Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (99K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (21)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Sioud, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sioud, M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 1995 Oxford University Press 333-338

Footnote

Effects of variations in length of hammerhead ribozyme antisense arms upon the cleavage of longer RNA substrates

Effects of variations in length of hammerhead ribozyme antisense arms upon the cleavage of longer RNA substrates Mouldy Sioud

Institute of Immunology and Rheumatology, The National Hospital, Fr. Qvamsgt. 1, N-0172 Oslo , Norway

Received September 27, 1996; Revised and Accepted November 20, 1996

ABSTRACT

The efficacy of intracellular binding of hammerhead ribozyme to its cleavage site in target RNA is a major requirement for its use as a therapeutic agent. Such efficacy can be influenced by several factors, such as the length of the ribozyme antisense arms and mRNA secondary structures. Analysis of various IL-2 hammerhead ribozymes having different antisense arms but directed to the same site predicts that the hammerhead ribozyme target site is present within a double-stranded region that is flanked by single-stranded loops. Extension of the low cleaving hammerhead ribozyme antisense arms by nucleotides that base pair with the single-stranded regions facilitated the hammerhead ribozyme binding to longer RNA substrates (e.g. mRNA). In addition, a correlation between the in vitro and intracellular results was also found. Thus, the present study would facilitate the design of hammerhead ribozymes directed against higher order structured sites. Further, it emphasises the importance of detailed structural investigations of hammerhead ribozyme full-length target RNAs.

INTRODUCTION

The inactivation of gene function by reverse genetics is important for elucidating the function of a particular gene and could also have a great impact upon the treatment of infectious and other diseases based upon aberrant gene expression. Hammerhead ribozymes have been synthesised for various target sequences and have been shown to have catalytic activity in vitro and in some cases also in the cell ( 1 - 7 ). Interestingly, hammerhead ribozymes directed against mouse tumour necrosis factor-[alpha] (TNF-[alpha]) can be delivered in a drug-like manner to mice with the use of cationic liposomes ( 8 ). Administered hammerhead ribozymes were taken by peritoneal cells. When mice were injected with LPS, a process that induces TNF-[alpha] gene expression, the TNF-[alpha] protein synthesis was significantly blocked, indicating for the first time that systemic injection of hammerhead ribozymes is possible. This type of delivery can even be targeted to specific cell types. However, despite an increasing number of successful studies based on general rules for antisense sequences, the design of a hammerhead ribozyme that can cleave its target in the cell while maintaining a high turnover is still under investigation.

The difficulties in establishing versatile roles for hammerhead ribozyme design may arise from the lack of knowledge of the potential cellular factors that affect intracellular hammerhead ribozyme catalysis. Such catalysis can be affected by a number of potential factors such as the ability of hammerhead ribozymes to co-localise with target RNA, the accessibility of target sites, mRNA secondary structures and the effect of cellular proteins upon RNA catalysis ( 9 - 14 ).

Kinetic models for hammerhead ribozyme actions and thermodynamic parameters analysis predict that hammerhead ribozymes with short antisense arms have a high turnover when compared to their counterparts with long arms ( 15 , 16 ). However, there are cases where hammerhead ribozymes with long antisense arms were found to be more active in the cell when compared with shorter derivatives ( 17 ). In this connection, we have noted that an IL-2 hammerhead ribozyme with 16 nucleotides (nt) was significantly less active when compared with hammerhead ribozymes having 21 or 27 nt antisense arms ( 14 ). In the case of a hammerhead ribozyme with 14 nt (the C of the GUC triplet is not included) as antisense arms, a significant correlation between various hammerhead ribozyme concentrations and their intracellular activities was not found. Furthermore, experimental evidence indicates that the hammerhead ribozyme was delivered to the cell, since 5' end-radiolabelled short target RNA was efficiently cleaved by total RNAs prepared from cells transfected with the hammerhead ribozyme (unpublished data). Thus, these observations would suggest that the structure of the target IL-2 mRNA may be responsible for the limited activity of the hammerhead ribozymes with short antisense arms. In order to both understand this phenomena and to determine whether a shortened version of IL-2 hammerhead ribozyme could be designed that would block IL-2 gene expression, a further analysis of the cleavage activity of various IL-2 hammerhead ribozymes in vitro using different IL-2 target RNAs, and their intracellular potencies were performed. Experimental data suggested that an important part of the chosen IL-2 site (11 nt) is present within a double-stranded RNA region which limited the ribozyme binding. Extension of the hammerhead ribozyme antisense arms with nucleotides that base pair with the single-stranded regions was found to facilitate its binding to longer RNA substrates and hence its cellular activity.

MATERIALS AND METHODS

IL-2 ribozyme antisense arms

+1

5'... AUG UACAGGAUGCAAC UCCU GU C UUGCAUUG CACUAAGUCUUG...3'

(6 nt) Rz14 (8 nt)

5'... AUG UACAGGAUGCAAC UCCU GU C UUGCAUUGC ACUAAGUCUUG...3'

(6 nt) Rz15 (9 nt)

5'... AUG UACAGGAUGC AACUCCU GU C UUGCAUUGC ACUAAGUCUUG...3'

(9 nt) Rz18 (9 nt)

Hammerhead ribozyme sequences

Hammerhead ribozyme RNAs were synthesised by in vitro transcription using DNA oligodeoxynucleotides as templates. The Rz14, Rz15 and Rz18 were designed to begin and end precisely at the end of the antisense portions as indicated above. Rz14 was also synthesised chemically.

Rz14: 5'-CAAUGCAACUGAUGAGUCCGUGAGGACGAAACAGGA-3';

Rz15: 5'- G CAAUGCAACUGAUGAGUCCGUGAGGACGAAACAGGA-3';

Rz18: 5'- G CAAUGCAACUGAUGAGUCCGUGAGGACGAAACAGGA GUU- 3';

Rz(Gaa): 5'- G CAAUGCAACUGAUGAGUCCGUGAGGACGAAACAGGA G aa - 3';

Rz(aaa): 5'-CAAUGC- AACUGAUGAGUCCGUGAGGACGAAACAGGAaaa - 3'.

The hammerhead core sequence is underlined. Bold letter correspond to nucleotides that enhance ribozyme binding to longer substrates. Lower case letters correspond to nucleotide that do not base pair with the IL-2 target site. Non-cleaving hammerhead ribozymes were made by deleting the G12 from the catalytic core of the ribozyme. For numbering see Hertel et al . ( 18 ).

RNA substrates

The 15 nt target RNA (5'-UCCU GUC UUGCAUU G -3') was synthesised by Phil Hendry (CSIRO, Sydney, Australia). Deoxyribonucleotide is underlined in this sequence. The 500 nt target RNA was synthesized by in vitro transcription using a PCR amplified product. Briefly, total RNA prepared from PHA stimulated peripheral blood mononuclear cells was reverse transcribed using an IL-2 specific primer (5'-TCAAGTCAGTGTTGAGATGATG-3'), and PCR amplified using a second primer specific for IL-2, having at its 5' end the T7 promoter top strand (5'-TAATACGACTCACTATAGTTTAATCACTACTCACAGTAA-3'). The expected amplified product (520 base pairs) was purified and in vitro transcribed using the T7 RNA polymerase. The 809 nt target RNA corresponding to approximately the full-length of IL-2 mRNA was also generated by in vitro transcription using IL-2 cDNA kindly provided by Dr Alain Mir (CSIRO, Sydney, Australia). Both targets were cleaved by the ribozyme at the expected site. In the case of the 809 target RNA, two fragments of 82 nt (5'P) and of 727 nt (3'P) were generated, while the 500 nt target RNA generated a 62 nt (5'P) and a 438 nt (3'P) following ribozyme cleavage. The 15 nt substrate was labelled on its 5' end using [[gamma]- 32 P]ATP and polynucleotide kinase, while longer substrates were internally labelled with [[alpha]- 32 P]ATP during in vitro transcription.

In vitro hammerhead ribozyme cleavage activity

Cleavage reactions were carried out at 37oC in buffer containing 50 mM Tris-HCl, pH 7.4 and 10 mM MgCl 2. In the case of multiple turnover experiments, the samples were removed at specified times, quenched by adding an equal volume of 40 mM EDTA, 80% formamide, 0.1% bromophenol blue and 0.1% xylene cyanol and quickly frozen at -20oC until analysis. Cleavage products were separated by electrophoresis on a 15% or a 6% polyacrylamide gel containing 7 M urea. Products were quantified by PhosphorImager (FUJIX BAS 1000) using TINA program.

Competition experiments

For each experiment two identical reaction mixtures were prepared containing the 5' end-labelled 15 nt target substrate (20 nM) and the hammerhead ribozyme (1.5 nM) in reaction mixture containing 50 mM Tris-HCl, pH 7.4 and 10 mM MgCl 2 . A 20-fold excess of unlabelled substrate RNA was added to one of the reactions and the incubation was continued. At specified times, 10 [mu]l samples were removed and quenched by adding an equal volume of 40 mM EDTA, 80% formamide, 0.1% bromophenol blue and 0.1% xylene cyanol. Products were separated by electrophoresis on a 15% polyacrylamide gel containing 7 M urea and quantified as above.

In the cell activity of IL-2 hammerhead ribozymes

The in vitro transcribed and gel purified test molecules were delivered to 10 5 peripheral blood mononuclear cells (PBMC) in 100 [mu]l of complete medium (RPMI +10% FCS) by the use of cationic liposomes (DOTAP) at 25 [mu]g/ml as recommended by the manufacturer (Boehringer Mannheim, Germany). Following 6 h transfection time, the cells were stimulated with phytohemagglutinin (PHA) at 5 [mu]g/ml for a period of 12 h, and subsequently the supernatants were collected. Their growth-promoting activity was determined by using an IL-2 dependent mouse cell line (CTLL-2) as described previously ( 11 ) as well as by ELISA as recommended by the manufacturer (Genzyme, Diagnostic).

RESULTS AND DISCUSSION

Comparative cleavage activity of various IL-2 hammerhead ribozymes upon short and long target RNA substrates

An important feature of synthetic hammerhead ribozymes is the length and base composition of their antisense arms. For turnover reasons, this length is usually chosen to be 8 or 7 nt on either side, so dissociation and a complete catalytic cycle can occur properly ( 15 , 19 ). Based upon the study by Herschlag ( 19 ) the free energy of RNA duplex formed between hammerhead ribozyme and its target RNA should be less than -16 kcal/mol for efficient catalytic cycle. From this prediction it would appear that U and/or AU rich hammerhead ribozymes are more desirable than GC-rich hammerhead ribozymes, since the latter reach a [Delta]G of -16 kcal with only a few base-pairs. In addition to the above prediction one hypothesis is that pyrimidines are more likely to be exposed within the mRNA secondary structure, and therefore are suitable sites for targeting. Despite these assumptions we noted that the intracellular activity of hammerhead ribozymes having 14 to 16 nt antisense arms and targeted to a chosen IL-2 site with high pyrimidine content was poor compared to hammerhead ribozymes with longer antisense arms ( 14 ). In order to clarify this phenomena we therefore further analysed the cleavage activity of newly designed IL-2 hammerhead ribozymes Rz14, Rz15 and Rz18 with 14, 15 or 18 nt antisense arms, respectively, to cleave both a 15 and a 500 nt target RNA (Fig. 1 A-D). Under multiple turnover reactions the Rz14 cleaved the 15 nt substrate at 37oC with high efficiency (Fig. 1 A and B). In contrast, and despite its well behaved structure, it was found to be much less active against the 500 nt target RNA (Fig. 1 C and D). Interestingly, under the same conditions both the Rz15 and Rz18 showed a strong cleavage activity towards the 500 nt target RNA as compared to Rz14 (Fig. 1 C and D). The simplest explanation for this finding is that the 5'G or 5G' and 3'GUU present in Rz15 or in Rz18, respectively, facilitate the cleavage of the 500 nt target RNA in vitro .


Figure 1 . In vitro cleavage of Rz14, Rz15 and Rz18. ( A ) PhosphorImager printout of 15% denaturing polyacrylamide gel. 1.5 nM of Rz14, Rz15 or Rz18 was mixed with 20 nM of 5'end-labelled 5 nt substrate in reaction mixtures containing 50 mM Tris-HCl pH 7.4 and 10 mM MgCl 2 at 37oC for 30 min. Following incubation, cleavage products were separated by electrophoresis. ( B) Multiple turnover reaction kinetics of Rz14, Rz15 and Rz18 to cleave the 5' end-labelled 15 nt target RNA. The cleavage conditions are as in (A). At appropriate times, 10 [mu]l aliquot was removed from the reaction and added to 10 [mu]l quenching solution and then cleavage products were separated by electrophoresis on 15% polyacrylamide denaturing gels. The radioactivity of each 5' cleavage product was quantified and expressed as a percentage of cleaved substrate. Each point represents the mean of at least five values. ( C) PhosphorImager printout of 6% polyacrylamide denaturing gel showing the in vitro cleavage activity of the 500 nt target RNA by Rz14, Rz15 and Rz18. In these experiments 20 nM of Rz14, Rz15 or Rz18 were mixed with 200 nM internally [ 32 P]-radiolabelled 500 nt target RNA in reaction mixture containing 50 mM Tris-HCl pH 7.4 and 10 mM MgCl 2 at 37oC for 90 min. ( D) Multiple turnover reactions. The cleavage conditions are as in (C). For each sample, the radioactivity present within the 3'P and the 5'P was quantified by PhosphorImager and divided by the total radioactivity present within both fragments and uncleaved fraction. The results were expressed as a percentage. The low intracellular activity of IL-2 hammerhead ribozymes with short antisense arms as compared to the hammerhead ribozyme with longer antisense arms was previously explained by the skewed base composition of the IL-2 site, since it contains 12 pyrimidines within 16 nucleotides, and since the hammerhead ribozyme with short hybridizing arms was found to cleave in vitro a 5' end-labelled 15 nt target RNA with a maximum activity at 33oC, despite its predicted T m of 40oC. These results suggested that in the cell the RNA/RNA duplex formed by, for example, Rz14 and the chosen IL-2 target RNA will not be sufficiently stable to allow the cleavage step to occur. However, if this prediction turns out to be the case, lowering the temperature from, for example, 37oC to 33oC, would enable the Rz14 to additionally cleave the 500 nt target RNA, since the 15 nt and the 500 nt contain identical RNA sites. Unfortunately, lowering the temperature to 33oC did not increase the efficacy of Rz14 to cleave the 500 nt (data not shown). This indicates that the relative stability of the hammerhead ribozyme/substrate duplex as predicted from in vitro experiments, using a short 15 nt target RNA, cannot be responsible for the low activity of IL-2 hammerhead ribozymes with short antisense arms in the cell.

In the next set of experiments, we have investigated whether the same phenomena would apply to the full length target IL-2 mRNA (809 nt). As shown in Figure 2 A and B, the Rz14 was inefficient at cleaving, the full length target mRNA as compared to Rz15 and Rz18. Again lowering the cleavage temperature did not increase the Rz14 cleavage activity.


Figure 2 . Cleavage of the full length RNA substrate (809 nt) by Rz14, Rz14 and Rz18. ( A) PhosphorImager printout of 6% polyacrylamide denaturing gel. 20 nM of Rz14, Rz15 or Rz18 were mixed with 200 nM of internally radiolabelled 809 nt target RNA in reaction mixtures containing 50 mM Tris-HCl pH 7.4 and 10 mM MgCl 2 at 37oC for 90 min. Following incubation, cleavage products were separated by electrophoresis. ( B) Multiple turnover reactions. The cleavage conditions are as in (A). Products were separated by 6% polyacrylamide denaturing gel, and then quantified as in Figure 1D. Each point represents the mean of at least four values.

The data presented above suggest that the 500 nt and the 809 nt may adopt alternative conformations that prevent the binding of the Rz14, but not other hammerhead ribozymes, especially the Rz18. This problem is of particular relevance to gene inactivation where the ribozyme sites are usually present within longer RNAs. The intramolecular interactions of the IL-2 site with other parts of the mRNA are more likely to take place with the neighbouring sequences, since the same cleavage results were obtained with the 500 nt and the 809 nt target RNAs.

To confirm that the binding of the Rz14 with the 500 or 806 nt was slow compared to Rz15 and Rz18, inhibition experiments of the Rz14 to cleave the 5' end-labelled 15 nt target RNA using excess of unlabelled 15, 500 or 806 nt as competitor, were performed under multiple turnover reactions (Fig. 3 A). Excess of unlabelled 15 nt RNA significantly inhibited the 5' end-labelled 15 nt cleavage. In contrast, excess of the 500 nt or the 809 nt target RNA was unable to compete the 5' end-labelled 15 nt cleavage. Notably, in the case of Rz18, all substrates competed significantly with the 5' end-labelled 15 nt cleavage (Fig. 3 B). The same RNA substrates competed with the Rz15 to cleave the 5' end-labelled 15 nt target RNA (data not shown). These results further indicate that in solution both Rz15 and Rz18 bind more effectively to longer RNAs as compared to Rz14. Furthermore, the inability of longer target substrates to inhibit the 5' end-labelled 15 nt target RNA cleavage by Rz14 supports the notion that at least 15 nt of the IL-2 target site should be masked by secondary and/or tertiary structure, since both the 15 nt and the long target substrates contain identical Rz14 binding sites. It is worth noting that an ~10-fold excess of Rz14, as compared to Rz15, is needed in order to obtain comparable in vitro cleavage activity of long target RNAs.


Figure 3 . Competition experiments. ( A) Excess of unlabelled long target RNAs are unable to compete with the Rz14 to cleave a 5' end-labelled 15 nt target RNA. Rz14 (1.5 nM) was mixed with 5' end-labelled 15-nt substrate (20 nM) in reaction mixtures containing 50 mM Tris-HCl pH 7.4 and 10 mM MgCl 2 at 37oC for 30 min in the presence or absence of excess of unlabelled 15, 500 or 806 nt target RNAs as described in Materials and Methods. Each point represent the mean of at least three values. ( B) Excess of unlabelled 15, 500 or 809 nt target RNAs are able to compete with the Rz18 to cleave a 5' end-labelled 15 nt target RNA. Conditions for cleavage are identical to (A). Each point represents the mean of at least three values.

According to many analyses, including the present study, it appears that the rate-limiting step with longer target RNAs is not the cleavage step, but the formation of active ribozyme/substrate complex ( 14 , 17 , 20 ). Such active complexes are more likely to be formed rapidly with Rz15 and Rz18 as compared to Rz14.

To further support our experimental data with a working model, the most stable secondary structure of IL-2 was predicted using the MUL-Fold program ( 21 ). Figure 4 A shows the potential thermo-dynamically stable IL-2 mRNA structure surrounding the target site. Notably, in this structure, the 15 nt IL-2 site (nt in bold) is predicted to form a base pairing interaction with the neighbouring sequences. In addition, the nucleotides C and CAA (as indicated by asterisk) are present in single stranded loop regions. These nucleotides are crucial for hammerhead ribozyme cleavage of long target RNAs, since complementary bases 5'G or 5'G and 3'GUU present in Rz15 or in Rz18, respectively, were found to increase both their binding and catalytic activity. Interestingly, two other versions of Rz14 with 5' G and 3' GU or with 5' G and 3'Gaa (only the G base pairs with the IL-2 target site) cleaved the 500 and 800 long target RNA with more efficiency as compared to the Rz14. In contrast, a version of Rz14 with 3'aaa showed the same cleavage activity as the Rz14. These results indicate that there is a correlation of the cleavage activity versus single-strandedness of the target site that base pairs with the hammerhead ribozyme. Furthermore, they suggest that hammerhead ribozyme annealing may depend on an end-invasion event.


Figure 4 . Computer-predicted secondary structure. ( A) Predicted secondary structure of IL-2 mRNA surrounding the chosen IL-2 site. The 15 nt target site is indicated by bold letters. Nucleotide indicated by asterisk (*) were found to facilitate the ribozyme binding to the 500 and 809 nt. The arrow indicates the cleavage site for Rz14, Rz15 and Rz18. ( B) Predicted secondary structure of Rz14, Rz15 and Rz18.

In general the masking of a particular ribozyme cleavage site via double stranded regions could be a problem if the site represents, for example, a disease causing mutation. Such a problem can be resolved, as shown here, by extending the ribozyme antisense arms to include single-stranded loops. Enhancement of hammerhead ribozyme cleavage activity in vitro by oligodeoxynucleotides called `facilitators' was reported by Goodchild ( 22 ). These types of facilitators unconnected to the hammerhead ribozyme may not have much effect in the cell, since the reaction would involve a trimolecular interaction rather than the current bimolecular one.

In the cell efficiency of IL-2 hammerhead ribozymes correlates with their in vitro cleavage activity of long target RNA substrates

In order to see whether a correlation between the in vitro cleavage activity and intracellular activity of the IL-2 hammerhead ribozymes exist, we investigated their in vivo potency. In this study hammerhead ribozymes were gel purified and their concentration was estimated by both measurement of absorbency at 260 nm as well as by polyacrylamide gel quantification using known RNA concentrations. Data presented in Figure 5 indicate that the Rz14 is significantly less active as compared to Rz15 and Rz18. In the first step of target RNA recognition, the hammerhead ribozyme forms partially duplex RNA with its target sequence and functions as conventional antisense. Such duplexes are also formed by the inactive hammerhead ribozymes, thus providing explanation for their intracellular effects upon IL-2 gene expression (Fig. 5 ).


Figure 5 . Intracellular inhibition of the IL-2 gene expression by Rz14, Rz16, Rz18 and mutant hammerhead ribozymes. Test molecules were delivered to 10 5 PBMC in 100 [mu]l medium as described in Materials and Methods. The final concentration of each molecule was indicated on the bottom of the figure. Following transfection and stimulation by PHA, each supernatant was tested for the presence of IL-2 by an ELISA as described by the manufacturer (Genzyme, Diagnostic). a The values were normalized against control cells transfected with only liposomes. m = Mutant ribozyme. Similar inhibitions were obtained with the CTLL-2 Bioassay (data not shown).

Taken together, the data supports the conclusions regarding the masking of the IL-2 targeted site within secondary structure in the longer substrates (e.g. mRNA). This prediction is more likely to be correct. However, if we envisage that the IL-2 site is not present within a secondary structure, although more unlikely, the data would also support the notion that elongation of the antisense arms, increases the catalytic activity of the hammerhead ribozyme against longer substrates. Antisense arms with optimal length that allow equilibrium between free and ribozyme-bound prior to cleavage step will be more suitable, because they would increase specificity.

A number of observations suggest that the low binding energy of R14 to its target site, provided it is linear (unstructured), may not be a problem in the cell as many crucial cellular RNA/RNA interactions were found to involve short base-pairing interactions. In the case of pre-mRNA splicing, such weak interactions are stabilized by protein factors that exist in eukaryotic cells ( 23 ). In this connection an IL-2 hammerhead ribozyme specific binding peptide, selected from random peptide phage libraries, was found to stabilize the binding of the Rz14 to the 15 nt RNA substrate in vitro (M.Sioud, manuscript in preparation). In the presence of optimum peptide concentration the cleavage activity of the Rz14 became maximal at 37oC as compared to 33oC in the absence of peptide. This observation further underlies the important interplay between proteins and RNA catalysis in general ( 11 , 14 ).

In conclusion, our data would facilitate the design of hammerhead ribozymes targeted to structured RNA sites. As shown, facilitation of the hammerhead ribozyme to bind long target RNA can be achieved by the extension of the hammerhead ribozyme antisense arms to cover single stranded loops. In addition, the structured 15 nt site should be used as a model to explore strategies for enhancing Rz14 binding to long target RNA. Finally, the design of an active IL-2 ribozyme may well have therapeutic applications, since IL-2 is frequently found to be involved in autoimmune disorders. In this connection, for example, it was shown that transgenic mice expressing constitutive levels of IL-2 in islet [beta] cells developed massive inflammatory response directed at the [beta] cells of the pancreas ( 24 ). Although clinical use of hammerhead ribozyme will be more likely to rely upon synthetic genes, in which ribozymes are synthesised continuously within target cells ( 5 ), the Rz18 delivered to mice with the use of cationic liposomes can be recovered in active form within total RNA prepared from peritoneal cells 40 hours post-intraperitoneal injection.

ACKNOWLEDGEMENTS

This work was supported by grants from the European Commission, Biotechnology programme (BI02-CT94-2092) and the Norwegian Women's Public Health Organization. Thanks to Dr Alain Mir for the generous gift of the IL-2 cDNA clone, Dr Maxine McCall for scientific discussions and Lill Jespersen for technical help.

REFERENCES

1 Haseloff,J. and Gerlach,W.L. (1988) Nature, 334, 585-591. MEDLINE Abstract

2 Cameron,F. and Jennings,P. (1989) Proc. Natl Acad. Sci. USA, 86, 9139-9143.

3 Cotten,M. and Birnstiel,M.L. (1989) EMBO J., 8, 3861-3866. MEDLINE Abstract

4 Sarver,N., Cantin,E.M., Chang,P.S., Zaia,J.A., Ladne,P.A., Stephens,D.A. and Rossi,J.J. (1990) Science, 247, 1222-1225. MEDLINE Abstract

5 Sioud,M. and Drlica,K. (1991) Proc. Natl. Acad. Sci. USA, 88, 7303-7307. MEDLINE Abstract

6 Heidenreich,O. and Eckstein,F. (1992) J. Biol. Chem. 267, 1904-1909. MEDLINE Abstract

7 Scanlon,K.J., Ishida,H. and Kashani-Sabet,M. (1994) Proc. Natl. Acad. Sci. USA, 91, 11123-11127. MEDLINE Abstract

8 Sioud,M. (1996) Eur. J. Immunol. 26, 1026-1031. MEDLINE Abstract

9 Sullenger,B.A. and Cech,T.R. (1993) Science, 262, 1566-1569. MEDLINE Abstract

10 L'huillier,P.J., Davis,S.R. and Bellamy,A.R. (1992) EMBO. J., 11, 4411-4418.

11 Sioud,M. (1994) J. Mol. Biol., 242, 619-629. MEDLINE Abstract

12 Bertrand,E.L. and Rossi,J.J. (1994) EMBO J. 13, 29O4-2912.

13 Tsuchihashi,Z., Khosla,M. and Herschlag,D. (1993) Science, 262, 99-102. MEDLINE Abstract

14 Sioud,M. and Jespersen,L. (1996) J. Mol. Biol., 257, 775-789. MEDLINE Abstract

15 Bertrand,E., Pictet,R. and Grange,T. (1994) Nucleic Acids Res., 22, 293-300.

16 Hertel,KJ., Herschlag,D. and Uhlenbeck,O.C. (1994) Biochemistry, 33, 3374-3385. MEDLINE Abstract

17 Crisell,P., Thompson,S. and James,W. (1993) Nucleic Acids Res., 21, 5251-5255. MEDLINE Abstract

18 Hertel,K.J., Pardi,A., Uhlenbeck,O.L, Koizumi,M., Ohtsuka.E., Vesugi.S., Cedergren,R., Eckstein,F and Gerlach,W.L (1992) Nucleic Acids Res., 20, 3252. MEDLINE Abstract

19 Herschlag,D. (1991) Proc. Natl. Acad. Sci. USA, 88, 6921-6925. MEDLINE Abstract

20 Ellis,J and Rogers,J. (1993) Nucleic Acids Res., 21, 5171-5178. MEDLINE Abstract

21 Jaeger,J., Turner,D. and Zuker,M. (1989) Proc. Natl. Acad. Sci. USA 86, 7706-7710. MEDLINE Abstract

22 Goodchild,J. (1992) Nucleic Acids Res., 20, 4607-4612. MEDLINE Abstract

23 Wu,J.Y., and Maniatis,T. (1993) Cell, 75, 1061-1070. MEDLINE Abstract

24 Elliott,E.A., and Flavell,R.A. (1994) Int. Immunol., 6, 1629-1637.

Return

Tel: +47 22 03 31 69; Fax: +47 22 20 72 87; Email: mosioud@embnet.uio.no.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
J. Kurreck, B. Bieber, R. Jahnel, and V. A. Erdmann
Comparative Study of DNA Enzymes and Ribozymes against the Same Full-length Messenger RNA of the Vanilloid Receptor Subtype I
J. Biol. Chem., February 22, 2002; 277(9): 7099 - 7107.
[Abstract] [Full Text] [PDF]

Home page
 Pharmacol. Rev.Home page
L. Q. Sun, M. J. Cairns, E. G. Saravolac, A. Baker, and W. L. Gerlach
Catalytic Nucleic Acids: From Lab to Applications
Pharmacol. Rev., September 1, 2000; 52(3): 325 - 348.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
Z.-D. Xu, L. Oey, S. Mohan, M. H. Kawachi, N.-S. Lee, J. J. Rossi, and Y. Fujita-Yamaguchi
Hammerhead Ribozyme-Mediated Cleavage of the Human Insulin-Like Growth Factor-II Ribonucleic Acid in Vitro and in Prostate Cancer Cells
Endocrinology, May 1, 1999; 140(5): 2134 - 2144.
[Abstract] [Full Text]

Home page
 BloodHome page
H. A. James and I. Gibson
The Therapeutic Potential of Ribozymes
Blood, January 15, 1998; 91(2): 371 - 382.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (99K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (21)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Sioud, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sioud, M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?