983) Biochem. J., 262, 581-589.

21 O'Connor,T.R. and Laval,J. (1989) Proc. Natl. Acad. Sci. USA, 86, 5222-5226. MEDLINE Abstract

22 Graves,R.J., Felzenswalb,I., Laval,J. and O'Connor,T.R. (1992) J. Biol. Chem., 267, 14429-14435. MEDLINE Abstract

23 Bhagwat,M. and Gerlt,J. (1996) Biochemistry, 35, 659-665. MEDLINE Abstract

24 Nash,H.M., Bruner,S.D., Scharer,O.D., Kawate,T, Addona,T.A., Spooner,E., Lane,W.S. and Verdine,G.L. (1996) Curr. Biol., 6, 968-980.

25 Dodson,M.L., Michaels,M.L. and Lloyd,R.S. (1994) J. Biol. Chem., 269, 32709-32712. MEDLINE Abstract

26 Sun,B., Latham,K.A., Dodson,M.L. and Lloyd,R.S. (1995) J. Biol. Chem., 270, 19501-19508. MEDLINE Abstract

27 Tchou,J. and Grollman,A.P. (1995) J. Biol. Chem., 270, 11671-11677. MEDLINE Abstract

28 Boiteux,S. and Huisman,O. (1989) Mol. Gen. Genet., 215, 300-305. MEDLINE Abstract

29 Radicella,P.J., Dherin,C., Desmazes,C., Fox,M.S. and Boiteux,S. (1997) Proc. Natl. Acad. Sci. USA, 94, in press.

30 Bradford,M.M. (1976) Anal. Biochem., 72, 248-254 MEDLINE Abstract

31 Boiteux,S., Belleney,J., Roques,B.P. and Laval,J. (1984) Nucleic Acids Res., 12, 5429-5439. MEDLINE Abstract

32 Castaing,B., Geiger,A., Seliger,H., Nehls,P., Laval,J., Zelwer, C. and Boiteux,S. (1993) Nucleic Acids Res., 21, 2899-2905. MEDLINE Abstract

33 Ramalho-Ordigao,J.F., Rosch,H., Selter,H., Frohlich,A., Lorenz,A., Montenach,M. and Seliger,H. (1992) Antisense Res. Dev., 2, 129-146.

34 Castaing,B., Boiteux,S. and Zelwer,C. (1992) Nucleic Acids Res., 20, 389-394. MEDLINE Abstract

35 De Oliveira,R., Auffret van der Kemp,P., Thomas,D., Barbey,R. and Boiteux,S. (1994) Nucleic Acids Res., 22, 3760-3764. MEDLINE Abstract

36 Schrock,R.D. and Lloyd,R.S. (1993) J. Biol. Chem., 268, 880-886. MEDLINE Abstract

37 Piersen,C.E., Prince,M.A., Augustine,M.L., Dodson,M.L. and Lloyd,L.S. (1995) J. Biol. Chem., 270, 23475-23484.

38 Thayer,M.M., Ahern,H., Xing,D., Cunningham,R.P. and Tainer,J.A. (1995) EMBO J., 16, 4108-4120.

39 Eide,L., Pirovano,M., Alseth,I., Berdal,K.G. and Seeberg,E. (1996) Proc. Natl. Acad. Sci. USA, 93, 10735-10740. MEDLINE Abstract

40 Roldan-Arjona,T., Anselmino,C. and Lindahl,T. (1996) Nucleic Acids Res., 24, 3307-3312. MEDLINE Abstract

41 Lu,R., Nash,H.M. and Verdine,G.L. (1997) Curr. Biol., 7, 397-407. MEDLINE Abstract


*To whom correspondence should be addressed. Tel: +33 1 46 54 88 58; Fax: +33 1 46 54 88 59; Email: boiteux@dsvidf.cea.fr
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
MutagenesisHome page
D. Manikova, D. Vlasakova, J. Loduhova, L. Letavayova, D. Vigasova, E. Krascsenitsova, V. Vlckova, J. Brozmanova, and M. Chovanec
Investigations on the role of base excision repair and non-homologous end-joining pathways in sodium selenite-induced toxicity and mutagenicity in Saccharomyces cerevisiae
Mutagenesis, December 2, 2009; (2009) gep056v1.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
P. Burkovics, I. Hajdu, V. Szukacsov, I. Unk, and L. Haracska
Role of PCNA-dependent stimulation of 3'-phosphodiesterase and 3'-5' exonuclease activities of human Ape2 in repair of oxidative DNA damage
Nucleic Acids Res., July 1, 2009; 37(13): 4247 - 4255.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
P. A. van der Kemp, M. de Padula, G. Burguiere-Slezak, H. D. Ulrich, and S. Boiteux
PCNA monoubiquitylation and DNA polymerase {eta} ubiquitin-binding domain are required to prevent 8-oxoguanine-induced mutagenesis in Saccharomyces cerevisiae
Nucleic Acids Res., May 1, 2009; 37(8): 2549 - 2559.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
Y.-S. Pu, K.-Y. Jan, T.-C. Wang, A. S. S. Wang, and J.-R. Gurr
8-Oxoguanine DNA Glycosylase and MutY Homolog Are Involved in the Incision of Arsenite-Induced DNA Adducts
Toxicol. Sci., February 1, 2007; 95(2): 376 - 382.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. A. Kuznetsov, V. V. Koval, G. A. Nevinsky, K. T. Douglas, D. O. Zharkov, and O. S. Fedorova
Kinetic Conformational Analysis of Human 8-Oxoguanine-DNA Glycosylase
J. Biol. Chem., January 12, 2007; 282(2): 1029 - 1038.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. Auerbach, R. A. O. Bennett, E. A. Bailey, H. E. Krokan, and B. Demple
Mutagenic specificity of endogenously generated abasic sites in Saccharomyces cerevisiae chromosomal DNA
PNAS, December 6, 2005; 102(49): 17711 - 17716.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Coste, M. Ober, T. Carell, S. Boiteux, C. Zelwer, and B. Castaing
Structural Basis for the Recognition of the FapydG Lesion (2,6-Diamino-4-hydroxy-5-formamidopyrimidine) by Formamidopyrimidine-DNA Glycosylase
J. Biol. Chem., October 15, 2004; 279(42): 44074 - 44083.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. de Padula, G. Slezak, P. Auffret van Der Kemp, and S. Boiteux
The post-replication repair RAD18 and RAD6 genes are involved in the prevention of spontaneous mutations caused by 7,8-dihydro-8-oxoguanine in Saccharomyces cerevisiae
Nucleic Acids Res., September 23, 2004; 32(17): 5003 - 5010.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
P. A. van der Kemp, J.-B. Charbonnier, M. Audebert, and S. Boiteux
Catalytic and DNA-binding properties of the human Ogg1 DNA N-glycosylase/AP lyase: biochemical exploration of H270, Q315 and F319, three amino acids of the 8-oxoguanine-binding pocket
Nucleic Acids Res., January 29, 2004; 32(2): 570 - 578.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Le Page, V. Schreiber, C. Dherin, G. de Murcia, and S. Boiteux
Poly(ADP-ribose) Polymerase-1 (PARP-1) Is Required in Murine Cell Lines for Base Excision Repair of Oxidative DNA Damage in the Absence of DNA Polymerase beta
J. Biol. Chem., May 9, 2003; 278(20): 18471 - 18477.
[Abstract] [Full Text] [PDF]


Home page
Sci Aging Knowl EnvironHome page
D. Sinclair
Is DNA Cut Out for a Long Life?
Sci. Aging Knowl. Environ., April 23, 2003; 2003(16): pe8 - 8.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
J. R. Vance and T. E. Wilson
Repair of DNA Strand Breaks by the Overlapping Functions of Lesion-Specific and Non-Lesion-Specific DNA 3' Phosphatases
Mol. Cell. Biol., November 1, 2001; 21(21): 7191 - 7198.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
J. F. Davidson and R. H. Schiestl
Cytotoxic and Genotoxic Consequences of Heat Stress Are Dependent on the Presence of Oxygen in Saccharomyces cerevisiae
J. Bacteriol., August 1, 2001; 183(15): 4580 - 4587.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. E. Vidal, I. D. Hickson, S. Boiteux, and J. P. Radicella
Mechanism of stimulation of the DNA glycosylase activity of hOGG1 by the major human AP endonuclease: bypass of the AP lyase activity step
Nucleic Acids Res., March 15, 2001; 29(6): 1285 - 1292.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M.-H. David-Cordonnier, S. Boiteux, and P. O'Neill
Excision of 8-oxoguanine within clustered damage by the yeast OGG1 protein
Nucleic Acids Res., March 1, 2001; 29(5): 1107 - 1113.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
T. Nakahara, Q.-M. Zhang, K. Hashiguchi, and S. Yonei
Identification of proteins of Escherichia coli and Saccharomyces cerevisiae that specifically bind to C/C mismatches in DNA
Nucleic Acids Res., July 1, 2000; 28(13): 2551 - 2556.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M.-H. David-Cordonnier, J. Laval, and P. O'Neill
Clustered DNA Damage, Influence on Damage Excision by XRS5 Nuclear Extracts and Escherichia coli Nth and Fpg Proteins
J. Biol. Chem., April 14, 2000; 275(16): 11865 - 11873.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Asagoshi, T. Yamada, H. Terato, Y. Ohyama, Y. Monden, T. Arai, S. Nishimura, H. Aburatani, T. Lindahl, and H. Ide
Distinct Repair Activities of Human 7,8-Dihydro-8-oxoguanine DNA Glycosylase and Formamidopyrimidine DNA Glycosylase for Formamidopyrimidine and 7,8-Dihydro-8-oxoguanine
J. Biol. Chem., February 18, 2000; 275(7): 4956 - 4964.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Gogos and N. D. Clarke
Characterization of an 8-Oxoguanine DNA Glycosylase from Methanococcus jannaschii
J. Biol. Chem., October 22, 1999; 274(43): 30447 - 30450.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
I. Alseth, L. Eide, M. Pirovano, T. Rognes, E. Seeberg, and M. Bjoras
The Saccharomyces cerevisiae Homologues of Endonuclease III from Escherichia coli, Ntg1 and Ntg2, Are Both Required for Efficient Repair of Spontaneous and Induced Oxidative DNA Damage in Yeast
Mol. Cell. Biol., May 1, 1999; 19(5): 3779 - 3787.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
K. Nishioka, T. Ohtsubo, H. Oda, T. Fujiwara, D. Kang, K. Sugimachi, and Y. Nakabeppu
Expression and Differential Intracellular Localization of Two Major Forms of Human 8-Oxoguanine DNA Glycosylase Encoded by Alternatively Spliced OGG1 mRNAs
Mol. Biol. Cell, May 1, 1999; 10(5): 1637 - 1652.
[Abstract] [Full Text]


Home page
Protein Eng Des SelHome page
T. J. Begley and R. P. Cunningham
Methanobacterium thermoformicicum thymine DNA mismatch glycosylase: conversion of an N-glycosylase to an AP lyase
Protein Eng. Des. Sel., April 1, 1999; 12(4): 333 - 340.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Ikeda, T. Biswas, R. Roy, T. Izumi, I. Boldogh, A. Kurosky, A. H. Sarker, S. Seki, and S. Mitra
Purification and Characterization of Human NTH1, a Homolog of Escherichia coli Endonuclease III. DIRECT IDENTIFICATION OF LYS-212 AS THE ACTIVE NUCLEOPHILIC RESIDUE
J. Biol. Chem., August 21, 1998; 273(34): 21585 - 21593.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Nicolas, J. M. Beggs, B. M. Haltiwanger, and T. F. Taraschi
A New Class of DNA Glycosylase/Apurinic/Apyrimidinic Lyases That Act on Specific Adenines in Single-stranded DNA
J. Biol. Chem., July 3, 1998; 273(27): 17216 - 17220.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. J. O'Rourke, C. Chevalier, S. Boiteux, A. Labigne, L. Ielpi, and J. P. Radicella
A Novel 3-Methyladenine DNA Glycosylase from Helicobacter pylori Defines a New Class within the Endonuclease III Family of Base Excision Repair Glycosylases
J. Biol. Chem., June 23, 2000; 275(26): 20077 - 20083.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. O. Zharkov, T. A. Rosenquist, S. E. Gerchman, and A. P. Grollman
Substrate Specificity and Reaction Mechanism of Murine 8-Oxoguanine-DNA Glycosylase
J. Biol. Chem., September 8, 2000; 275(37): 28607 - 28617.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. R. Vance and T. E. Wilson
Uncoupling of 3'-Phosphatase and 5'-Kinase Functions in Budding Yeast. CHARACTERIZATION OF SACCHAROMYCES CEREVISIAE DNA 3'-PHOSPHATASE (TPP1)
J. Biol. Chem., April 27, 2001; 276(18): 15073 - 15081.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (289K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (69)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Girard, P. M.
Right arrow Articles by Boiteux, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Girard, P. M.
Right arrow Articles by Boiteux, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?