Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (549K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (82)
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Hayashi, S.
Right arrow Articles by Tanaka, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hayashi, S.
Right arrow Articles by Tanaka, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 1997 Oxford University Press 4035-4040

Functional modulation of estrogen receptor by redox state with reference to thioredoxin as a mediator

Functional modulation of estrogen receptor by redox state with reference to thioredoxin as a mediator Shin-ichi Hayashi*, Kyoko Hajiro-Nakanishi, Yuichi Makino1, Hidetaka Eguchi, Junji Yodoi2 and Hirotoshi Tanaka1

Department of Biochemistry, Saitama Cancer Center Research Institute, Komuro, Ina, Saitama 362, Japan, 1Second Department of Internal Medicine, Asahikawa Medical College, Asahikawa 078, Japan and 2Department of Biological Responses, Institute for Virus Research, Kyoto University, Shogoin-Kawaracho, Sakyo-Ku, Kyoto 660, Japan

Received July 7, 1997; Revised and Accepted September 4, 1997

ABSTRACT

Redox regulation of transcription factors has recently been demonstrated for AP-1, NF-[kappa]B, Sp-1 and glucocorticoid receptor in vitro and in vivo. The redox state in estrogen-dependent cells possibly influences the function of estrogen receptor (ER), and the regulation of the function of ER is essential for understanding of growth and differentiation of these cells, as well as promotion and progression of estrogen-associated cancer. In this paper, we first analyzed the effects of redox state on transcriptional activity of ER in terms of pS2 mRNA expression and transfection of ERE-CAT plasmid in human breast cancer cells. Addition of H2O2 at low concentrations lowered levels of pS2 mRNA and also down-regulated ERE-CAT activity, which was recovered by transfection of thioredoxin (TRX) expression vector. Next, the transfection of antisense TRX plasmid diminished ERE-CAT activity, and the activity was recovered by co-transfected sense TRX. Furthermore, specific DNA binding activity of recombinant ER was inhibited by sulfhydryl-modifying reagents and restored by the addition of recombinant TRX protein in electrophoretic mobility shift assay. These results in vitro and in vivo revealed that the transcription activity of ER is strongly influenced by its redox state, which is reversibly modulated by endogenous redox effector protein, TRX.

INTRODUCTION

Estrogen and its receptor play an important role in regulating growth and differentiation of the normal epithelium as well as in carcinogenesis of steroid hormone-dependent cancers. In breast cancer, the expression of the estrogen receptor (ER) is closely associated with the cancer biology, especially the development of tumor; i.e., presence or absence of ER is associated with growth of breast cancer cells: breast carcinomas which lack ER expression often reveal more aggressive phenotypes (1 -3 ). Moreover, expression of ER in tumor tissues is a good predictor of prognosis in endocrine treatment (4 ), which aims to inhibit the mitogenic stimulus produced by the ER bound to estrogen.

ER belongs to a family of nuclear receptors that have steroid and thyroid hormones as known ligands, and it regulates the transcription of various genes as a transcription factor upon binding to estrogen response elements (ERE) upstream of the target genes (5 -7 ). The transcriptional regulation of the ER gene is one of the major factors in mediating the estrogen effects on cells. We recently characterized the expression of ER mRNA in human primary breast cancers, and found that transcriptional regulation from a specific distal promoter is responsible for enhanced expression of ER related to breast carcinogenesis (8 ). Besides transcriptional regulation, post-transcriptional events are important in the regulation of ER activity, e. g., phosphorylation of ER protein at specific positions has been shown to influence the function of ER as a transcription factor (9 -11 ). The post-transcriptional regulation of ER by means other than phosphorylation is also an integral factor in understanding its function in cells.

Thioredoxin (TRX) stimulates the growth of various normal and cancer cell lines (12 -15 ), and expression of TRX increases in primary lung cancer, colon cancer, cervical neoplastic squamous cells and hepatocellular carcinoma (16 -18 ). Very recently, it has been reported that the transfection of dominant negative mutant TRX reversed a transformed phenotype of ER-positive human breast cancer cell line, MCF-7, suggesting that endogenous TRX plays an important role in malignant development of breast cancer (19 ). However, the endogenous molecular targets of TRX in breast carcinogenesis have not been identified yet.

Human TRX was originally discovered as a T cell growth factor secreted from HTLV-I-infected T cell (20 ). TRX is a 12 kDa ubiquitous protein that controls the redox state of various target proteins by means of thiol-disulfide exchanges as a constituent of cellular antioxidant defence systems (21 ,22 ). The redox-active sulfhydryls in TRX are located at a highly-conserved active-site sequence -Trp-Cys-Gly-Pro-Cys- (22 ). The pathway for the reduction of a protein disulfide by TRX entails nucleophilic attack by one of the active-site sulfhydryls, formation of a protein-protein disulfide, and subsequent intramolecular displacement of the reduced target proteins with concomitant formation of oxidized TRX (22 ). Recently, involvement of TRX in transcriptional processes of several genes has been suggested: transient transfection or exogenous application of TRX resulted in inhibition of NF-[kappa]B and induction of AP-1 activity (23 ,24 ), and the glucocorticoid receptor (GR) in isolated rat cytosol was stabilized as a reduced and ligand-binding form when TRX and TRX-dependent thiol-disulfide exchange system was added (25 ). Furthermore, we have recently reported that cellular glucocorticoid responsiveness is coordinately modulated by redox state and TRX levels in vivo (26 ). Thus, redox state in cells may be another important mechanism for post-transcriptional regulation of ER function, thereby playing a critical role in regulating the transcription activity of ER. This is the case, for example, in NF-[kappa]B (27 ), AP-1 (28 ), Sp-1 (29 ) and GR (26 ), since the ER has zinc fingers in its DNA binding domain, as Sp-1 and GR do, and since most cysteine residues converged in the DNA binding domain (nine of 13 cysteines). Here, we report for the first time that the cellular content of TRX determines the transcriptional activity of ER, indicating that the function of ER is highly sensitive to the cellular redox state.

MATERIALS AND METHODS

Cells and culture

Human mammary tumor cells, ZR-75-1, were cultured in RPMI1640 medium supplemented with 10% fetal calf serum, 100 nM 17[beta]-estradiol, 2 mM l-glutamine, and 2 µg/ml of gentamicin at 37oC in a humidified atmosphere of 5% CO2 in air.

Reagents and antibodies

Diamide, dithiothreitol (DTT), N-ethylmaleimide (NEM), and 17[beta]-estradiol were purchased from Sigma Co. (St. Louis, MO); other chemicals from Wako Pure Chemical (Osaka, Japan). Recombinant TRX (rTRX) was produced by the method described previously and kindly provided by Ajinomoto Co. Inc., Basic Research Laboratory, Kawasaki, Japan (30 ). Anti-human ER antibody G-20 was obtained from Santa Cruz Biotech. (Nashanic Station, NJ). All enzymes were purchased from TaKaRa Shuzo (Tokyo, Japan).

Plasmids

The bacterial expression plasmid of GST-hER was constructed from pGEX2T expression plasmid (Pharmacia) and wild type of human ER cDNA kindly supplied by Dr B. S. Katzenellenbogen (University of Illinois, Urbana, IL) (31 ). BamHI and EcoRI sites were designed adjacent to the initiation and termination codons of ER cDNA, respectively, using PCR. The amplified cDNA by PCR was subcloned into the BamHI-EcoRI site of pGEX2T. The sequence of cDNA clone in pGEX2T was confirmed by sequencing using ALF Auto Read Sequencing Kit (Pharmacia). The expression plasmid for TRX, pcDSR[alpha]ADF, and antisense TRX expression plasmid, pASADF, were prepared as described previously (26 ). Antisense TRX expression plasmid pcASADF has been ascertained to reduce the cellular thioredoxin protein levels (26 ). The estrogen-responsive reporter construct pERE-CAT was kindly supplied by Dr H. Oshima. In brief, the oligonucleotides containing ERE tandem repeats (non-coding strand, 5'-GATCCAGGTCAGGATGACCTAGCTACGGATCCAGGTCAGGATGACCTAGCTACGGATC-3') were inserted into a pBLCAT2 CAT expression vector (32 ).

Preparation of RNA and semi-quantitative RT-PCR

Total RNAs were prepared from cultured cells (1-5 × 106 cells) according to the method of Chomczynski and Sacchi (33 ). Semi-quantitative RT-PCR was carried out using the GeneAmp RNA PCR Kit (Takara Shuzo, Tokyo) as previously reported (34 ). Oligonucleotides used in PCR amplification were as follows: PS1, CCAGACAGAGACGTGTACAG; PS2, TGGGACTAATCACCGTGCTG for pS2 (35 ); hER9, GGTACTGGCCAATCTTTCTC; hER10, AACGCGCAGGTC TACGGTCA for ER (8 ); GAP1, ACATCGCTCAGACACCATGG and GAP2, GTAGTTGAGGTCAATGAAGGG for GAPDH (36 ). The primers were designed to sandwich one intron for specific detection of mRNA. Total RNA (1 µg) was reverse transcribed to synthesize cDNA using random hexamers at 42oC and then subjected to PCR amplification with 0.4 µg each of specific primers and 3 µCi of [[alpha]-32P]dCTP (3000 Ci/mmol) in 50 µl mixtures consisting of 10 mM Tris-HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin, and 0.2 mM dNTPs (dATP, dTTP, dGTP, dCTP). PCR comprised 26 cycles for GAPDH and pS2, and 30 cycles for ER, with denaturing at 95oC for 1 min, annealing at 62oC for 1 min, and extension at 72oC for 1 min in each cycle using a GeneAmpTM PCR System 9600 (Perkin Elmer Cetus). The PCR products were then subjected to 5% polyacrylamide gel-electrophoresis, and the radioactivity was evaluated using the Fuji BAS2000 (Fuji Film, Tokyo). A linear relation between radiolabeled PCR products and RNA amounts was ascertained in this study along with the confirmation of reproducibility by a method described in a previous report (8 ,34 ).

Transfection and CAT assay

Transient transfection was performed as described previously (26 ). Briefly, cells were plated on plastic culture dishes to 30-50% confluency, and medium was replaced with RPMI1640 medium. Plasmid cocktail was mixed with Lipofectin reagent (GIBCO Laboratories) and added to the culture. Total amount of the plasmids was kept constant by adding carrier plasmid, pGEM7Z (Promega). After 24 h of incubation, the medium was replaced with fresh RPMI1640 medium supplemented with 5% FCS, and the cells were further cultured in the presence of 100 nM estradiol for 24 h; CAT activity was determined essentially as described previously (37 ) by the standard method using [14C]chloramphenicol as a substrate. The activities were evaluated by autoradiography with a Fuji Bio-Image Analyzer BAS2000 (Fuji film, Tokyo). The transfection efficiency was normalized by luciferase expression using pGL2-control vector (Promega).

Preparation of recombinant GST-fused ER

Subsequent to bacterial expression of the protein using expression plasmid of GST-hER, the recombinant GST-fused ER (rER) was isolated according to the manufacturer's recommendation using glutathione-Sepharose column chromatography. Purified rER was dialyzed against 100 mM Tris-HCl buffer, pH 8.0, containing 0.5 mM EDTA, 2 mM DTT, 0.1 mM PMSF, and 10 µM ZnSO4. The partially purified rER was checked by SDS polyacrylamide gel-electrophoresis and western blotting using anti-ER antibody.

Electrophoretic mobility shift assay (EMSA)

EMSA for rER was carried out as described before (37 ). Briefly, the ERE probe was end-labeled with [[alpha]-32P]dCTP using the Klenow fragment of DNA polymerase I. The sequences of the oligonucleotides encompassing ERE are: 5'-GGTTTGGCAAGGGTCACAATGACCTCAACA-3' (upper strand sequence) and 5'-GGTGTTGAGGTCATTGTGACCCTTGCCAAA-3' (lower strand sequence). Recombinant ER (50 ng protein per reaction) was incubated with 1.2 ng of ERE probe labeled with [32P]dCTP using Klenow fragment in a 10 µl reaction mixture containing 10 mM Tris-HCl pH 7.5, 50 mM NaCl, 0.5 mM EDTA, 1 mM MgCl2, 2 mM DTT, 4% glycerol and 500 ng poly (dI-dC) (Pharmacia LKB) for 30 min on ice. Radioinert competitor DNA, rTRX, or anti-ER antibody was added when indicated. The reaction mixture was then loaded onto a 5% non-denaturing polyacrylamide gel containing 0.5* TBE. The gels were run at 200 V for 2 h and dried. Results were visualized using the Fuji Bio-Image Analyzer BAS2000.


Figure 1. Decrease in pS2 mRNA expression in an ER-positive breast cancer cell line, ZR-75-1 cells, after treatment with H2O2. The cells were cultured in the presence of the indicated concentrations of H2O2 in culture medium for 24 h and quantitative RT-PCR for pS2 and GAPDH was carried out using total RNA prepared from these cells as described in Materials and Methods. The mRNA expression of pS2 gene is shown as relative to that of untreated cells.

RESULTS

Redox regulation of ER-mediated transcription

The human pS2 gene, which has a cis-acting ERE, was initially characterized as a gene whose expression is specifically controlled by estrogen in breast cancer cell lines (38 ,39 ). Thus, pS2 is considered to be one of the representative target genes of ER in mammary cells. We first examined the effect of oxidative stress on mRNA expression of pS2 by adding H2O2 to an ER-positive breast cancer cell line, ZR-75-1. As shown in Figure 1 , the abundant expression of pS2 mRNA in normal culture conditions was dose-dependently reduced by the addition of H2O2. On the other hand, expression of GAPDH mRNA and viability of cells remained unaffected under oxidative stress.


Figure 2. Effect of treatment with H2O2 on ERE-mediated gene expression. The ER-inducible CAT construct (ERE-CAT) or basic plasmid (pBLCAT2) was transiently transfected in ZR-75-1 cells. The reporter gene activity was assayed after exposure of the transfectants to H2O2 for 24 h. The positions of [14C]chloramphenicol (CM) and acetylated chloramphenicol (ACM) are shown. The CAT activity was measured in three independent experiments, and the mean activity (±SE) relative to that of untreated cells (lane 1) is shown.

We further analyzed the effects of altering cellular redox state on transcription activity of the ER. For this purpose, the reporter plasmid ERE-CAT, which possesses a perfect palindromic ERE in front of the tk-promoter and CAT gene, was transfected into ZR-75-1 cells and CAT activity was determined. As shown in Figure 2 , ERE-CAT activity dose-dependently decreased with the additional H2O2: specifically, the addition of 0.1 mM H2O2 inhibited the activity to ~30% of control. On the other hand, CAT activity of pBLCAT2, a parental tk-CAT reporter plasmid without ERE, was not altered within the range of H2O2 concentrations used (data not shown). Another control vector pGL2-control, which has high transcription activity and was used as a control of transcription efficiency, also showed no substantial alteration, indicating that H2O2 within this range did not, on the whole, influence transcription machinery. Taking the low concentrations of H2O2 used into consideration, ER appears to be highly sensitive to oxidative stress, especially when compared with other redox-sensitive transcription factors such as Sp-1, GR, NF-[kappa]B and AP-1 (26 ,29 ). Furthermore, when TRX was overexpressed by co-transfection of the TRX expression plasmid, the suppression of ER-mediated gene expression by treatment with either 0.02 mM H2O2 or 0.05 mM H2O2 was restored as shown in Figure 3 A, lanes 3, 4, and 7. Even in the presence of H2O2, the CAT activity in the cells transfected with 2 µg of the TRX expression plasmid was almost double that of untreated cells (lanes 5 and 9, compare with lane 1). Moreover, when the TRX expression plasmid was added to untreated cells, ERE-CAT activity was enhanced up to ~2.5-fold of that in control (Fig. 3 B), indicating that ER in untreated ZR-75-1 cells is partly oxidized and also that overexpression of TRX regenerated such spared receptor activity.


Figure 3. The effect of overexpression of TRX on ERE-mediated gene expression in ZR-75-1 cells, (A) under oxidative stress by H2O2 or (B) untreated with H2O2. TRX expression plasmid, pcDSR[alpha]ADF, was cotransfected with ERE-CAT in ZR-75-1 cells, and the CAT activity was assessed after exposure of the transfected cells to 0.02 or 0.05 mM H2O2 for 24 h. The CAT activity was measured in three independent experiments, and the mean activity (±SE) relative to that of untreated cells (lane 1) is shown.

In vivo complementation between TRX and antisense TRX on regulation of ER-mediated gene expression

The effect of TRX on ER-mediated transcription was also confirmed by an in vivo complementation assay using the TRX expression plasmid and an antisense TRX expression plasmid. As indicated in Figure 4 , the transfection of antisense TRX plasmid dose-dependently suppressed the ERE-CAT expression (lanes 1-4), while the cotransfection of TRX expression plasmid canceled the negative effects of the antisense TRX and restored ER-mediated transcriptional activation in a dose-dependent manner (lanes 5-8). Thus, it is strongly indicated that cellular TRX levels are one of the determinants in regulation of the transcription activity of ER, and also that TRX acts as an endogenous auxiliary factor for the ER transactivation function.


Figure 4. In vivo complementation between TRX and antisense TRX on regulation of ER-mediated gene expression. The ERE-CAT activity in the ZR-75-1 cells transfected with various amounts of antisense TRX expression plasmid (AS-TRX) is shown in lanes 2-4; TRX expression plasmid was co-transfected into the cells with 2 µg of AS-TRX, in lanes 5-8. The CAT activity was measured in three independent experiments, and the mean activity (±SE) relative to that of untreated cells (lane 1) is shown.

Regulation of DNA binding activity of ER by redox state in vitro

Since most cysteine residues of ER converge in the DNA binding domain, we next asked whether the DNA binding activity of ER is regulated by redox state. For this experiment we used EMSA with purified ER protein. The binding of recombinant ER protein (rER) to the oligonucleotide probe encompassing a perfect palindromic vitellogenin ERE was observed as shown in Figure 5 A, and this binding dramatically decreased with the addition of radioinert ERE oligonucleotide but not with the addition of unspecific competitors, AP-1 and Sp-1 oligonucleotides. The binding complex also decreased with the addition of anti-ER antibody (Fig. 5 B, lane 8). These observations indicate the specific binding of rER to ERE oligonucleotide, and in Figure 5 A and B the broad minor band in the lower position is presumably the complex of proteolysed rER. After incubation of protein samples with a thiol specific oxidizing reagent diamide, DNA binding of rER drastically decreased (Fig. 5 B, lanes 2-4), a decrease which was restored by the presence of a thiol reducing agent, DTT (lane 5). N-ethylmaleimide (NEM), a thiol alkylating reagent, also eliminated the DNA binding of rER (lanes 6 and 7). These results strongly suggest that the redox state of cysteine residues of ER is important for its DNA binding activity to ERE.


Figure 5. Effects of sulfhydryl-modifying agents on DNA binding of ER. Recombinant ER (rER) was expressed and purified as described in Materials and Methods for EMSA. (A) The specific binding of rER to ERE was confirmed by a competition experiment using increasing amounts (*15, *30, *60) of cold ERE-oligonucleotides competitor and unspecific competitors, AP-1 (*60) and Sp-1 (*60) oligonucleotides. (B) rER was incubated with diamide, dithiothreitol (DTT), and N-ethylmaleimide (NEM), before the addition of ERE oligonucleotide probe as indicated. Anti-ER antibody was also added to identify the ER-DNA complex (lane 8). Three separate experiments showed identical results.

TRX rescued the inhibitory effect of diamide on DNA binding of the ER

To examine the direct interaction between ER and TRX proteins in vitro, we performed EMSA using rER and recombinant TRX protein (rTRX). After incubation of ER protein samples with diamide, DNA binding of rER to the ERE oligonucleotide probe sharply dropped with increased concentrations of diamide (Fig. 6 , lanes 2-4). Addition of rTRX to the samples dose-dependently squelched the inhibitory effect of diamide on DNA binding of rER (lanes 6-11); DNA binding was enhanced to a level higher than that in control or in the samples restored by co-presence of 10 mM DTT. Since only two purified proteins, rER and rTRX, were used in this assay system, the results indicate that TRX reduces ER by a direct protein-protein interaction.


Figure 6.. Effects of TRX on DNA binding activity of ER. Recombinant ER was incubated with various concentrations of diamide (lanes 2-4); effects of recombinant TRX were examined in the presence of 1 or 0.75 mM diamide (lanes 6-11) using EMSA. Two separate experiments showed identical results.

DISCUSSION

Understanding the ER-mediated regulation of various genes is indispensable for the biology of breast epithelium cells and also important for breast carcinogenesis. We previously found that the enhanced expression of ER mRNA in human ER-positive breast carcinomas can be ascribed to transcription from a distal upstream promoter of the ER gene, suggesting a tumor-specific transcription mechanism of ER in breast carcinogenesis (8 ). Apart from the transcriptional regulation of the ER, post-transcriptional events such as phosphorylation or redox-dependent modification are also important determinants in the biological function of ER. Here we present evidence that ER-mediated gene expression is coordinately modulated by cellular redox state and TRX levels using breast cancer cells. Moreover, we indicate that the redox regulation of ER is ascribable to thiol-mediated modification of ER by oxidants and TRX.

As we have found in transcriptional regulation of ER in human breast cancer, accumulated evidence suggests that a tumor-specific mechanism is important in post-transcriptional regulation of ER. During tumor promotion and progression of cancer, the cells are stimulated in autocrine or paracrine manners by various growth factors and cytokines, resulting in increased oxidative stress. Oxidative stress induces the expression of TRX (40 -42 ), and enhanced expression of TRX has been observed in various cancers (16 -18 ). Recently, Gallegos et al. reported that a dominant-negative mutant of TRX inhibited tumor cell growth and reversed a transformed phenotype of human breast cancer cells, suggesting that endogenous TRX may play a crucial role in developing breast cancer (19 ). Since ER plays an important role in the proliferation and progression of ER-positive breast cancer cells, our results suggest that ER may be one of the major targets of TRX in breast cancer, and that TRX, at least in part, is involved in cell proliferation and malignant development of breast cancer through redox regulation of ER. Involvement of other proteins such as Ref-1 (43 ) in the redox regulation of ER will also be an important target in future study. Alteration of the redox regulation of ER in human breast carcinomas, compared with that in normal mammary gland, needs to be further investigated, particularly its association with clinical characteristics of breast cancer.

Our results showed that the overexpression of TRX resulted in a significant increase in transcriptional activity of ER, indicating that at least a part of cellular ER is sequestered in a transcriptionally inactive state, probably due to oxidative modification of the thiol residues in the DNA binding domain. All cysteine residues within proteins including transcription factors must not be equally sensitive to redox state in the cells, and ER seems to be one of the most sensitive proteins playing a physiologically important role. We therefore propose that the function of ER is controllable in not only a negative but also a positive direction by cellular redox state or various reducing regents. In the case of estrogen-dependent cancer, treatment with antiestrogen is a standard endocrine therapy. However, while 70-80% of ER-positive cancers respond to endocrine therapy, the rest are resistant. Pharmacological modulation of ER function through redox state may be a useful tool for future treatment of these resistant cases. Moreover, the cellular levels of TRX also appear to influence the sensitivity of several cancer cells to a variety of superoxide-generating anticancer drugs; for example, cisplatin-resistant cancer cells, which often show high levels of TRX, become susceptible to anticancer drugs after antisense-mediated sequestration of TRX (44 ). Thus, TRX can be not only a novel target in anticancer therapy but a useful marker for diagnosis and prognosis, particularly in steroid hormone-dependent cancers.

ACKNOWLEDGEMENTS

We thank Drs Benita S. Katzenellenbogen (University of Illinois, Urbana, IL), Hisaji Oshima (NIH, Bethesda, MD) for providing plasmid, and Dr Masakazu Toi (The Tokyo Metropolitan Institute for Medicinal Sciences) for providing cell line. We thank Drs Kei Nakachi, and Hirota Fujiki (Saitama Cancer Center Research Institute) for valuable comments. This study was supported in part by Grants-in-Aid for Scientific Research from the Ministry of Education, Science and Culture of Japan and for a 2nd-Term Comprehensive 10-Years Strategy for Cancer Control from the Ministry of Health and Welfare of Japan.

REFERENCES

1 Hulka,B.S., Chambless,L.E., Wilkinson,W.E., Deubner,D.C., McCarty,K.S.,Sr and McCarty,K.S.,Jr (1984) Am. J. Epidemiol., 119, 692-704. MEDLINE Abstract

2 Nomura,Y., Miura,S., Koyama,H., Enomoto,K., Kasumi,F., Yamamoto,H., Kimura,M., Tominaga,T., Iino,H., Morimoto,T. and Tashiro,H. (1992) Cancer,69,153-164. MEDLINE Abstract

3 Hoskins,K. and Weber,B.L. (1994) Curr. Opin. Oncol., 6, 554-559. MEDLINE Abstract

4 Benner,S.E., Clark,G.M. and McGuire,W.L. (1988) Am. J. Med. Sci., 296, 59-66. MEDLINE Abstract

5 Green,S., Walter,P., Kumar,V., Krust,A., Bornert,J.-M., Argos,P. and Chambon,P. (1986) Nature, 320, 134-139. MEDLINE Abstract

6 Evans,R.M. (1988) Science, 240, 889-895. MEDLINE Abstract

7 Beato,M. (1989) Cell, 56, 335-344. MEDLINE Abstract

8 Hayashi,S.-I., Imai,K., Suga,K., Kurihara,T., Higashi,Y. and Nakachi,K. (1997) Carcinogenesis, 18, 459-464. MEDLINE Abstract

9 Arnord,S.F., Vorojeikina,D.P. and Notides,A.C. (1995) J. Biol. Chem., 270, 30205-30212.

10 Kato,S., Endoh,H., Masuhiro,Y., Kitamoto,T., Uchiyama,S., Sasaki,H., Masushige,S., Gotoh,Y., Nishida,E., Kawashima,H., Metzger,D. and Chambon,P. (1995) Science, 270, 1491-1494. MEDLINE Abstract

11 Bunone,G., Briand,P.-A., Miksicek,R.J. and Picard,D. (1996) EMBO J., 15, 2174-2183. MEDLINE Abstract

12 Wakasugi,N., Tagaya,Y., Wakasugi,A., Mitsui,M., Maeda,M., Yodoi,J. and Tursz,T. (1990) Proc. Natl. Acad. Sci. USA, 87, 8282-8286. MEDLINE Abstract

13 Yodoi,J. and Tursz,T. (1991) Adv. Cancer Res., 57, 381-411. MEDLINE Abstract

14 Oblong,J.E., Berggren,M., Gasdaska,P.Y. and Powis,G. (1994) J. Biol. Chem., 269, 11714-11720. MEDLINE Abstract

15 Gasdaska,J.R., Berggren,M. and Powis,G. (1995) Cell Growth Differ., 6, 1643-1650. MEDLINE Abstract

16 Berggren,M., Gallegos,A., Gasdaska,J.R., Gasdaska,P.Y., Warneke,J. and Powis,G. (1996) Anticancer Res., 16, 3459-3466. MEDLINE Abstract

17 Fujii,S., Nanbu,Y., Nonogaki,H., Konishi,I., Mori,T., Masutani,H. and Yodoi,J. (1991) Cancer, 68, 1583-1591. MEDLINE Abstract

18 Nakamura,H., Masutani,H., Tagaya,Y., Yamauchi,A., Inamoto,T., Nanbu,Y., Fujii,S., Ozawa,K. and Yodoi,J. (1992) Cancer, 69, 2029-2079.

19 Gallegos,A., Gasdaska,J.R., Taylor,C.W., Paine-Murrieta,G.D., Goodman,D., Gasdaska, P.Y., Berggren,M., Briehl,M.M. and Powis,G. (1996) Cancer Res., 56, 5765-5770. MEDLINE Abstract

20 Tagaya,Y., Maeda,Y., Mitsui,A., Kondo,N., Matsui,H., Hamuro,J., Brown,N., Arai,K.-I., Yokota,T., Wakasugi,H. and Yodoi,J. (1989) EMBO J., 8, 757-764. MEDLINE Abstract

21 Holmgren,A. (1985) Annu. Rev. Biochem.,54, 237-271. MEDLINE Abstract

22 Holmgren,A. (1995) Structure, 3, 239-243. MEDLINE Abstract

23 Schenk,H., Klein,M., Erdbrugger,W., Droge,W. and Schulze-Osthoff,K. (1995) Proc. Natl. Acad. Sci. USA, 91, 1672-1676.

24 Meyer,M., Schreck,R. and Baeuerle,P.A. (1993) EMBO J., 12, 2005-2015. MEDLINE Abstract

25 Grippo,J.F., Holmgren,A. and Pratt,W.B. (1985) J. Biol. Chem., 260, 93-97. MEDLINE Abstract

26 Makino,Y., Okamoto,K., Aoshima,M., Hirota,K., Yodoi,J., Umesono,K., Makino, I. and Tanaka,H. (1996) J. Clin. Invest., 98, 2469-2477. MEDLINE Abstract

27 Hayashi,T., Ueno,Y. and Okamoto,T. (1993) J. Biol. Chem., 268, 11380-11388. MEDLINE Abstract

28 Abate,C., Patel,L., Rauscher,F.J.-III and Curran,T. (1990) Science, 249, 1157-1161. MEDLINE Abstract

29 Wu,X., Bishopric,N.H., Discher,D.J., Murphy,B.J. and Webster,K.A. (1996) Mol. Cell. Biol., 16, 1035-1046. MEDLINE Abstract

30 Tagaya,Y., Wakasugi,H., Masutani,H., Nakamura,H., Iwata,S., Mitsui,A., Fujii,S., Wakasugi,N., Tursz,T. and Yodoi,J. (1990) Mol. Immunol., 27, 1279-1289. MEDLINE Abstract

31 Reese,J.C. and Katzenellenbogen,B.S. (1991) Nucleic Acids Res., 19, 6595-6602. MEDLINE Abstract

32 Oshima,H. and Simons,S.S.,Jr (1993) J. Biol. Chem., 268, 26858-26865. MEDLINE Abstract

33 Chomczynski,P. and Sacchi,N. (1987) Anal. Biochem., 162, 156-159. MEDLINE Abstract

34 Hayashi,S.-I., Watanabe,J., Nakachi,K., Eguchi,H., Gotoh,O. and Kawajiri,K. (1994) Carcinogenesis, 15, 801-806. MEDLINE Abstract

35 Jakowlew,S.B., Breathnach,R., Jeltsch,J.M., Masiakowski,P. and Chambon,P. (1984) Nucleic Acids Res., 12, 2861-2878. MEDLINE Abstract

36 Ercolani,L., Florence,B., Denaro,M. and Alexander,M. (1988) J. Biol. Chem. 263, 15335-15341. MEDLINE Abstract

37 Hayashi,S.-I., Watanabe,J. and Kawajiri,K. (1991) J. Biochem. 110, 559-565. MEDLINE Abstract

38 Masiakowski,P., Breathnach,R., Bloch,J., Gannon,F., Krust,A. and Chambon,P. (1982) Nucleic Acids Res.,10, 7895-7903. MEDLINE Abstract

39 Brown,A.M.C., Jeltsch,J.M., Roberts,M. and Chambon,P. (1984) Proc. Natl. Acad. Sci. USA, 81, 6344-6348.

40 Spector,A., Yan,G., Huang,R.C., McDermott,M.J., Gascoyne,P.R.C., Pigiet,V. (1988) J. Biol. Chem., 263, 4984-4990. MEDLINE Abstract

41 Nakamura,H., Matsuda,M., Furuke,K., Kitaoka,Y., Iwata,S., Toda,K., Inamoto,T., Yamaoka,Y., Ozawa,K. and Yodoi,J. (1992) Immunol. Lett. 42, 75-80.

42 Taniguchi,Y., Taniguchi-Ueda,Y., Mori,K. and Yodoi,J. (1996) Nucleic Acids Res., 24, 2746-2752. MEDLINE Abstract

43 Xanthoudakis,S., Miao,G., Wang,F., Pan,Y.-C.E. and Curran,T. (1992) EMBO J. 11, 3323-3335. MEDLINE Abstract

44 Yokomizo,A., Ono,M., Nanri,H., Makino,Y., Ohga,T., Wada,M., Okamoto,T., Yodoi,J., Kuwano,M. and Kohno,K. (1995) Cancer Res., 55, 4293-4296. MEDLINE Abstract


*To whom correspondence should be addressed. Tel: +81 48 722 1111; Fax: +81 48 722 1739; Email: shayashi@saitama-cc.go.jp


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Mol. Endocrinol.Home page
A. K. Rao, Y. S. Ziegler, I. X. McLeod, J. R. Yates, and A. M. Nardulli
Effects of Cu/Zn Superoxide Dismutase on Estrogen Responsiveness and Oxidative Stress in Human Breast Cancer Cells
Mol. Endocrinol., May 1, 2008; 22(5): 1113 - 1124.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
S. DeMorrow, H. Francis, E. Gaudio, Y. Ueno, J. Venter, P. Onori, A. Franchitto, B. Vaculin, S. Vaculin, and G. Alpini
Anandamide inhibits cholangiocyte hyperplastic proliferation via activation of thioredoxin 1/redox factor 1 and AP-1 activation
Am J Physiol Gastrointest Liver Physiol, February 1, 2008; 294(2): G506 - G519.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Zhou, A. E. Damdimopoulos, G. Spyrou, and B. Brune
Thioredoxin 1 and Thioredoxin 2 Have Opposed Regulatory Functions on Hypoxia-inducible Factor-1{alpha}
J. Biol. Chem., March 9, 2007; 282(10): 7482 - 7490.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C. Berndt, C. H. Lillig, and A. Holmgren
Thiol-based mechanisms of the thioredoxin and glutaredoxin systems: implications for diseases in the cardiovascular system
Am J Physiol Heart Circ Physiol, March 1, 2007; 292(3): H1227 - H1236.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. R. Schultz-Norton, W. H. McDonald, J. R. Yates, and A. M. Nardulli
Protein Disulfide Isomerase Serves as a Molecular Chaperone to Maintain Estrogen Receptor {alpha} Structure and Function
Mol. Endocrinol., September 1, 2006; 20(9): 1982 - 1995.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Urata, Y. Ihara, H. Murata, S. Goto, T. Koji, J. Yodoi, S. Inoue, and T. Kondo
17beta-Estradiol Protects against Oxidative Stress-induced Cell Death through the Glutathione/Glutaredoxin-dependent Redox Regulation of Akt in Myocardiac H9c2 Cells
J. Biol. Chem., May 12, 2006; 281(19): 13092 - 13102.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
G.-H. Liu, J. Qu, and X. Shen
Thioredoxin-mediated Negative Autoregulation of Peroxisome Proliferator-activated Receptor {alpha} Transcriptional Activity
Mol. Biol. Cell, April 1, 2006; 17(4): 1822 - 1833.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
J. Kohrle, F. Jakob, B. Contempre, and J. E. Dumont
Selenium, the Thyroid, and the Endocrine System
Endocr. Rev., December 1, 2005; 26(7): 944 - 984.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. J. Garban, D. C. Marquez-Garban, R. J. Pietras, and L. J. Ignarro
Rapid nitric oxide-mediated S-nitrosylation of estrogen receptor: Regulation of estrogen-dependent gene transcription
PNAS, February 15, 2005; 102(7): 2632 - 2636.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. E. Damdimopoulos, A. Miranda-Vizuete, E. Treuter, J.-A. Gustafsson, and G. Spyrou
An Alternative Splicing Variant of the Selenoprotein Thioredoxin Reductase Is a Modulator of Estrogen Signaling
J. Biol. Chem., September 10, 2004; 279(37): 38721 - 38729.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
W. H. Watson, X. Yang, Y. E. Choi, D. P. Jones, and J. P. Kehrer
Thioredoxin and Its Role in Toxicology
Toxicol. Sci., March 1, 2004; 78(1): 3 - 14.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
H. Yamawaki, J. Haendeler, and B. C. Berk
Thioredoxin: A Key Regulator of Cardiovascular Homeostasis
Circ. Res., November 28, 2003; 93(11): 1029 - 1033.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
B. Husbeck and G. Powis
The redox protein thioredoxin-1 regulates the constitutive and inducible expression of the estrogen metabolizing cytochromes P450 1B1 and 1A1 in MCF-7 human breast cancer cells
Carcinogenesis, October 1, 2002; 23(10): 1625 - 1630.
[Abstract] [Full Text] [PDF]


Home page
Ann. N. Y. Acad. Sci.Home page
K. HIROTA, H. NAKAMURA, H. MASUTANI, and J. YODOI
Thioredoxin Superfamily and Thioredoxin-Inducing Agents
Ann. N.Y. Acad. Sci., May 1, 2002; 957(1): 189 - 199.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K.-D. Kroncke, L.-O. Klotz, C. V. Suschek, and H. Sies
Comparing Nitrosative Versus Oxidative Stress toward Zinc Finger-dependent Transcription. UNIQUE ROLE FOR NO
J. Biol. Chem., April 5, 2002; 277(15): 13294 - 13301.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
A. Lopata, M.C. Sibson, A.C. Enders, K.L. Bloomfield, M.S. Gregory, G.D. Trapani, A.V. Perkins, K.F. Tonissen, and F.M. Clarke
Expression and localization of thioredoxin during early implantation in the marmoset monkey
Mol. Hum. Reprod., December 1, 2001; 7(12): 1159 - 1165.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Y. Matsutani, A. Yamauchi, R. Takahashi, M. Ueno, K. Yoshikawa, K. Honda, H. Nakamura, H. Kato, H. Kodama, T. Inamoto, et al.
Inverse Correlation of Thioredoxin Expression with Estrogen Receptor- and p53-dependent Tumor Growth in Breast Cancer Tissues
Clin. Cancer Res., November 1, 2001; 7(11): 3430 - 3436.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
I. Hata, Y. Shigematsu, Y. Ohshima, H. Tsukahara, K. Fujisawa, M. Hiraoka, H. Nakamura, H. Masutani, J. Yodoi, F. Kotsuji, et al.
Involvement of thioredoxin in the regulation of growth hormone secretion in rat pituitary cell cultures
Am J Physiol Endocrinol Metab, August 1, 2001; 281(2): E269 - E274.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
K. Demary, L. Wong, J. S. Liou, D. V. Faller, and R. A. Spanjaard
Redox Control of Retinoic Acid Receptor Activity: A Novel Mechanism for Retinoic Acid Resistance in Melanoma Cells
Endocrinology, June 1, 2001; 142(6): 2600 - 2605.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Lando, I. Pongratz, L. Poellinger, and M. L. Whitelaw
A Redox Mechanism Controls Differential DNA Binding Activities of Hypoxia-inducible Factor (HIF) 1alpha and the HIF-like Factor
J. Biol. Chem., February 18, 2000; 275(7): 4618 - 4627.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
N. Denko, C. Schindler, A. Koong, K. Laderoute, C. Green, and A. Giaccia
Epigenetic Regulation of Gene Expression in Cervical Cancer Cells by the Tumor Microenvironment
Clin. Cancer Res., February 1, 2000; 6(2): 480 - 487.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
S. Witte, M. Villalba, K. Bi, Y. Liu, N. Isakov, and A. Altman
Inhibition of the c-Jun N-terminal Kinase/AP-1 and NF-kappa B Pathways by PICOT, a Novel Protein Kinase C-interacting Protein with a Thioredoxin Homology Domain
J. Biol. Chem., January 21, 2000; 275(3): 1902 - 1909.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Ueno, H. Masutani, R. J. Arai, A. Yamauchi, K. Hirota, T. Sakai, T. Inamoto, Y. Yamaoka, J. Yodoi, and T. Nikaido
Thioredoxin-dependent Redox Regulation of p53-mediated p21 Activation
J. Biol. Chem., December 10, 1999; 274(50): 35809 - 35815.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Hirota, M. Murata, Y. Sachi, H. Nakamura, J. Takeuchi, K. Mori, and J. Yodoi
Distinct Roles of Thioredoxin in the Cytoplasm and in the Nucleus. A TWO-STEP MECHANISM OF REDOX REGULATION OF TRANSCRIPTION FACTOR NF-kappa B
J. Biol. Chem., September 24, 1999; 274(39): 27891 - 27897.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Nishiyama, M. Matsui, S. Iwata, K. Hirota, H. Masutani, H. Nakamura, Y. Takagi, H. Sono, Y. Gon, and J. Yodoi
Identification of Thioredoxin-binding Protein-2/Vitamin D3 Up-regulated Protein 1 as a Negative Regulator of Thioredoxin Function and Expression
J. Biol. Chem., July 30, 1999; 274(31): 21645 - 21650.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Okamoto, H. Tanaka, H. Ogawa, Y. Makino, H. Eguchi, S.-i. Hayashi, N. Yoshikawa, L. Poellinger, K. Umesono, and I. Makino
Redox-dependent Regulation of Nuclear Import of the Glucocorticoid Receptor
J. Biol. Chem., April 9, 1999; 274(15): 10363 - 10371.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Makino, N. Yoshikawa, K. Okamoto, K. Hirota, J. Yodoi, I. Makino, and H. Tanaka
Direct Association with Thioredoxin Allows Redox Regulation of Glucocorticoid Receptor Function
J. Biol. Chem., January 29, 1999; 274(5): 3182 - 3188.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. Maruyama, Y. Sachi, K. Furuke, Y. Kitaoka, H. Kanzaki, Y. Yoshimura, and J. Yodoi
Induction of Thioredoxin, a Redox-Active Protein, by Ovarian Steroid Hormones during Growth and Differentiation of Endometrial Stromal Cells in Vitro
Endocrinology, January 1, 1999; 140(1): 365 - 372.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
M. Gangloff, M. Ruff, S. Eiler, S. Duclaud, J. M. Wurtz, and D. Moras
Crystal Structure of a Mutant hERalpha Ligand-binding Domain Reveals Key Structural Features for the Mechanism of Partial Agonism
J. Biol. Chem., April 27, 2001; 276(18): 15059 - 15065.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Matsuo, N. Akiyama, H. Nakamura, J. Yodoi, M. Noda, and S. Kizaka-Kondoh
Identification of a Novel Thioredoxin-related Transmembrane Protein
J. Biol. Chem., March 23, 2001; 276(13): 10032 - 10038.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (549K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager