ABSTRACT
The Y-box proteins are a family of highly conserved nucleic acid binding proteins which are conserved from bacteria to human. In this report we have identified a new member of this family from Drosophila melanogaster. Degenerate-PCR was used to identify a conserved region within the highly conserved cold-shock domain (CSD) of Y-box proteins. Subsequently, the cDNA for this gene was sequenced, and the identified open reading frame was named ypsilon schachtel (yps). The expression pattern of yps indicates that this gene is expressed throughout development with the highest level of expression found in adult flies. In situ hybridization shows that the yps mRNA is maternally loaded into the egg cytoplasm. In addition, there appears to be expression of yps mRNA in mesodermal tissue during embryogenesis. YPS, while containing a conserved CSD, is novel in that it completely lacks the alternating acidic and basic regions found in the C-terminus of the other vertebrate eukaryotic Y-box proteins. The CSD of yps was purified and gel-shift analysis showed that this domain can interact with RNA. We predict that YPS would be an RNA-binding protein due to these results and the motifs which have been identified within the amino acid sequence.
The Y-box proteins are a family of highly conserved nucleic acid binding proteins which were defined as a group based on their ability to bind to the DNA sequence (CTGATTGGCCAA) known as the Y-box element (see 1 and 2 for review). The Y-box element which contains a reverse CAAT motif, is present in a variety of promoters, including the major histocompatability class II genes (3 ), the multidrug resistance gene in humans (4 ) and oocyte specific genes in Xenopus (5 ). The first cloned Y-box protein, YB-1, was isolated from a human B-cell expression library (3 ). Subsequently, Y-box proteins have been identified in Xenopus (6 ,7 ), mouse (8 ), chicken (9 ), rat (10 ,11 ), rabbit (12 ), cow (13 ), sea mollusks (14 ) and most recently in Caenorhabditis elegans (15 ). These eukaryotic proteins share a region of high homology with the bacterial cold-shock proteins, consisting of ~70 amino acid residues, and therefore, this region has been termed the cold-shock domain (CSD). The CSD of the human YB-1 protein shares 44% homology with the major cold shock protein from Escherichia coli, CspA. Among the eukaryotic Y-box proteins, amino acid homology within this domain is >90%.
CspA is a small protein consisting of 70 amino acids. It is induced upon temperature downshift from 37 to 10 or 15°C (16 ). Although a large family of CspA-related proteins in E.coli has been identified (17 ,18 ) only CspA, CspB and CspG have been shown to be cold-shock inducible. The three-dimensional structures of both CspA from E.coli and the homologous protein CspB from Bacillus subtilis have been determined by both NMR spectroscopy and X-ray crystallography (19 -22 ). The structure consists of five [beta]-strands arranged in an antiparallel order to form a [beta]-barrel structure. Within the CSD are two well recognized RNA binding motifs, RNP-1 and RNP-2 (23 ).
The eukaryotic Y-box proteins all contain a CSD located at the N-terminal region (1 ). This domain is a recognized RNA-binding domain, and was recently found to be required for sequence-specific recognition of RNA in the case of the frog Y-box proteins (24 ). Although the C-terminal tail following the CSD shows less homology among these proteins, characteristic alternating regions of positive and negative charge (about every 30 amino acids) have been recognized in spite of the fact that the overall sequence similarity is not very high (7 ). The basic regions are also rich in aromatic amino acid residues and have thus been termed basic/aromatic islands within the C-terminal domain. This domain of the protein has also been shown to interact with RNA (25 ,26 ).
Most Y-box proteins were found by screening cDNA expression libraries for proteins which would bind to probes containing a CCAAT sequence element. However, in addition to the Y-box element, other probes have been used to identify proteins in the Y-box family. These include the W-box element and apurinic DNA (27 ,28 ), the B-box element (29 ) and triplex forming or H-DNA (30 ). This suggests that specific interactions between nucleic acids and the individual Y-box proteins are determined not only by the CSD but also by other domains of the protein. It appears that the nature of this interaction is quite different for individual proteins. While the Y-box proteins do not all carry out similar functions, some patterns regarding their expression and function are beginning to emerge. Quite a few Y-box proteins have been found to be core proteins responsible for the formation of cytoplasmic mRNPs (5 -7 ). In addition there is a subset of Y-box proteins which are highly expressed in germ cells (7 ,8 ). It has been proposed that one common link among the Y-box family may be that many of these proteins are associated with growth related processes (31 ).
Here, we describe a new member of the Y-box family isolated from the fruit fly Drosophila melanogaster. This gene was isolated using the polymerase chain reaction (PCR) with degenerate primers to the region encoding the highly conserved CSD of these proteins. We have sequenced the cDNA and identified the open reading frame (ORF) containing the CSD. The gene for the ORF was designated ypsilon schachtel (yps). In addition to the CSD, various known protein motifs were identified within the yps ORF. The expression pattern of this gene was examined by both RNase protection assays and in situ hybridization with whole mount embryos. We have also mapped yps to chromosome 3 of the Drosophila genome. A plasmid was constructed which encodes the CSD of yps and was used in a bacterial overexpression system. The purified protein was used for mobility gel-shift analysis to investigate its nucleic acid binding characteristics. Gel-shift analysis showed that this domain of YPS can bind to single-stranded RNA suggesting that the function of YPS probably involves binding to RNA.
Degenerate primers were synthesized on an Applied Biosystems 380B synthesizer. Primer 1 d(CGGGATCCGTNAA(A/G)TGGTT(C/T)AA) covers amino acid sequence VKWFN and is degenerate at three positions. Primer 2 d(CGGGATCC(G/A)TGNAC(G/A)AANAC(G/A)TC) covers the sequence DVFVH and is degenerate at five positions. Both primers contain a BamHI site added to the 5'-end.
Drosophila DNA was prepared from Kc tissue culture cells according to Sambrook et al. (32 ). For the amplification reaction, 1 ng of DNA was mixed with 50 pmol of each primer in a 50 µl reaction containing 20 mM dNTPs, reaction buffer and Taq polymerase (Boehringer Mannheim). The parameters used for the PCR were as follows: 30 s at 94°C, 30 s at 37°C, a slow ramp from 37 to 72°C (1°C increase every 4 s) and 72°C for 45 s, this cycle was repeated three times, followed by 30 cycles as follows: 30 s at 94°C, 30 s at 55°C and 45 s at 72°C. During the initial four cycles, a lower annealing temperature and a slow ramp time between the annealing temperature and extension temperature were used because both have been reported to be critical parameters for the use of degenerate primers in PCR amplification (33 ). The 90 bp band of interest was purified according to Sambrook et al. (32 ), digested with BamHI and cloned into the BamHI site of pUC19, producing clones pYB1-pYB20.
The D.melanogaster embryonic cDNA library was originally constructed by T.-S.Hsieh (34 ). The procedure for screening the library was essentially that of Sambrook et al. (32 ). Plaque lifts were made with Hybond-N (Amersham) paper in duplicate. The filters were placed for 2 min onto Whatman paper that had been soaked in denaturing solution (1.5 M NaCl and 0.5 N NaOH), then transferred twice onto neutralizing solution (1 M Tris-HCl pH 7.4 and 1.5 M NaCl) soaked Whatman paper for 3 min each time. The filters were rinsed briefly in 2× SSC and allowed to air dry. The DNA was fixed to the nylon by exposure to ultraviolet irradiation for 3 min.
The filters were prehybridized in 5× SSPE, 5× Denhardt's solution, 0.5% SDS and 1 mg/ml salmon sperm DNA at 55°C for 90 min. The PCR fragment, described above, was labeled with [[alpha]-32P]dCTP and [[alpha]-32P]dGTP using the megaprime labeling kit (Boehringer Mannheim) following the manufacturer's protocol. Hybridization was done at 55°C overnight. The filters were rinsed three times in 2× SSC, 0.1% SDS and once in 1× SSC, 0.1% SDS at 50°C.
Positive plaques were picked and eluted in 1 ml of SM buffer (0.1 M NaCl, 0.01 M MgSO4, 50 mM Tris-HCl pH 7.5 and 0.01% gelatin) plus 1 drop of chloroform. Lambda DNA was isolated from positive phage after three rounds of screening, by the liquid lysate method of Chisholm (35 ).
After cloning the 90 bp PCR product into pUC19, eight separate clones were sequenced using a DuPont Genesis 2000 Automated DNA sequencer. For sequence analysis of the full length cDNA clone, the 1.8 kb EcoRI fragment from the lambda phage was subcloned into the EcoRI site of pUC19, producing plasmid pHT9a. DNA sequencing of this fragment was performed by the dideoxy chain termination method (36 ) using a Sequenase 2.0 kit (US Biochemical Corp) and [[alpha]-35S]dATP according to the manufacturer's procedure. The GenBank accession number for this nucleotide sequence is U49120.
Kc cells were maintained in D-22 medium (Sigma) supplemented with heat-inactivated 10% fetal bovine serum (Gibco-BRL) at 25°C. For cold shock experiments, 1 ml of cell suspension was transferred to a 15 ml sterile tube and immersed into a circulating water bath at 10°C. After the appropriate time (30 min or 4 h) cells were immediately pelleted in a refrigerated centrifuge and frozen at -80°C.
RNA was isolated from both organisms and tissue culture cells by the acid phenol guanidinium isothiocyanate method of Chomczyski and Sacchi (37 ). In the case of Drosophila egg, larvae, pupae and adult flies the organisms were homogenized for 10 s using a Tekmar tissumizer. Poly [A]+ RNA was isolated by the batch method using oligo dT-cellulose beads (Gibco, BRL).
In order to generate both sense and antisense transcripts of the yps gene the EcoRI fragment from pHT9a was inserted into the pBS KS(+) vector (Stratagene). This construct called pBSHT9a was cut with PstI to remove a 1.5 kb fragment of the cDNA. Re-ligation of the PstI-digested plasmid leaves the 346 bp fragment from the 5'-end of the cDNA which includes the first 213 untranslated bases and the first 133 bases of the coding region. This plasmid, pBSHT9aP was linearized with HincII and in vitro transcribed with T7 polymerase in the presence of [[alpha]-32P]CTP. The plasmid rp49 (gift from L.Rabinow, Rutgers University) was linearized with EcoRI and in vitro transcribed with T7 polymerase in the presence of [[alpha]-32P]CTP to produce an antisense transcript. In vitro transcription was performed using the riboprobe system (Promega) following the manufacturer's protocol. For detection of the transcripts the RPAII kit (Ambion) was used.
Nucleic acid and protein sequences were analyzed by use of the Genetics Computer Group Sequence analysis software package, version 7.2. Analysis of acidic/basic domains of the proteins was done using the DNA Strider 1.0.1 software.
Whole mount embryos were fixed and hybridized according to the procedure described by Mullen and DiNardo (38 ). pBSHT9a was linearized with XbaI or HindIII in order to make both sense and antisense RNA probes, respectively. In vitro transcription was performed with both T7 and Sp6 RNA polymerases in separate reactions, using the digoxigenin-labeling Genius kit (Boehringer Mannheim) according to manufacturer's instructions. Embryos were fixed according to standard procedures. Hybridization was carried out at 55°C overnight in hybridization mix (50% formamide, 5× SSC, 100 mg/ml herring sperm DNA, 50 mg/ml heparin and 0.1% Tween-20). After washing, embryos were incubated for 1 h at room temperature in anti-digoxigenin-alkaline phosphatase conjugated antibody diluted 1:1000 in PBT (PBS with 0.1% Tween-20) and preabsorbed to wild-type embryos. Color development with NBT and X-phosphate was carried out in the dark for ~2 h according to the manufacturer's instructions, after which the embryos were extensively washed with PBT. The embryos were then dehydrated and mounted onto slides. Pictures were taken using Nomarski optics, on a Nikon Microphot-SA microscope.
Drosophila salivary gland chromosomal squashes were prepared as described in Ashburner (39 ). pBSHT9a was used in a nick translation reaction as follows: 0.5 µg of DNA was mixed in a reaction with 0.166 mM each of dATP, dGTP and dCTP, 156 µM Biotin-16-dUTP, 0.06 U of DNase I (Boehringer Mannheim), 2.0 µl of DNA polymerase I, 156 µM cold dTTP and reaction buffer (0.5 M Tris-HCl pH 7.4, 0.1 M MgSO4, 1 mM DTT and 500 µg/ml bovine serum albumin). The reaction was in a final volume of 25 µl and was carried out for 1 h at room temperature. The labeled probe was purified over a Sephadex G-50 column and after ethanol precipitation was resuspended in 30 mM sodium phosphate buffer pH 6.8. The procedure for hybridization was essentially the same as described in Ashburner (39 ).
The CSD of the yps cDNA was amplified by PCR. The 5' primer d(AACATATGGCCACCAAAGTCACC) contained one base substitution at nucleotide 369 of the yps sequence to create an NdeI site and an initiation codon. The 3' primer d(CGCCGGTTGCACTGGTCGGACATCCCCTAGGGC), was designed to change the glycine and proline at the C-terminus of the CSD to serine and leucine respectively, and in addition a BamHI site was included at the 5'-end of this primer.
The 238 bp PCR product was purified and its sequence was verified. This fragment was digested with NdeI and BamHI and the resulting fragment was cloned into the T7 expression plasmid, pET11a which had also been digested with NdeI and BamHI. This plasmid, pET11FlyCSD, was transformed into BL21(DE3) cells for overexpression of protein.
BL21(DE3) cells containing plasmid pET11FlyCSD, were grown to an optical density of 0.6 before induction with 1 mM isopropylthio-[beta]-d-galactoside (IPTG) for 1.5 h. Cells were harvested and broken by French Press at 14 000 psi. The cell lysate was centrifuged at 9000 g for 45 min. A high-speed centrifugation of the supernatant was performed at 100 000 g for 2 h. The soluble fraction was then subjected to 35% ammonium sulfate precipitation. The pellet was dialyzed against 20 mM Tris-Cl pH 8.5 and loaded onto a Q-Sepharose column which was equilibrated with the same buffer. The column was run with a gradient from 0 to 600 mM NaCl. Fractions which contained a single protein band (corresponding to the IPTG-induced protein band) by Comassie blue staining were used for the gel-shift analysis.
The RNA probe used for gel-shift analysis was transcribed from XbaI digested pSP65 plasmid using SP6 RNA polymerase in the presence of [[alpha]-32P]CTP. The transcription procedure was as described by Promega. Transcription using SP6 polymerase produces a 38 base RNA transcript. The probe was gel purified on a denaturing polyacrylamide gel.
The binding assay was carried out in a buffer containing 10 mM Tris-HCl pH 7.4, 50 mM KCl, 5% glycerol, 1 mM EDTA and 0.05% NP-40. Radioactively labeled probe (5 × 103 c.p.m.) was mixed with 200 ng of poly dI:dC, and different concentrations of purified CSD protein in the presence of 8 mM MgCl2. The binding assay was incubated at room temperature for 1 h prior to loading on a pre-run 5% native polyacrylamide gel containing 0.5× TBE. Gels were transferred to filter paper, dried and exposed to Kodak XAR film.
PCR amplification using primers within two completely conserved regions of the CSD produced an array of bands presumably due to the degeneracy of the primers. However, as shown in Figure 1 , a band of the expected size (90 bp) was included among these bands. This fragment was isolated and cloned into pUC19. Sequencing of eight clones showed that four of them contained the identical sequence which was homologous to other known CSD sequences. This fragment was then used to screen an embryonic D.melanogaster cDNA library. Approximately 400 000 plaques were screened in which three positive clones were identified, 1, 6 and 9. These three clones contained inserts of ~2.2, 0.6 and 1.9 kb, respectively. Sequencing of clone 9 revealed that it contained a full length ORF. The ORF starts at position 213 and ends at position 1289, which suggests that it encodes a protein of 359 amino acid residues with a predicted molecular weight of 39 kDa. The gene for the ORF was designated ypsilon schachtel (yps). The yps protein appears to be very basic with a calculated pI of 11.2. The sequence preceding the ATG, AACGATG corresponds in five of seven positions to the consensus translation initiation sequence (C/A)AA(C/A)ATG for Drosophila (40 ). A stop codon, TAA, is found at position 1289, followed by a putative polyadenylation signal. Near the N-terminus of the protein sequence is the CSD. Also of interest are two glutamine-rich regions that flank either end of the CSD. N-terminal to the CSD are 10 Gln residues, and C-terminal to the CSD are stretches of both six and five Gln residues. These regions are CAG repeats which are present in many Drosophila genes (41 ). The C-terminal tail of the protein contains a very high amount of arginine (26%), glycine (10%) and proline (14%) between residues 192 and 359.
Figure 2 shows a sequence comparison for the CSD of the YPS protein aligned with the CSD of other known eukaryotic Y-box proteins, along with CspA from E.coli. Identity within this region is 89% compared to the human YB-1 protein and 47% compared to CspA. The RNP1 RNA binding motif encompasses the sequence GYGF and is conserved among all the eukaryotic proteins. In addition, the RNP-2 like motif VFV is also conserved among all the proteins, with the exception of C.elegans which contains the sequence LFV.
Most Y-box proteins do not have high sequence homology with each other when comparing the C-terminal domains. It has been proposed that this domain has eight regions of alternating acidic and basic residues, each about 30 amino acid residues in length. Figure 3 displays the acidic and basic content, represented by histograms, of some of the eukaryotic Y-box proteins. The proteins are aligned with respect to their CSD. The eight alternating regions are clearly visible in the vertebrate Y-box proteins. However, these regions are absent in the Drosophila yps protein, and in the Y-box protein from Aplysia californica. In both of these cases there is only one acidic region within an entirely basic tail domain. The similarity between Aplysia and Drosophila would suggest that the invertebrate proteins may make up a different class of Y-box proteins than the vertebrate members. Interestingly, the C.elegans gene lin-28 encodes a protein with a much shorter C-terminal tail compared to the other eukaryotic Y-box proteins, and also does not have alternating acidic and basic regions (15 ). In addition, a plant Y-box protein GRP, does not have the alternating acidic and basic residues at the C-terminus, however this protein is much smaller than other Y-box proteins and is glycine-rich (42 ).
Figure
One characteristic which is common to all the vertebrate Y-box proteins is a high arginine content in the C-terminal tail of these proteins. This is also true for the yps protein. The RGG box which is known as an RNA binding domain, is defined as closely spaced Arg-Gly-Gly (RGG) repeats (43 ). The minimal number of RGG repeats required for RNA binding is not known, however the yps protein contains four repeats located in the tail region between amino acid residues 204 and 276.
Developmental expression of the yps gene was investigated using an RNase protection assay (RPA). The yps transcript was detected in all stages of development that were tested, including 2-3 h embryos, 14-22 h embryos, third instar larvae and adult flies (Fig. 4 A). After densitometric analysis, the values were corrected against the control, rp49. The relative amount of the yps transcript is shown in the histogram in Figure 4 . The highest expression was found in adult flies, with about a 3-fold increase over other stages tested.
Figure
We were also interested to test the possibility that this gene may be cold-shock inducible, due to the fact that three of the bacterial homologs are cold-shock inducible (17 ,18 ). To our knowledge the question of cold induciblity of the eukaryotic Y-box proteins has not been previously addressed. We tested this in the Kc cell line, an embryonic cell line which has endogenous yps expression. After both 30 min and 4 h incubation at 10°C the amount of the yps mRNA did not change appreciably (Fig. 4 B). The histogram shown in Figure 4 shows a slight increase in the relative amount of the message during cold shock. However, these values were obtained as relative amounts against rp49 expression which was slightly decreased at 10°C.
In order to further investigate the expression of the yps gene during development, in situ hybridization of whole mount embryos was performed. Figure 5 displays the results of this hybridization. The yps transcript is clearly present in the stage 2 embryo, which implies that it is maternally loaded into the egg cytoplasm prior to fertilization. Between stages 2 and 4 the egg cytoplasm concentrates peripherally in the so-called cortex (44 ). At stage 4 (Fig. 5 B) a region of staining in the periphery of the embryo is observed, which is explained by the fact that the cytoplasm has now migrated to this position. By stage 6 the somatic cells have incorporated most of the egg cytoplasm, and within these cells, the nuclei are situated to the outside and the cytoplasm inside. This is particularly clear in the stage 6 picture (Fig. 5 C). At stage 8 (Fig. 5 D) as germ band elongation has begun, dark staining is clearly present along the mesodermal layer of cells. Staining is also seen above the cephalic furrow, most likely in the cephalic mesoderm, or anterior midgut primordium. At the latest stage no staining can be seen in the outer epidermal tissues (Fig. 5 E).
Figure
In order to map this gene within the Drosophila chromosome, in situ hybridization was carried out with salivary gland polytene chromosomes. Only one hybridized band was found indicating that this is probably the only Y-box gene in Drosophila. The biotin-labeled DNA probe is clearly visualized in Figure 6 . This region of hybridization corresponds to the left arm of chromosome 3. It is believed that the band falls within the later sections of band 69 to the early sections of band 70.
Figure
The CSD of the YPS protein was successfully purified by the use of ion-exchange chromatography to over 95% purity. This purified protein was then used for studies of its nucleic acid binding characteristics. The probe used to measure the RNA binding capability of the CSD of yps was a single-stranded 38mer. As seen in Figure 7 , the CSD of yps was able to bind to this RNA probe, when added at concentrations of 8 and 12 µM. When protein was added to the probe at concentrations of 2 µM, no gel shift was seen, and at 4 µM only a partial gel shift was observed (data not shown). 120 pmol of the CSD was required to bind 25 fmol of the RNA probe.
Figure
In the present report we have identified a Drosophila cDNA encoding a member of the Y-box protein family. Common to all eukaryotic, vertebrate Y-box proteins is the presence of a conserved CSD and a C-terminal tail of alternating acidic and basic regions (2 ). Although the YPS protein contains the conserved CSD, it lacks the alternating acidic and basic regions conserved among the other vertebrate Y-box proteins. Both the marine invertebrate, Aplysia, and Drosophila lack these regions suggesting that this feature is absent in the invertebrate members of this protein family. Interestingly, the prokaryotic proteins in this family are much shorter than the eukaryotic members and consist only of the CSD. In addition to the CSD we have located what may be an RGG box in the C-terminus of the protein. Both of these protein domains are recognized RNA-binding motifs (42 ). Our studies with the purified CSD of this protein show that it does interact with RNA supporting the theory that YPS may be an RNA binding protein.
Another interesting motif within the YPS protein is the CAG repeats which are found flanking either side of the CSD. These repeats encode polyglutamine tracts and are found in a number of developmentally regulated Drosophila genes, including several homeotic genes (43 ). The function of these polyglutamine tracts is not fully understood, although it has been suggested that they may function in transcriptional regulation by modulating the interaction of protein with DNA. Evolutionarily speaking, one could imagine an event in which the CSD was transposed into a CAG repeat region, leading to the polyglutamine tracts which flank the CSD of the YPS protein.
Although many eukaryotic Y-box proteins have been cloned, to our knowledge the cold shock responsiveness of these proteins has not been investigated. We investigated the amount of yps transcript after cold shock of tissue culture cells. The level of yps transcript did not change during cold treatment, indicating that yps is not a cold shock inducible gene. In addition, we also found that this gene did not respond to heat shock (data not shown).
According to the results from the whole mount in situ hybridization, we propose that yps is a maternally loaded transcript. There are numerous examples of maternal effect genes which are involved in spatial organization of the embryo (45 ,46 ). According to our results, the mRNA for yps is found throughout the early embryo cytoplasm. In the case of dorsal, the mRNA is also found throughout the early embryo, however, protein expression is spatially restricted (46 ). The translational capacity of the mRNA identified in Figure 5 is not known. Expression of yps is also seen in the mesodermal region of the germ band. According to the stages that were used for hybridization it appears that the yps gene is expressed in all mesodermal tissue. However, some proteins show broad mesodermal expression during early stages of development, while in later stages they show a specific expression confined to distinct organs (47 ). This may also be the case for yps since embryos later than stage 13 were not used for hybridization. In addition, we cannot be certain if the message detected at these stages is actually transcribed.
Many of the organisms in which Y-box proteins have been isolated actually contain more than one Y-box gene. This is true in the case of human, frog and mouse. Escherichia coli also has a large family of CspA-like proteins. Results from Southern hybridization, using the CSD of yps as a probe, have led us to believe that yps is the only Y-box gene in D.melanogaster (data not shown). This is further supported by the findings with the polytene chromosome hybridization, in which only one band was identified. The localization of the yps gene to the left arm of chromosome 3, division 69-70a-c, puts the gene in an area in which many lethal genes have been mapped. Further analysis may provide more precise information about the location of this gene within this subdivision.
In summary, yps is a gene which appears to be both a maternally loaded transcript, as well as zygotically expressed in mesodermal tissue during development. This gene also appears to be expressed throughout development. Analysis of the primary amino acid sequence of yps reveals two known RNA binding motifs, the CSD and the RGG box. Yps is novel in that it contains these two motifs together in one protein. Results obtained with the CSD of this protein show that this domain interacts and binds to RNA, however, further analysis would be necessary to determine how the C-terminal domain affects this RNA binding. All the present evidence suggests that YPS would be an RNA binding protein, it remains to be determined if it has dual specificity and could also act as a transcription factor as has been found for other Y-box proteins (5 ,7 ).
We would like to thank Dr Marilyn Sanders for providing us with the Kc cell line and for supplying the cDNA library. We are indebted to the many Drosophila researchers at the Waksman Institute. In particular we would like to thank the laboratory of Dr Richard Padgett and particularly, Dr Janet Mullen for helping us with the whole mount in situ hybridization. We would also like to thank Dr Ruth Steward and the members of her laboratory for their help with the polytene chromosome hybridization, and for use of their microscope. In addition we acknowledge Dr Marcelo Jacobs-Lorena (Case Western Reserve University) for providing us with the frozen embryos, larvae and adult flies. Finally, we would like to thank Dr Ujwal Shinde for his help with computer imaging and Dr Sue Harlocker for her help with computer analysis. This work was supported by a grant issued from the National Institute of Health, GM19043.
This article has been cited by other articles:
REFERENCES
![]()
CiteULike
Connotea
Del.icio.us What's this?
![]()
![]()

![]()
![]()
![]()
S. Takiya, Y. Nishita, S. Ishikawa, K. Ohno, T.-a. Tamura, and Y. Suzuki
Bombyx Y-Box Protein BYB Facilitates Specific DNA Interaction of Various DNA Binding Proteins Independently of the Cold Shock Domain
J. Biochem.,
June 1, 2004;
135(6):
683 - 693.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
T. Soop, D. Nashchekin, J. Zhao, X. Sun, A. T. Alzhanova-Ericsson, B. Bjorkroth, L. Ovchinnikov, and B. Daneholt
A p50-like Y-box protein with a putative translational role becomes associated with pre-mRNA concomitant with transcription
J. Cell Sci.,
April 15, 2003;
116(8):
1493 - 1503.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
J. Yu, N. B. Hecht, and R. M. Schultz
RNA-Binding Properties and Translation Repression In Vitro by Germ Cell-Specific MSY2 Protein
Biol Reprod,
October 1, 2002;
67(4):
1093 - 1098.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
J. H. Mansfield, J. E. Wilhelm, and T. Hazelrigg
Ypsilon Schachtel, a Drosophila Y-box protein, acts antagonistically to Orb in the oskar mRNA localization and translation pathway
Development,
January 1, 2002;
129(1):
197 - 209.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
A. Nakamura, R. Amikura, K. Hanyu, and S. Kobayashi
Me31B silences translation of oocyte-localizing RNAs through the formation of cytoplasmic RNP complex during Drosophila oogenesis
Development,
September 1, 2001;
128(17):
3233 - 3242.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
M. Pelletier, M. M. Miller, and L. K. Read
RNA-binding properties of the mitochondrial Y-box protein RBP16
Nucleic Acids Res.,
March 1, 2000;
28(5):
1266 - 1275.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
J. E. Wilhelm, J. Mansfield, N. Hom-Booher, S. Wang, C. W. Turck, T. Hazelrigg, and R. D. Vale
Isolation of a Ribonucleoprotein Complex Involved in mRNA Localization in Drosophila Oocytes
J. Cell Biol.,
February 7, 2000;
148(3):
427 - 440.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
M. L. Hayman and L. K. Read
Trypanosoma brucei RBP16 Is a Mitochondrial Y-box Family Protein with Guide RNA Binding Activity
J. Biol. Chem.,
April 23, 1999;
274(17):
12067 - 12074.
[Abstract]
[Full Text]
[PDF]
![]()
![]()
![]()

![]()
![]()
![]()
W. Gu, S. Tekur, R. Reinbold, J. J. Eppig, Y.-C. Choi, J. Z. Zheng, M. T. Murray, and N. B. Hecht
Mammalian Male and Female Germ Cells Express a Germ Cell-Specific Y-Box Protein, MSY2
Biol Reprod,
November 1, 1998;
59(5):
1266 - 1274.
[Abstract]
[Full Text]
![]()
This Article ![]()
![]()
Abstract
![]()
Print PDF (238K)
![]()
Alert me when this article is cited
![]()
Alert me if a correction is posted
![]()
Services ![]()
![]()
Email this article to a friend
![]()
Similar articles in this journal
![]()
Similar articles in ISI Web of Science
![]()
Similar articles in PubMed
![]()
Alert me to new issues of the journal
![]()
Add to My Personal Archive
![]()
Download to citation manager
![]()
Search for citing articles in:
ISI Web of Science (19)
![]()
Commercial Re-use Guidelines
for Open Access NAR Content
![]()
Google Scholar ![]()
![]()
Articles by Thieringer, H. A.
![]()
Articles by Inouye, M.
![]()
Search for Related Content
![]()
PubMed ![]()
![]()
PubMed Citation
![]()
Articles by Thieringer, H. A.
![]()
Articles by Inouye, M.
![]()
Social Bookmarking ![]()
![]()
What's this?
