Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (97K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (20)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Belousov, E. S.
Right arrow Articles by Meyer, R. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Belousov, E. S.
Right arrow Articles by Meyer, R. B.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 1997 Oxford University Press 3440-3444

Sequence-specific targeting and covalent modification of human genomic DNA

Sequence-specific targeting and covalent modification of human genomic DNA Evgeniy S. Belousov, Irina A. Afonina, Mikhail A. Podyminogin, Howard B. Gamper, Michael W. Reed, Robert M. Wydro and Rich B. Meyer*

Epoch Pharmaceuticals, Inc., 1725 220th Street SE, #104, Bothell, WA 98021, USA

Received May 27, 1997; Revised and Accepted July 14, 1997

ABSTRACT

We compare two techniques which enable selective, nucleotide-specific covalent modification of human genomic DNA, as assayed by quantitative ligation- mediated PCR. In the first, a purine motif triplex-forming oligonucleotide with a terminally appended chlorambucil was shown to label a target guanine residue adjacent to its binding site in 80% efficiency at 0.5 [mu]M. Efficiency was higher in the presence of the triplex-stabilizing intercalator coralyne. In the second method, an oligonucleotide targeting a site containing all four bases and bearing chlorambucil on an interior base was shown to efficiently react with a specific nucleotide in the target sequence. The targeted sequence in these cases was in the DQ[beta]1*0302 allele of the MHC II locus.

INTRODUCTION

Site-directed mutagenesis by specific modification of genomic DNA offers a viable alternative to vector-based gene therapy in cases where single base changes are useful. We have been developing methods for DNA sequence alteration using oligodeoxynucleotides (ODNs) with reactive agents attached to one or more positions. These may cause mutation at the targeted site, induced by covalent modification (1 ,2 ), resulting in inactivation or modification of functional expression of the gene.

One method of DNA sequence targeting is with triplex-forming oligonucleotides (TFOs). If these are conjugated to electrophilic or photoreactive groups, they can recognize and efficiently modify bases on either one (1 ,3 -6 ) or both (7 ,8 ) strands in targeted duplex DNA. A current difficulty with TFOs is that only purines may be in the TFO binding strand of the duplex target. This severely restricts the availability of target sites.

An alternate method, useful for targeting any sequence, is use of the Escherichia coli RecA protein with single-stranded ODNs. This protein coats single-stranded DNA, and catalyzes a homology search on double-stranded DNA targets (9 ). This can occur when the single strand is a fairly short ODN. Oligonucleotides have been used with RecA protein to mask specific methylation of restriction sites, leaving those targeted sites sensitive to restriction after the other sites were modified (10 ), and to retrieve targeted plasmids from a mixture by using biotinylated ODNs, with capture of the biotinylated ODN-bound plasmids on a streptavidin column (11 ). In the latter case, supercoiled plasmids were required. These three-stranded complexes can be stable after deproteinization, however, if the single-stranded ODN bears a reactive group that covalently binds to the target's complementary strand, as we have previously shown (12 ,13 ). This strand displacement method allows modification of any target site (four letter targeting) in DNA without sequence restriction by use of such a recombinase-assisted ODN (RAO).

In this study we show that both of these two gene targeting methods give highly efficient and specific site-directed electrophilic modification of a native gene in whole genomic human DNA. The target for the crosslinking TFO is a polypurine tract in the DQ[beta]1*0302 allele of the MHC II locus, and for the RAO, a nearby site on the same gene. Quantitative ligation-mediated PCR (LMPCR) was used to monitor the extent to which the targeted nucleotide was alkylated. With either technique, efficient ODN-directed modification was shown to have occurred at a significant rate with good specificity.

MATERIALS AND METHODS

Oligonucleotide design, synthesis, conjugation and labeling

Figure 1 shows the alignment of the ODNs with the targeted sequences, the sites of modification and the structure of the oligonucleotides used in this study. The target sequence for both types of ODN was the first intron of the HLA DQ[beta]1*0302 allele, an allele associated with predisposition to juvenile onset (Type I) diabetes (14 ), and the human HT-29 cells (obtained from ATCC) used here contain a single copy of this allele. We found the sequence recorded in GenBank (15 ) (accession no. K01499) to be incorrect; Figure 1 shows the correct sequence in the area we are targeting. When a TFO with a terminal alkylating group forms a triplex with double-stranded DNA, it reacts with nearby guanines at N7 in the major groove (4 ,7 ). In RAOs the reactive moiety, located on an internal base, preferentially reacts with guanines on the complementary strand of the target sequence after synaptic complex formation.


Figure 1.Systems used in demonstration of modification of double-stranded genomic DNA by reactive oligonucleotides. (A) Schematic of the region of DNA targeted and position of LMPCR primers. TFO is designed to alkylate top (sense) strand; RAO is designed to alkylate bottom strand. The arrows marking the LMPCR primer sites schematically represent the regions where the primers for each strand are nested, such that primer 1 binds at the 3'-most position (on the copied strand) of each set, with the others closely 5' (or occasionally overlapping) to the previous primer. (B) TFO1 and target sequence in a polypurine stretch of the HLA DQ[beta]1*0302 allele. Chlorambucil is appended to the 5'-end of the ODN. (C) RAO2, with chlorambucil appended to an internal dUrd, and target region on same gene. RAO1 covers the same sequence but is 50 nt long.

ODNs with a 5' or 3' aminohexyl group were prepared using N-MMT-hexanolamine phosphoramidite linker (Glen Research) for the 5'-modification, or aminohexyl controlled pore glass (16 ) for the 3'-modifications. ODNs with an internal aminopropyl group (the RAOs used here) were prepared using the protected phosphoramidite of 5-(3-aminopropyl)-2'-deoxyuridine (17 ). The synthesis, HPLC purification, detritylation and butanol precipitation of both types of ODNs were carried out using standard procedures as previously described (18 ). Drying of the ODN solutions was performed under vacuum using a centrifugal evaporator.

For conjugation, ODN (from a 2 [mu]mol scale synthesis) was converted to the triethylammonium (TEA) salt by dissolving the ODN in 0.5 ml of water and injecting it onto a PRP-1 HPLC column (Hamilton). A gradient of 0-60% 0.1 M acetonitrile in TEA bicarbonate over 20 min (flow rate = 2 ml/min) gave the ODN peak at ~14 min for a 30mer; this was dried overnight. The G-rich TFOs were converted to the tributylammonium (TBA) salt by an analogous procedure using 0.05 M TBA bicarbonate. The ODN concentration was determined from UV absorbance after dissolution in 0.5 ml water. Extinction coefficients for ODNs were determined using a nearest neighbor model (19 ). For conjugation to chlorambucil, an aliquot containing 1 mg of ODN was dried and dissolved in 0.2 ml of anhydrous DMSO. After addition of 10 [mu]l of ethyldiisopropylamine and 75 [mu]l of a 20 mg/ml solution of chlorambucil 2,3,5,6-tetrafluorophenyl ester in DMSO (1.5 mg, prepared by treatment of chlorambucil with tetrafluorophenyl trifluoroacetate; 18 ), the solution was shaken for 3 h, then poured into 10 ml of 2% sodium perchlorate in acetone. After immediate centrifugation at 3000 g for 5 min, the pellet was vortexed with 2 ml of acetone and re-centrifuged. The washed pellet was dried for 10 min on a centrifugal evaporator and stored at -80oC.

This crude chlorambucil-ODN was dissolved in 0.25 ml of water and purified by C18 HPLC (5-85% acetonitrile in 0.1 M TEA acetate, 40 min at 1 ml/min, ~20 min retention).The product was immediately precipitated with 100 [mu]l of 3 M sodium acetate and 4 ml of butanol for each millilitre of eluent collected. The precipitate was pelleted without delay (3000 g for 5 min), washed with 2 ml ethanol, and re-pelleted. This pellet was dried for 10 min on a centrifugal evaporator, dissolved in 0.2 ml of water, and assayed for concentration and purity by C18 HPLC. All conjugates were at least 90% pure. They were stored at -80oC, where they were stable for weeks.

Reaction of triplex-forming ODNs with genomic DNA

Genomic DNA from HT29 cells was prepared with a Wizard Genomic DNA Purification Kit (Promega). To 5-10 [mu]g of genomic DNA in 90 [mu]l 20 mM HEPES, pH 7.2, 140 mM KCl, 10 mM MgCl2 and 1 mM spermine was added 10 [mu]l of a 10* stock of TFO1 or controls to give a final ODN concentration of 10-6-10-9 M. After mixing and incubation 3 h at 37oC, the DNA was pelleted by addition of 10 [mu]l of 3 M NaOAc, pH 7.0, and 300 [mu]l of ice-cold 100% ethanol, chilling (-70oC), centrifugation at 12 000 r.p.m. for 15 min at 4oC, washed with EtOH, and dried.

Reaction of ODNs with genomic DNA with RecA protein catalysis

To 10 [mu]l of an ice cold 1 [mu]M chlorambucil-ODN (RAO1 or RAO2) solution in 10 mM Tris-HCl, pH 7.5, and 1 mM EDTA was added 10 [mu]l of 10* RecA buffer [100 mM Tris-acetate, pH 7.5, 500 mM NaOAc, 120 mM Mg(OAc)2, 10 mM dithiothreitol (DTT) and 50% glycerol], along with 10 [mu]l of 10 mM ATP[gamma]S and water to give a final volume of 87 [mu]l, which was kept ice cold. After addition of 3 [mu]l of a cold solution of RecA protein (New England BioLabs #249L) solution (2 mg/ml), 5-10 [mu]g of genomic DNA was added and the mixture was incubated for 6 h at 37oC. After addition of 82 [mu]l of 10 mM Tris-HCl, pH 7.5, containing 1 mM EDTA, 10 [mu]l of 10% SDS and 8 [mu]l of Proteinase K (5 mg/ml), and incubation for 30 min at 37oC, the reaction mixture was extracted with an equal volume of phenol-chloroform. The aqueous phase was extracted three times with ether and the DNA precipitated as above.

Quantitative ligation-mediated PCR (LMPCR)

Most steps of this technique were performed as described (20 ,21 ), although certain modifications (22 ) were made for this work. Since we required a method to quantitate the amount of site-specific alkylation and cleavage, we generated an internal control site by cleavage of the DNA with a restriction enzyme after the chlorambucil-ODN reaction. Selection of a restriction endonuclease was based on the enzyme having a recognition site 50-200 nt upstream (5') of the alkylated base, and no recognition sites between that base and the downstream (3') sequence complementary to the first primer. A BamHI site for each strand was identified as shown in the schematic in Figure 1 . Initial experiments confirmed completion of digestion at these sites, using Southern blot hybridization and a PCR-generated probe, and also confirmed the lack of dependence of the ratio of target site cleavage to restriction site cleavage on amount of treated DNA (0.5-5 [mu]g tested) used in the LMPCR protocol.

The second modification to the protocol was heating the DNA to 95oC in the buffer used for first strand synthesis, pH 8.9, for 10 min prior to annealing and extending the first primer. This is slightly longer than the standard 3 min of the protocol (21 ), and causes quantitative depurination and cleavage of the DNA at the site of alkylation with the generation of the 5'-phosphate required for the ligation step. All chlorambucil alkylation sites in this work were designed to be on N-7 of guanines.

For each experiment an aliquot of the genomic DNA was treated with dimethylsulfate and amplified along with the rest of the samples to provide a G-ladder (20 ). The DNA samples were restricted with BamHI to completion by incubating 3 h under optimal conditions with a 3-fold excess of restriction enzyme. The volume was adjusted to 100 [mu]l with water and the DNA was precipitated as described above. The pellet was resuspended in 10 mM Tris-HCl, pH 7.5, 1 mM EDTA, to give a DNA concentration of ~0.5 [mu]g/[mu]l. To 5 [mu]l of this chilled solution in a PCR tube was added 25 [mu]l of the primer 1 solution (21 ). First strand synthesis and ligation of the universal linker (see above) was performed as described by Mueller and co-workers (21 ), except that the 95oC heating step was extended to 10 min. Nested PCR was then performed as described by Pfeifer and Riggs (20 ).

Phosphorimaging was used to analyze the polyacrylamide gel electropherograms of the LMPCR results, and the ratio of intensities of the bands due to the restriction and alkylation sites gave the efficiency of targeted alkylation.

RESULTS

Targeted DNA modification by a reactive TFO

Figure 2 shows the results of incubation of TFO1 with isolated genomic DNA from human HT29 cells in physiological buffer, as analyzed by LMPCR. The BamHI (internal standard) site was located 36 bases 5' from the target site. Since we showed by Southern blot that 100% of the DNA was cleaved by BamHI, the efficiency of cleavage at the targeted site is given by the ratio of the density in the cleavage site to the sum of the density in the cleavage and the restriction site, assuming negligible background. Table 1 gives this quantitation of specific targeting.


Figure 2.Alkylation of the HLA DQ[beta]1*0302 allele in human genomic DNA by TFO1, a chlorambucil-ODN conjugate. A homopurine run in the first intron of this single copy gene, present in DNA isolated from HT-29 cells, was targeted using a reactive 21mer (5'-chlorambucil-AGGAGAAAGGAGAGGAGAGAG). Following incubation for 3 h at 37oC with addition of 8 [mu]M coralyne (lanes 6-9) or without any coralyne (lanes 2-5), the DNA was ethanol precipitated and restricted with BamHI. Quantitative LMPCR was performed using the following primers (sense strand): 5'-CCATAATATTTAGTCCAGGC (primer 1), 5'-GTCTTGGGGCACGCCTAAATGACA (primer 2), and 5'-32P-CTGCTGTGTCTCTGGAGAAATTCGTATCTTC (primer 3). Final concentrations of reactive ODN were: lane 1, no ODN; lanes 2 and 6, 4 nM; lanes 3 and 7, 20 nM; lanes 4 and 8, 100 nM; lanes 5 and 9, 500 nM; lane G, G-ladder.

The incubations were performed in the presence or absence of the triplex-stabilizing agent coralyne, which had a significant effect on the efficiency of alkylation. Lee and co-workers (23 ) have shown that coralyne stabilized pyrimidine motif triplexes, and we have observed that coralyne stabilizes triplexes formed using G/A and G/T motif TFOs (H.Gamper and J.Lampe, unpublished results). In the presence of coralyne, the sequence-specific modification of the target nucleotide is clearly seen at concentrations as low as 4 nM (7%). At increasing concentrations, the selective alkylation of the target site increases, with 90% efficiency seen at a concentration of 500 nM. Even without the triplex stabilization by coralyne, the efficiency of modification is high. At 500 nM 80% modification was achieved with ODN alone.

These assays were run in buffers that approximate physiological concentrations of major cations. The effect of potassium ion on triplex formation is variable, depending on the motif of the TFO being used. We (H.Gamper, unpublished results) and others (24 ,25 ) have found that potassium ion significantly destabilizes triplexes using purine motif (G/A or G/T) TFOs. In all of the hybridizations conducted in this study using genomic DNA, we used 140 mM KCl in the buffer to achieve physiological ionic strength and approximate conditions within the nuclei of cells (26 ). These cell-free results, therefore, may be more predictive of the cell culture activity of TFOs than studies performed in buffers with no monovalent cations.

Table 1 . Quantification of cleavage at the targeted site by TFO1
Lane in Figure 2 2 3 4 5 6 7 8 9
  No coralyne 8 [mu]M coralyne
TFO1 (nM) 4 20 100 500 4 20 100 500
% Targeted alkylation and cleavage 1 5 36 80 7 28 75 90

Targeted modification of genomic DNA with reactive four-letter ODNs


Figure 3.RecA protein-mediated alkylation of the HLA DQ[beta]1*0302 allele in human genomic DNA by chlorambucil-ODN conjugates. A site in the first intron of this single copy gene was targeted using a RecA protein coated, homologous 30mer RAO2 [5'-GAAGATACGAATTTCUCCAGAGACACAGCA] or 50mer RAO1 [5'-GGTTATTTTTGAAGATACGAATTTCUCCAGAGACACAGCAGGATTTGTCA], where U is 5-{3-[4-(p-(bis-(2-chloroethyl)amino)phenyl)butyramido]propyl}deoxyuridylate. After 6 h incubation RecA protein was removed by phenol extraction and the DNA was restricted with BamHI. LMPCR was performed using the following primers (antisense strand): 5'-ATCCCCATCCTACAGGCT (primer 1), 5'- GCCTGGAAGAGAAGGAGAGAGGAG (primer 2) and 5'-32P-GAGGAGACAAAGTGTACATTTACTACCAGTG (primer 3). Lane 1, no ODN or RecA protein; lane 2, 50mer RAO1 minus RecA protein; lane 3, RAO1 plus RecA protein; lane 4, 30mer RAO2 minus RecA protein; lane 5, RAO2 plus RecA protein; lane G, G-ladder.

Figure 3 shows the results of targeting a specific site in the DQ[beta]1*0302 allele with oligonucleotides bearing all four of the DNA bases. We constructed two oligonucleotides targeted at the 0302 allele, one 50 bases long (RAO1) and one 30 bases long (RAO2) targeted at the same site, as shown in Figure 1 . These two oligonucleotides both bore a crosslinking group attached to the 5-position of dUrd, substituted for a dThd close to the middle of the oligonucleotide, as previously shown to be the most efficient conjugation position (12 ). It can target any of the adjacent three guanines on the complementary strand. When incubated with the genomic DNA target in the presence of E.coli RecA protein and ATP[gamma]S (27 ) at pH 7.4 for 6 h, the two RAOs alkylated the targeted bases with good specificity. Crosslinking to the targeted guanines in the complementary strand of the targeted site was very efficient in the case of the 50mer RAO1 (~50%) and moderately efficient in the case of the 30mer RAO2. We believe that the alkylation reaction occurs within a synaptic complex (28 ) after strand exchange, and that the RAO is in a complex resembling a Watson-Crick duplex with the complementary strand, such that adjacent major groove nucleophilic sites on the complementary strand of target DNA are accessible to reactive side chains on the RAOs (12 ,13 ). The fairly long crosslinking side chain used here can span at least two bases to either side of such a duplex. The complete lack of reaction at the target site in the absence of RecA protein is evidence that the reaction is not occurring by duplex formation of RAO with denatured DNA.

DISCUSSION

Two versatile techniques by which naked genomic DNA may be covalently modified with high efficiency and at specifically targeted nucleotides have been described here. Previous demonstrations of efficient targeting at this level of complexity have been limited to sites engineered in chromosomal DNA (8 ) and to integrated viral sequence in cells which were photochemically modified with lower efficiency (29 ). We now show the ability to target a site in a native gene with a triplex forming ODN with an appended electrophilic group with physiological salt concentrations. We further show the ability to target any desired sequence, by design, using reactive oligonucleotides and RecA protein catalysis.

Use of TFOs continues to be limited by their ability to `read' only two letters of the genetic code. Although work in other laboratories has attempted to expand this code by incorporating into a TFO the ability to recognize pyrimidine interruptions in the polypurine strand (30 -32 ) or to recognize two short purine tracts on alternate strands of the DNA (33 ), a general solution to recognition of DNA by triplex forming oligonucleotides is not likely to be available in the near term. Given these limitations, however, one can recognize and label targeted sites in genomic DNA at low concentrations in very high efficiency under physiological conditions. The addition of a triplex-specific intercalator that stabilizes the triplex (23 ,34 ,35 ) gave an increase in this efficiency and demonstrates the applicability of these agents to complex nucleic acid systems. With a view to cell culture work with these ODNs, we have found that the concentration of the intercalator we used, 8 [mu]M coralyne, is non-toxic to cells in culture (data not shown).

Ultimately, the targeting of user-designed sites in DNA should have no limitations regarding sequence. The method shown here is an effective method for accomplishing this: the use of RecA protein to catalyze the homology search and strand exchange by ODNs, enabling the covalent crosslinking to the targeted site. Our previous demonstration (13 ) of efficiency and selectivity of this method in plasmid DNA is now shown applicable to whole genomic DNA. We had shown that the length of the oligonucleotide needed to be at least 30 bases (13 ). In the more complex system used here, efficiency may benefit by using an ODN a few more bases longer, such as the 50mer RAO1 in Figure 3 .

The utility of agents that specifically label DNA is broad. These reactive ODNs could see immediate use in the isolation of rare sequences in complex dsDNA. For example, using chlorambucil-bearing ODNs with a biotin tag, it would be straightforward to affinity-capture complementary sequences of dsDNA which are hybridized and crosslinked to the ODN. Release of the captured DNA could be effected by depurination and strand scission of the adducted guanine adduct using the mild, non-denaturing conditions previously described by Povsic et al. (8 ). Another application of these ODNs might be their use as artificial restriction enzymes. Double-stranded cleavage of DNA would require two sites of crosslinking from the ODN to the target site on DNA, which we have shown with TFOs (7 ) and RAOs (M. Podyminogin, unpublished results).

The potential of this approach for modification of genes in cells for therapeutic purposes is most interesting. Covalent modification of targeted sites in cells would be expected to inhibit transcription by physical blockage (36 ). More importantly, permanent alteration in gene function would be achieved by the site-directed mutagenesis these agents would induce (1 ). Shuttle vector experiments have shown that targeted modification of the supF gene by photoreactive TFOs elicits mutations when processed by mammalian cells, although the efficiency reported to date is low (37 ,38 ). Modification of both strands of the target site has the potential to produce much higher rates of mutation, as we have found in preliminary studies. This powerful ability to directly change the code of a gene may be applied to correction of genetic defects due to single point mutations or to inactivation of gene function. The latter might find use, for instance, in inactivation of genes responsible for certain autoimmune diseases like type I diabetes (14 ). Ultimately, the genetic modification principles described herein are preliminary steps to a novel type of gene therapy based on synthetic oligonucleotides that modify the function of endogenous genes.

ACKNOWLEDGEMENTS

We wish to thank Dr Vladimir Gorn for synthesis of oligonucleotides, Deborah Lucas for conjugation reactions, and Drs Igor Kutyavin, David Brown and Joe Hedgpeth for helpful discussions.

REFERENCES

1 Takasugi, M., Guendouz, A., Chassignol, M., Decout, J.L., Lhomme, J., Thuong, N.T. and Helene, C. (1991) Proc. Natl. Acad. Sci. USA 88,5602-5606.

2 Havre, P.A., Gunther, E.J., Gasparro, F.P. and Glazer, P.M. (1993) Proc. Natl. Acad. Sci. USA 90, 7879-7883. MEDLINE Abstract

3 Vlassov, V.V., Gaidamakov, S.A., Zarytova, V.F., Knorre, D.G., Levina, A.S., Nikonova, A.A., Podust, L.M. and Fedorova, O.S. (1988) Gene 72,313-322.

4 Povsic, T.J. and Dervan, P.B. (1990) J. Am. Chem. Soc. 112,9428-9430.

5 Shaw, J.-P., Miligan, J.F., Krawczyk, S.H. and Matteucci, M. (1991) J. Am. Chem. Soc. 113, 7765-7766.

6 Grant, K.B. and Dervan, P.B. (1996) Biochemistry 35, 12313-12319. MEDLINE Abstract

7 Kutyavin, I.V., Gamper, H.B., Gall, A.A. and Meyer, R.B. (1993) J. Am. Chem. Soc. 115, 9303-9304.

8 Povsic, T.J., Strobel, S.A. and Dervan, P.B. (1992) J. Am. Chem. Soc. 114, 5934-5941.

9 Gonda, D.K., Shibata, T. and Radding, C.M. (1985) Biochemistry 24,413-420.

10 Ferrin, L.J. and Camerini-Otero, R.D. (1991) Science 254,1494-1497.

11 Rigas, B., Welcher, A.A., Ward, D.C. and Weissman, S.M. (1986) Proc. Natl. Acad. Sci. USA 83, 9591-9595. MEDLINE Abstract

12 Podyminogin, M., Meyer, R.B. and Gamper, H.G. (1995) Biochemistry 34, 13098-13108. MEDLINE Abstract

13 Podyminogin, M., Meyer, R.B. and Gamper, H.B. (1996) Biochemistry 34, 7267-7274.

14 Nepom, G.T. and Erlich, H. (1991) Annu. Rev. Immunol. 9, 493-525. MEDLINE Abstract

15 Larhammar, D., Hyidig-Nielsen, J.J., Servenius, B., Andersson, G., Rask, L. and Peterson, P.A. (1983) Proc. Natl. Acad. Sci. USA 80,7313-7317.

16 Petrie, C.R., Reed, M.W., Adams, A.D. and Meyer, R.B. (1992) Bioconjug. Chem. 3, 85-87. MEDLINE Abstract

17 Meyer, R.B., Jr, Tabone, J.C., Hurst, G., Smith, T.M. and Gamper, H. (1989) J. Am. Chem. Soc. 111, 8517-8519.

18 Gamper, H.B., Reed, M.W., Cox, T., Virosco, J.S., Adams, A.D., Gall, A.A., Scholler, J.K. and Meyer, R.B. (1993) Nucleic Acids Res. 21,145-150.

19 Cantor, C.R., Warshaw, M.M. and Shapiro, H. (1970) Biopolymers 9,1059-1077.

20 Pfeifer, G.P. and Riggs, A.D. (1993) Methods Mol. Biol. 15,153-168.

21 Mueller, P.R., Garrity, P.A. and Wold, B. (1994) In Ausubel, F.M. et al. (eds), Current Protocols in Molecular Biology. John Wiley & Sons, Inc., vol. 2,pp. 15.5.1-15.5.26.

22 Gamper, H.B., Afonina, I., Belousov, E., Reed, M.W. and Podyminogin, M.A. (1997) In Kmiec, E.B. (ed.), Methods in Molecular Biology: Gene Targeting Vector Protocols. Humana Press, in press.

23 Lee, J.S., Latimer, L.J.P. and Hampel, K.J. (1993) Biochemistry 32, 5591-5597. MEDLINE Abstract

24 Milligan, J.F., Krawczyk, S.H., Wadwani, S. and Matteucci, M.D. (1993) Nucleic Acids Res. 21, 327-333. MEDLINE Abstract

25 Cheng, A.J. and Van Dyke, M.W. (1993) Nucleic Acids Res. 21, 5630-5635. MEDLINE Abstract

26 Krawczyk, S.H., Milligan, J.F., Wadwani, S., Moulds, C., Froehler, B.C. and Matteucci, M.D. (1992) Proc. Natl. Acad. Sci. USA 89,3761-3764.

27 Chiu, S.K., Rao, B.J., Story, R.M. and Radding, C.M. (1993) Biochemistry 32, 13146-13155. MEDLINE Abstract

28 Radding, C.M. (1991) J. Biol. Chem. 266,5355-5358.

29 Giovannangeli, C., Diviacco, S., Labrousse, V., Gryaznov, S., Charneau, P. and Helene, C. (1997) Proc. Natl. Acad. Sci. USA 94, 79-84. MEDLINE Abstract

30 Griffin, L.C. and Dervan, P.B. (1989) Science 245, 967-971. MEDLINE Abstract

31 Griffin, L.C., Keissling, L.L., Beal, P.A., Gillespie, P. and Dervan, P.B. (1992) J. Am. Chem. Soc. 114, 7976-7982.

32 Huang, C.-Y. and Miller, P.S. (1993) J. Am. Chem. Soc. 115, 10456-10457.

33 Froehler, B.C., Terhorst, T., Shaw J.P. and McCurdy, S.N. (1992) Biochemistry 31, 1603-1609. MEDLINE Abstract

34 Wilson, W.D., Tanious, F.A., Mizan, S., Yao, S., Kiselyov, A.S., Zon, G. and Strekowski, L. (1993) Biochemistry 32, 10614-10621. MEDLINE Abstract

35 Mergny, J.L., Duval-Valentin, G., Nguyen, C.H., Perrouault, L., Faucon, B., Rougee, M., Montenay-Garestier, T., Bisagni, E. and Helene, C. (1992) Science 256, 1681-1684. MEDLINE Abstract

36 Duval-Valentin, G., Thuong, N.T. and Helene, C. (1992) Proc. Natl. Acad. Sci. USA 89, 504-508.

37 Havre, P.A. and Glazer, P.M. (1993) J. Virol. 67, 7324-7331. MEDLINE Abstract

38 Sandor, Z. and Bredberg, A. (1994) Nucleic Acids Res. 22, 2051-2056. MEDLINE Abstract


*To whom correspondence should be addressed. Tel: +1 425 485 8566; Fax: +1 425 486 8336; Email: rmeyer@epochpharm.com
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
A. Ziemba, L. C. Derosier, R. Methvin, C.-Y. Song, E. Clary, W. Kahn, D. Milesi, V. Gorn, M. Reed, and S. Ebbinghaus
Repair of triplex-directed DNA alkylation by nucleotide excision repair
Nucleic Acids Res., November 1, 2001; 29(21): 4257 - 4263.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. P. Knauert and P. M. Glazer
Triplex forming oligonucleotides: sequence-specific tools for gene targeting
Hum. Mol. Genet., October 1, 2001; 10(20): 2243 - 2251.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
O. A. Sedelnikova, I. G. Panyutin, A. N. Luu, and R. D. Neumann
The stability of DNA triplexes inside cells as studied by iodine-125 radioprinting
Nucleic Acids Res., October 1, 1999; 27(19): 3844 - 3850.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. P. Chan, M. Lin, A. F. Faruqi, J. Powell, M. M. Seidman, and P. M. Glazer
Targeted Correction of an Episomal Gene in Mammalian Cells by a Short DNA Fragment Tethered to a Triplex-forming Oligonucleotide
J. Biol. Chem., April 23, 1999; 274(17): 11541 - 11548.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (97K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (20)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Belousov, E. S.
Right arrow Articles by Meyer, R. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Belousov, E. S.
Right arrow Articles by Meyer, R. B.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?