ABSTRACT
A telomerase-like primer extension activity has been detected in chromatographic fractions derived from Schizosaccharomyces pombe extracts. This primer extension activity acts preferentially on dG-rich oligodeoxynucleotides, is sensitive to RNase A pretreatment and requires all four deoxynucleotides for optimal polymerization. The extension products are also truncated by the inclusion of any one of the four dideoxynucleotides, consistent with the presence of all four bases in the S.pombe telomeric repeats. The intensity distribution of the extension products and the dideoxynucleotide termination pattern suggest that nucleotide addition is template directed, and that telomere-like sequences are added to the primers. In particular, the sequence d(CGGTTA), a variant of the S.pombe telomeric repeat, can be added directly by the in vitro activity. Partially purified S.pombe telomerase sediments as a 35S particle, suggesting that it exists in vivo as part of a large multi-protein complex.
Telomeres are specialized nucleoprotein structures found at the ends of linear eukaryotic chromosomes. Telomeres confer stability to chromosomes by preventing nucleolytic degradation and recombination. They also function in chromosomal localization, nuclear architecture, and repression of nearby genes (1 ,2 ). The telomeric DNA of most organisms consists of simple tandem repeats that are rich in dG and dT residues on the 3' end-containing strand (3 ). This strand can be synthesized de novo by a ribonucleoprotein complex called telomerase (4 ,5 ), an enzyme that is critical to the maintenance of telomere length (6 ,7 ), and hence, function.
Telomerase activity was initially identified in Tetrahymena thermophila, a ciliated protozoa whose life cycle involves the formation of a large number of telomeres. The in vitro assay was based on telomerase's ability to extend telomere-like oligodeoxynucleotides in the presence of dGTP and dTTP (4 ). The enzyme was subsequently characterized as an unusual reverse transcriptase containing an integral RNA component, a small segment of which acts as the template for the synthesis of the dGT-rich strand of telomeric repeats (5 ). Multiple repeats can be added to the input primer following initial binding, despite the minimal number of repeat units in the RNA template, suggesting that the enzyme can undergo a translocation step during processive DNA synthesis, or that the enzyme can undergo multiple cycles of dissociation and reassociation with the primer. Telomerase can also cleave the input primer under certain conditions (8 ), a property that is shared by a number of DNA and RNA polymerases. Telomerase activity has been detected in a wide range of organisms including protozoa (9 ), yeast (10 -13 ), mouse (14 ), Xenopus (15 ) and human (16 ). The genes encoding the RNA component of the enzyme complex have also been cloned for most of the known telomerases, such as that of yeast and human (7 ,17 ). Most recently, some of the polypeptide components of telomerase were cloned. In particular, a protein named p123 in Euplotes aediculatus and a homologous protein encoded by EST2 in yeast were shown to be the catalytic components of the respective telomerases (18 ,19 ); these two polypeptides exhibit significant homology to other reverse transcriptases and mutations that alter Est2p residues that are conserved among reverse transcriptases abolish telomerase activity in vitro and telomerase function in vivo. In addition, two polypeptides, p80 and p95, that copurify with Tetrahymena telomerase have been cloned and been shown to interact with telomerase RNA and the DNA primer, respectively (20 ). Mouse and human homologues of p80 have also been identified, and been shown to associate with the respective telomerases (21 ,22 ). These recent developments should greatly facilitate structure-function analysis of telomerase.
Telomerase activity is easily detected in male and female reproductive tissues, and long telomeres are stably maintained in germ-line cells. In contrast, in most postnatal somatic cells, telomeric DNA is progressively lost with replicative aging and telomerase activity is undetectable in the majority of cases (23 ). This correlation suggests that telomerase is the major factor for counterbalancing the DNA loss anticipated from the `end replication' problem and that telomere shortening is one underlying mechanism for replicative aging. Such conjectures find strong support in yeast, where deletion of the telomerase RNA and a catalytic protein component leads to both telomere shortening, and eventually, a senescent phenotype (7 ,19 ). Furthermore, in tumor cells and postcrisis immortalized cell lines, telomere lengths are again stably maintained, and telomerase activity again becomes detectable in the majority of cases (24 ,25 ). However, telomerase-negative immortalized cells have also been observed, suggesting an alternative mechanism of telomere maintenance (26 ). Little is known about how telomerase activity is regulated.
As mentioned before, telomerase activity has been identified in both the RNA and a protein component cloned from the genetically tractable budding yeast Saccharomyces cerevisiae. However, for a number of reasons, the fission yeast Schizosaccharomyces pombe may be uniquely advantageous as a model system for the study of telomerase structure and function. First, while both yeasts are distantly related to higher eukaryotes, the genome organization and functional chromosomal elements of the fission yeast appear to share more characteristics with those of higher cells. Second, the cytological organization of the S.pombe nucleus is much better understood and much more easily investigated. Indeed, cytological studies in S.pombe have lead to the interesting conclusion that telomeres play a role in chromosomal movements during karyotomy and meiosis (26 ). Thus, cell biological questions regarding the spatial and temporal localization of telomerase components and their relationship to other nuclear structures may best be answered in the fission yeast. Finally, unlike telomeric sequences from most organisms, the S.pombe telomeric repeats are extremely irregular and conform to the following loose consensus: C A0-2 C0-1 G1-8 T1-3 A (27 ,28 ). The basis for this irregularity may constitute an important aspect of the mechanisms of nucleotide addition by telomerase. Study of S.pombe telomeres and telomerase has lagged far behind that of S.cerevisiae. However, a number of S.pombe telomeres have been cloned and sequenced, and proteins that specifically recognize S.pombe telomeric repeats have been identified and partially purified (29 ). Very recently, a telomere-binding protein in S.pombe (Taz1p) was cloned and shown to regulate telomere length and adjacent gene expression, and to be required for meiosis (30 ). In this paper we describe the identification and initial characterization of a primer extension activity that fulfills all of the available criteria for being the S.pombe telomerase.
The haploid S.pombe wild-type strain 972h- was used throughout. They were either grown in 3% glucose, 0.5% Yeast Extract or 3% glycerol, 1% glucose, 1% Bacto-Peptone, 2% Yeast Extract. Comparable results were obtained with either medium. The following protease inhibitors were included in all buffers: 1 mM phenylmethylsulfonyl fluoride, 2 mM benzamidine, 2 µg/ml pepstatin A and 1 µg/ml leupeptin. Buffer A contains 20 mM HEPES-NaOH, pH 7.6, 1 mM magnesium acetate, 20% glycerol, 1 mM DTT. Buffer A(500) etc. denotes buffer A plus the concentration of potassium acetate in mM specified by the number in parentheses.
About 60 l of S.pombe cultures were grown to mid-log phase (~3 × 107 cells/ml), harvested, and washed once with ice-cold water. Cell pellets were resuspended with an equal volume of 3* Buffer A(0) (~200 ml of total suspension), adjusted with 5 M potassium acetate to a conductivity of ~50 mSi, mixed with ~150 ml of acid washed glass beads, transferred to a Biospec Bead-Beater chamber, and lysed with 15 20 s pulses. The Bead-Beater was turned off for 90 s following each pulse to allow for cooling of the lysate, which was achieved by surrounding the chamber with an ice/salt/glycerol bath that was kept at -10oC. Best results were obtained with the large Bead-Beater chamber. Cell lysates were collected and cleared by two successive centrifugations: first in a GSA rotor (Sorvall) at 8000 r.p.m. for 10 min, and then in a T-865 rotor (Sorvall) at 50 000 r.p.m. for 1 h. A typical extract has a protein concentration of ~15 mg/ml. While more prolonged bead-beating results in extracts of higher protein concentration, more inhibitors and/or contaminating activities are also released, making it difficult to detect telomerase activity.
Telomerase activity was partially purified by passage through a DEAE Sepharose (Fast-Flow, Pharmacia) and a Q-Sepharose (Fast-Flow, Pharmacia) column. Extracts were diluted with Buffer A(0) to a conductivity of ~40 mSi and loaded onto a DEAE-Sepharose column. The column was washed with 2 column vol of Buffer A(400) and the activity eluted with 5 column vol of a linear gradient from Buffer A(400) to A(1500). Peak fractions (eluting around 800 mM potassium acetate) were pooled, diluted with Buffer A(0) to a conductivity of ~50 mSi, and loaded onto a Q-Sepharose column. The column was washed with 2 column vol of Buffer A(500) and the activity eluted with 10 column vol of a gradient from Buffer A(500) to A(1500). Peak fractions (eluting around 1100 mM potassium acetate) together contained ~0.2% of the protein in the initial extract.
Fractions from either the DEAE-Sepharose or Q-Sepharose column were adjusted to 10% glycerol by dilution and then concentrated several fold by passage through centricon-30 (Amicon). The resulting material was spun through a 10 ml glycerol gradient (20-50% glycerol, containing 20 mM HEPES-NaOH, pH 7.6, 1 mM magnesium acetate, 20% glycerol, 1 mM DTT and 300 mM potassium acetate) in an SW41 rotor at 30 000 r.p.m. for 20 h. Individual fractions were collected and assayed for telomerase activity. The positions of ribosomal particles and Blue Dextran2000 in a parallel gradient were used as molecular weight standards. Ribosome-containing extracts were prepared and ribosomal particles monitored according to published protocol (31 ).
A typical telomerase reaction was carried out in 25 µl containing the following: 50 mM HEPES-NaOH, pH 7.6, 4 mM magnesium glutamate, 30 mM potassium glutamate, 0.1 mM EDTA, 1 mM DTT, 5% glycerol (v/v), 50 µM dATP, 50 µM dCTP, 50 µM dTTP, 20 µCi of [[alpha]-32P]dGTP (3000 Ci/mmol), 5 µM of primer oligodeoxynucleotides, and ~5 µl of column fractions. Sometimes, a different radioactive nucleotide was used as label. In such cases, the concentrations of the labeled and unlabeled nucleotides are unchanged. For the RNase A inactivation experiments, 5 µl of telomerase was preincubated with 20 ng of RNase A at room temperature for 20 min before starting the reaction. As a further control, the fraction was sometimes treated simultaneously with 20 ng of RNase A and 2 U of an RNase inhibitor (Prime Inhibitor, 5 prime to 3 prime, Boulder, CO) before starting the assay. For the chain termination experiments, one of the cold deoxynucleotides is replaced by 50 µM of its dideoxynucleotide analogue. Following incubation at 30oC for 1.5 h, the reaction was stopped with 80 µl of 10 mM Tris-HCl, pH 8.0, 20 mM EDTA, 0.1 mg/ml RNase A, and incubated at room temperature for 10 min, and further digested with 100 µl of a solution containing 10 mM Tris-HCl, pH 8.0, 0.5% SDS and 0.3 mg/ml proteinase K. The digested reaction products were mixed with 750 µl of absolute ethanol and 100 µl of 7.5 M ammonium acetate containing 1 µg of yeast tRNA to precipitate the nucleic acids. The pellets were washed twice with 70% ethanol, resuspended in gel electrophoresis buffer containing tracking dyes, and analyzed on a 12 or 15% TBE-urea polyacrylamide gel. Dried gels were analyzed using a PhosphorImager system (Molecular Dynamics).
Telomerases from many sources have been found to preferentially extend dGT-rich oligonucleotides, although the sequence requirements are not stringent. In particular, telomerase from one organism can often be found to efficiently elongate telomeric repeats from another organism. Furthermore, even non-telomeric primers can occasionally support reactions in vitro. In the case of the S.pombe activity, we have found that in addition to S.pombe primers (e.g. PTEL3, PTEL4, PTEL7, PTEL14 and PTEL15; Table 1 and Figs 2 C and 5 ), some S.cerevisiae primers (TEL4 and TEL6; Table 1 and Fig. 2 A) or a slight variant of S.cerevisiae primers (TEL13), which do not contain either dA or dC residues, can be efficiently extended. The presence of non-telomeric sequence at the 5' end of the primer has little effect on priming efficiency (comparing TEL4 with TEL10; Table 1 and Fig. 2 A). In contrast, including either a 6 or a 12 nt non-telomeric sequence at the 3' end of the primer abolishes the RNase-sensitive short extension products (comparing TEL4 with TEL8 and TEL9; Table 1 and Fig. 2 B).
Table 1
Close inspection of the distribution of the short products suggests that a specific sequence or sequences are added to the input primer. For example, there are clearly preferred pausing or termination sites, consistent with preferential dissociation of the enzyme at particular templating positions, which has been observed for many telomerases. A purely random addition of nucleotides would not be expected to generate such patterns. Furthermore, primers that have identical 3' ends yield very similar patterns of extension products. Reactions with TEL4, TEL6 and TEL10, which share 12 identical nucleotides at their 3' end, all result in a very strong band at the `primer +2' position, and a somewhat weaker band at the `primer + 6' position (Table 1 and Fig. 2 A; in Fig. 2 A, the large and small arrows to the right of the `TEL4', `TEL6' and `TEL10' reactions point to the `primer + 2' and `primer + 6' products, respectively). This pausing or termination property appears to be a conserved characteristic of all telomerases. In addition, the use of primers with different 3' ends results in different patterns of product distribution, consistent with the ability of telomerase to recognize the 3' end of primer through base-pairing. For example, The `TEL13' reaction yields a strong product at the `primer + 3' position, and the `PTEL7' reaction yields significant amount of products at the `primer + 1', `primer + 2' and `primer + 5' positions (Fig. 2 A and C).
We have described an RNA-dependent primer extension activity from S.pombe that fulfills all of the available criteria for being the S.pombe telomerase. All catalytic properties of this enzyme as reported here, including its primer preference, primer recognition and patterns of extension, have precedents in previously described telomerases.
If one assumes that all telomerases have fundamentally identical catalytic mechanisms and have similar catalytic components, then the large size of non-ciliate telomerases probably represent their association with other regulatory factors. The RNA component of non-ciliate telomerase, such as human (450 nt) and S.cerevisiae (1300 nt), albeit larger than that of ciliates, appears insufficient to account for the size difference. Because of the very different life cycles of ciliated protozoa, involving chromosomal fragmentation and the de novo formation of a large number of telomeres, factors that regulate telomerase activity in these organisms may be very different from those of others. Thus non-ciliate telomerase may contain a different set of regulatory factors than ciliate telomerase, leading to the observed size difference.
A particularly interesting trait of S.pombe telomeric repeat is its irregularity. As mentioned previously, only a very loose consensus sequence (C A0-2 C0-1 G1-8 T1-3 A) can be discerned. Although some sequence heterogeneity could arise as a result of recombination, this degree of irregularity may be due in part to the action of telomerase. However, in vitro, our S.pombe telomerase activity appears to synthesize preferentially one variant of this repeat, namely d(C-G-G-T-T-A). For example, a primer that ends in d(C-G-G) supports almost exclusively the addition of d(T-T-A) only. Despite the variability in the length of the dG tract in vivo, there is little evidence for the incorporation of more dG residues prior to that of d(T-T-A) in vitro. Similarly, there is little evidence for the incorporation of dA immediately following that of dC, despite the prevalence of such a dinucleotide unit in the S.pombe telomeres. These discrepancies suggest a number of intriguing possibility. First, there may be multiple telomerase activities in vivo, only one of which is detected by our current protocol. Second, the telomerase RNA may contain variants of the complements of d(C-G-G-T-T-A) repeats, but these variants are not utilized efficiently in vitro or not revealed by the primers employed thus far. Third, S.pombe telomerase in vivo may have a tendency to misalign with the template, giving rise to an irregular pattern.
Fourth, perhaps most interestingly, telomerase activity in vivo may be regulated or modified such that it becomes `sloppy'. One can imagine, for example, the sequence G1-8 being made as the enzyme repeatedly `slips' and uses the same `C' nucleotide in the template for base pairing and addition of dG residues. In this fashion, the S.pombe telomerase does not need to carry an RNA that contains all the possible combinations of complementary sequence in order to generate a characteristic S.pombe telomere. While such slippage reaction has been postulated to be responsible for runs of dinucleotides in some telomeres (11 ), repetitive addition of a single nucleotide has not been documented for any native telomerase. However, a Tetrahymena telomerase that carries a mutated RNA template has been found to incorporate stretches of dG residues that are longer than encoded by the template (34 ). More interesting still, the HIV reverse transcriptase has been found, under certain conditions, to use repeatedly the same templating base to make a significant stretch of homopolymer (35 ). Thus enzyme slippage may be a feature not only of telomerases, but of some reverse transcriptases as well. That a single telomerase RNA can support the synthesis of multiple variants of a repeat is apparently true for paramecium, as reported recently (36 ).
The possibility of enzyme slippage makes it impossible to ascertain the telomerase RNA template sequence from sequences of the reaction products. While it is tempting to speculate that the sequence r(T-A-A-C-C-G) is part of the S.pombe telomerase RNA, based on our investigation of nucleotide addition by the in vitro activity and the sequence of cloned S.pombe telomeres, such an interpretation cannot be confirmed without cloning the gene encoding S.pombe telomerase RNA. Identification of this RNA, coupled with detailed in vitro analysis of the activity, should lead to further insights on telomerase mechanisms.
We thank Dr Henry Levin for antibodies against Tf proteins, and Ken Berns for helpful comments on the manuscript.
Oligo
Sequence
TEL4
TGTGGTGTGTGGGTGTG
TEL6
TGTGTGGGTGTG
TEL8
GTGTGTGGGTGTGGATCAT
TEL9
GTGTGTGGGTGTGCTACGCGATCAT
TEL10
CGGGATCCCGTGTGGTGTGTGGGTGTG
TEL13
TGTCTGGGTGTCTGGGT
PTEL3
GGTTACAGGTTACAGGTT
PTEL4
GGGTTACAGGTTACAGGT
PTEL7
TTACAGGGTTACAGGTTAC
PTEL13
TTACAGGGTTACAGGTTA
PTEL14
ACAGGGTTACAGGTTACG
PTEL15
CAGGGTTACAGGTTACGG
REFERENCES