Characterization of the TATA-less core promoter of the cell cycle-regulated cdc25C gene
Characterization of the TATA-less core promoter of the cell cycle-regulated cdc25C geneKathrin Körner, Lawrence A. Wolfraim+, Frances C. Lucibello and Rolf Müller*
Institut für Molekularbiologie und Tumorforschung (IMT), Philipps-Universität Marburg, Emil-Mannkopff-Strasse 2, D-35033 Marburg, Germany
Received September 8, 1997Revised and Accepted October 19, 1997
ABSTRACT
The TATA- and Inr-less promoter of the human cdc25C gene is regulated during the cell cycle through binding of a repressor to two contiguous promoter-proximal elements, the CDE and CHR. In this study we have characterized in detail the region of the cdc25C promoter immediately downstream of these elements. Several lines of evidence suggest that this region of ~60 bp acts as the core promoter. This sequence: (i) harbors most of the transcription initiation sites; (ii) possesses basal promoter activity in vivo; (iii) shows no stable protein binding in vivo as indicated by genomic dimethyl sulfate and phenanthroline copper footprinting; (iv) contains single-stranded regions in vivo as shown by potassium permanganate footprinting; (v) is hypersensitive to DNase I cleavage in permeabilized cells. Mutational analysis of the core promoter revealed the presence of three sites which play a role in transcription. Two of these sites were found to represent low affinity binding sites for transcription factors of the Sp1 family. Mutation of these sites led to decreased levels of transcription, while their alteration to canonical Sp1 sites impaired cell cycle regulation. Thus the transient interaction of Sp1 with the core promoter appears to be necessary for maximal transcription without perturbing cell cycle regulation.
The product of the mammlian cdc25C gene is a protein phosphatase which positively regulates passage from G2 to M phase (1 ,2 ). During cell cycle progression the level of cdc25C mRNA increases dramatically in S phase, reaching peak levels in G2 (3 ,4 ). We have previously described two regulatory elements, the cell cycle-dependent element (CDE) and the cell cycle genes homology region (CHR), which cooperate in the control of cell cycle-regulated repression of this gene (4 ,5 ). It is believed that cooperative binding of a repressor, CDF-1, with these elements during the early stages of the cell cycle interfers with the interaction of proteins bound to the upstream activating sequence (UAS) with the basal transcriptional machinery (4 ,6 ).
The cdc25C UAS has been analyzed in detail (6 ) and the transcription factors NF-Y/CBF (7 ,8 ) and Sp1 (and/or other Sp1 family members) have been shown to be the major activator proteins of this gene. In contrast, the region of transcription initiation lying downstream of the UAS (4 ) and the CDE-CHR has not yet been characterized. Like most other cell cycle genes described to date, the cdc25C gene lacks a TATA box and a consensus sequence for an initiator (Inr) element (4 ). As a consequence these genes initiate transcription from multiple sites, clustering within a region of 50-150 bp (9 ). Other elements have been implicated in the initiation of a few other genes, most of them interacting with proteins of unknown nature or ill-defined function (9 ). Interestingly, the transcription factor YY-1, also involved in transcriptional activation and repression, has been reported to initiate transcription in vitro from the adeno-associated virus P5 promoter together with TFIIB and RNA polymerase II in the absence of the TATA binding protein TBP (10 ,11 ). For other genes it has been suggested that stable binding of Sp1 to a site(s) immediately 5' of the region of transcription initiation may serve to recruit the basal complex to the promoter in the absence of a TATA box and an Inr (12 ). For most TATA- and Inr-less genes it is, however, unclear how initiation is determined and how core promoter structures could be defined. This applies to almost all known cell cycle-regulated genes, including cell cycle-dependent kinases (cdc2) and phospatases (cdc25C), cyclins (A, B and E), pocket proteins (p107), transcription factors (B-myb and E2F-1) and enzymes (dehydrofolate reductase and thymidine kinase) (13 ).
In this study we have characterized in greater detail the putative core promoter region of the cdc25C promoter located downstream of the CDE-CHR. The proximal promoter region of the human cdc25C gene lacks both a TATA box and an Inr consensus sequence and is GC rich (4 ), features which are common to the basal promoter regions of many cell cycle-regulated genes. Transcription start site mapping by primer extension revealed the existence of multiple sites spanning the entire region from approximately -20 to +56, the two strongest sites being located downstream of the CDE-CHR element (4 ). In the present study we verify the location of the transcription initiation region by an independent method. Mutational analysis of this region revealed the existence of three sites playing a role in transcription. In vivo footprinting studies failed to reveal protein binding to this sequence, but clearly showed DNase I hypersensitive nucleotides and single-stranded regions. Taken together, these observations suggest that this region of the cdc25C gene represents the core promoter. We also show that three sites within this region are functionally important, two of these sites being low affinity binding sites for members of the Sp1 family. Swapping these sites with high affinity sites leads to a considerable decrease in cell cycle regulation. These results suggest that these sites are necessary for maximum transcription and that transient binding is a necessity for maintaining cell cycle regulation via the CDE-CHR element.
Transcription start sites were mapped using the tobacco acid pyrophosphatase-reverse ligation polymerase chain reaction (TAP-RLPCR) procedure as described (14 ) using 1 µg poly(A)+ RNA from serum-deprived or restimulated WI-38 cells as starting material. In all incubation steps 38 U RNA guard (Pharmacia) were included. Ligation products were mixed with 10 ng cdc25C gene-specific primer number one. Samples were denatured for 5 min at 95°C, cooled to 48°C and primer annealing was carried out for 45 min. Reverse transcription (RT) was performed for 90 min at 48°C using 200 U Superscript Plus reverse transcriptase (Gibco-BRL) and terminated for 5 min at 95°C. The following two PCR reactions were performed with a `hot' start using Amplitaq (Perkin Elmer) and 50 ng gene-specific primer two or 12.5 ng gene-specific primer three. The third gene-specific primer was end-labeled to visualize the PCR products. Following the `hot' PCR, samples were extracted with phenol/chloroform and ethanol precipitated.
The following oligonucleotides were used in the TAP-RLPCR: cdc25C-1 primer, 5'-AGGGGAAAGGAGGTAGTT; cdc25C-2 primer, 5'-TAGATTGCAGCTCTGCCTTCCGAC; cdc25C-3 primer, 5'-CCTTCCGACTGGGTAGGCCAACGTCG; RNA linker primer, 5'-GGGCAUAGGCUGACCCUGGCUGAAA; DNA linker primer, 5'-GGGCATAGGCTGACCCTCGCTGAAA.
For genomic footprinting (4 ,6 ,15 ) WI-38 cells were grown to 70% confluency. For dimethyl sulfate (DMS) footprinting the cells were treated with 0.2% DMS for 2 min. After DMS treatment cells were washed three times with cold PBS and the DNA isolated. Piperidine cleavage was performed as described. For potassium permanganate (KMnO4) treatment (16 ,17 ) cells were incubated with 20 mM KMnO4 for 2 min and washed twice with PBS, 2% [beta]-mercaptoethanol and once with PBS. Piperidine cleavage was performed as described. For DNase I and 1,10-phenanthroline copper (OP-Cu) treatment the cells were scraped into PBS and resuspended in DNase I digestion buffer (60 mM KCl, 15 mM NaCl, 5 mM MgCl2, 0.1 mM EGTA, 15 mM Tris-HCl, pH 7.4, 0.5 mM DTT, 0.1 mM PMSF, 1 M sucrose) containing 0.2% NP40 (for permeabilization of cells). For DNase I cleavage 200-400 U DNase I (Boehringer, Mannheim) were added, after 5 min the reaction was stopped by addition of a 1/5 reaction volume 62.5 mM EDTA and 2.5% SDS. For OP-Cu treatment a complex formed from 40 µM 1,10-phenanthroline and 10 µM CuSO4 (final concentrations) was added to the cell suspension and the reaction was started by addition of 3-mercaptopropionic acid to a concentration of 6.9 mM. After 2 min the reaction was stopped by addition of 2.9-dimethyl-1,10 phenanthroline to a final concentration of 2.8 mM. For comparison WI-38 genomic DNA was either methylated in vitro with 0.2% DMS for 10-30 s, treated with 2 mM KMnO4 for 30 s, cleaved with 4 U DNase I for 30 s or treated with OP-Cu for 60-75 s. Three µg of genomic DNA was used for ligation-mediated PCR (LMPCR) as described. For OP-Cu treatment the DNA was phosphorylated with T4 polynucleotide kinase (New England Biolabs) before performance of LMPCR. The Stoffel fragment of Taq polymerase (Perkin Elmer) was used instead of the native enzyme. Samples were phenol extracted and ethanol precipitated after primer extension with 32P-labeled primers.
The following oligonucleotides were used as primers: primer 1, Tm = 56.0°C, 5'-d(AGGGAAAGGAGGTAGTT)-3'; primer 2, Tm = 74.0°C, 5'-d(TAGATTGCAGCTATGCCTTCCGAC)-3'; primer 3, Tm = 83.0°C, 5'-d(CCTTCCGACTGGGTAGGCCAACGTCG)-3'.
Two to four base pair mutations were introduced into the region of the cdc25C promoter spanning -2 to +52 using PCR-directed mutagensis (6 ,18 ) and Vent DNA polymerase (New England Biolabs). Fragments were cloned as BamHI-HindIII fragments into the multiple cloning region of the promoterless luciferase reporter vector pXP2 (19 ). For this series of mutants the following base substitution rules were observed: guanines and cytosines were changed to thymidines and adenines respectively and vice versa. All other mutant constructs were similarly generated. All constructs were verified by DNA sequencing. Constructs were transfected into NIH 3T3 cells using the DEAE-dextran method. Values were determined for growing and quiescent NIH 3T3 cells as previously described (4 ).
Nuclear extracts were prepared from exponentially growing HeLa cells in suspension (20 ). Electrophoretic mobility shift assays (EMSA) were performed by incubating 1-2 µl nuclear extract with ~0.5 pmol radiolabeled probe as previously described (21 ). EMSA reactions were performed at room temperature for 15 min followed by gel electrophoresis at 4°C using 4% polyacrylamide gels. Supershifts were carried out by preincubating EMSA reactions on ice for 20 min with 2 µl indicated antibodies prior to addition of the radiolabeled probe. Sp1 and Sp3 antibodies (22 ) were obtained from Dr G.Suske (IMT, Marburg, Germany).
The following oligonucleotides were used as probes and/or competitors: -10/+20, 5'-gggAGGTTTGAATGGTCAACGCCTGCGGCTGTT; +25/+54, 5'-gggTTCTTGCTCAGAGGCCGTAACTTTGGCCTT; M11, 5'-gggAGGTTTGAATGGTCAACGC-CGGCGGCTGTT; M12, 5'-gggAGGTTTGAATGGTCAACGCCTACGGCTGTT; M13, 5'-gggAGGTTTGAATGGTCAACGC-CTGAGGCTGTT; M14, 5'-gggAGGTTTGAATGGTCAACGC-CTGCAGCTGTT; M15/16, 5'-gggAGGTTTGAATGGTCAAC-GCCTGCGTATGTT; GT-box, 5'-AGCTTCCGTTGGGGTGTG-GCTTCACGTCGA.
Letters in lower case represent G residues added to the 5'-end of each strand to facilitate labeling by the Klenow fragment of DNA polymerase. Underlined letters represent mutated bases.
Off-rates were measured essentially as described (23 ). Nuclear extracts were incubated with 0.5 pmol labeled probe for 15 min, when binding equilibrium was reached (data not shown). Excess unlabeled competitor (50 pmol) was added after various time points. Incubations were staggered to ensure that all reactions were terminated by transfer to ice at the same time. Samples were immediately loaded onto a 4% polyacrylamide gel for EMSA analysis.
The location of the transcription initiation region within the cdc25C promoter has been mapped by primer extension analysis (4 ). To verify these previous results by an independent technique we made use of the TAP-RLPCR procedure. The TAP-RLPCR method is highly sensitive and is cap specific (17 ), so that transcripts which are 5'-truncated will not be detected. In addition, truncated molecules arising from pausing during the subsequent reverse transcription reaction will not be efficiently amplified with this procedure. The transcription start sites of human cdc25C identified by this technique were mapped to a very similar region as that identified by primer extension (Fig. 1 ). Many of the positions mapped by the two procedures were actually identical, although the number of sites seen with the TAP-RLPCR technique was greater and the two major start sites mapped by primer extension were not as pronounced by TAP-RLPCR. Similar differences have also been reported when other TATA-less promoters were analyzed with different techniques, as for example in the case of the human cyclin D1 promoter (24 ,25 ). These differences are, however, not important for the questions addressed in the present study, since the region of transcription initiation was the same with both procedures.
In order to gain some insight into the in vivo structure of the cdc25C transcription initiation region we performed genomic footprinting using different reagents for modification of the DNA. First, we investigated whether stable protein interactions occur in this part of the promoter. Cells were exposed to DMS or OP-Cu and the DNA analyzed for protected or hypersensitive regions. As shown in Figure 2 A and B, neither DMS nor OP-Cu exposure resulted in any differences when DNAs treated in vivo or in vitro were compared. In contrast, clear protections were seen in the region upstream of position +1 with both reagents. This region harbors multiple known binding sites for activators (CBS1-3 in Fig. 2 A) and the cell cycle-regulated repressor CDF-1, binding to the CDE-CHR at positions -16 to -2 (Fig. 2 ). These observations indicate that the transcription initiation region does not stably interact with transcription factors in vivo, as would be expected of a core promoter.
We next investigated the sensitivity of the chromatin in the transcription initiation region to nucleolytic cleavage using a high resolution genomic footprinting approach after treatment of permeabilized cells with DNase I. The data in Figure 3 clearly reveal multiple hypersensitive sites in between positions +14 and +52. Such a clustering of DNase I hypersensitive nucleotides was specific for this region of the promoter and not seen in the UAS, where, in contrast, protections due to binding of the upstream activators could be detected (Fig. 3 and data not shown). This selective accessibility to DNase I points to an open chromatin structure and the absence of stable protein interactions, an observation that is fully compatible with this region representing the core promoter of the cdc25C gene.
Finally, we asked the question as to whether the same promoter sequence might contain single-stranded regions. To this end cells were exposed to KMnO4, which preferentially attacks pyrimidines in single-stranded DNA (16 ,17 ). The DNA from these cells was analyzed by the same PCR-mediated approach as before and compared with DNA treated in vitro. As can be seen in Figure 4 , the region from +1 to +58 showed >12 strongly hypersensitive nucleotides. Again, a similar clustering of hypersensitive sites was not seen further upstream (Fig. 4 and data not shown), indicating that extensive single-stranded regions occur in the region of transcription initiation. This finding also supports the conclusion that this region is the cdc25C core promoter, since clustered KMnO4 hypersensitive regions are a hallmark of paused RNA polymerases (26 ).
We next sought to investigate whether the region upstream of the CDE-CHR has an influence on promoter activity. For this purpose we truncated most of this region (downstream of +31) in promoter constructs including part of the UAS (C75) or lacking the UAS (C20). The data in Figure 5 show that this truncation (+31 to +121) led to a clear decrease in promoter activity in both cases, in particular in the construct lacking the UAS. We have previously shown that the region downstream of position +50 plays only a marginal role, if any, in determining transcriptional activity (4 ). We therefore conclude that it is the sequences upstream of position +50 which contribute to promoter activity. These observations show that the transcription initiation region possesses basal promoter activity. This activity corresponds to 10-20% of the basal SV40 promoter including its six Sp1 sites (data not shown).
Two or four base pair substitutions introduced into the cdc25C promoter from +2 to +48 in the C290 construct (-290 to +121) revealed the presence of three functionally important regions (see roman numbers in Fig. 5 ). Region I was revealed when mutations were introduced at positions +7 to +10 and +11 to +14, which led to a decrease in luciferase activity of ~40 and 20% respectively. Region II was mapped to bases +23 to +30, where two mutants showed a 40-55% reduction in transcriptional activity. An ~55% reduction was also seen with a plasmid harboring mutations at positions +37 to +40 (region III). A closer anaylsis of region I using point mutants (Fig. 5 ) showed that an alteration at position +11 led to a decrease in transcription by ~20%, while mutation of position 12 resulted in an ~20% increase.
In order to identify proteins that interact with the functionally relevant regions in the cdc25C core promoter we performed EMSAs with nuclear extract from HeLa cells and two probes covering nucleotides -10 to +20 or +25 to +54. Both probes formed multiple complexes with the same DNA binding proteins, as suggested by cross-competition experiments (data not shown). These proteins were identified as transcription factors of the Sp1 family. This conclusion is based on several observations: (i) these complexes were of the same mobility as those seen for a bona fide Sp1 binding site, the GT box (data not shown); (ii) competition experiments with a GT box oligonucleotide completely abrogated these complexes (data not shown); (iii) antibody supershift experiments identified the complex-forming factors as Sp1 and Sp3 (Fig. 6 ). Furthermore, an oligonucleotide competitor of random sequence was unable to compete with any of the probes, demonstrating that the binding was specific.
The interaction with Sp1 family members is surprising since no protections were seen in the respective regions of the core promoter in genomic footprints (Fig. 2 ), in spite of the fact that the same promoter shows strong DMS and DNase I footprints in the UAS region in vivo (6 ). One possibility to explain this discrepancy would be to postulate that Sp1 and Sp3 bind only transiently to these non-canonical downstream sites. The affinity of these sites is 10- and 40-fold lower for regions I and III respectively relative to the consensus GT box, as revealed by a competitor titration and PhosphorImager analysis (data not shown). We therefore sought to compare the dissociation rates for these sites with a canonical Sp1/Sp3 site. As shown in Figure 8 , the canonical Sp1/Sp3 binding site bound these proteins in a stable manner with very little dissociation in the presence of excess competitor over the time course of the experiment. In contrast, binding to both sites in the cdc25C core promoter was very rapidly competed by excess competitor. Only ~8 and 6% of the probe remained bound after only 1 min for the sites in regions I and III respectively. In agreement with these results, association of the cdc25C sites with Sp1 was faster than that seen with the GT box (data not shown). These results suggest that the low affinity binding sites in the cdc25C core promoter bind Sp1 and Sp3 transiently, although transfection studies clearly indicate that these sites play a role in supporting promoter activity (Fig. 5 ).
Finally, we decided to determine whether the transient nature of Sp1/Sp3 binding to these sites was of any functional relevance. To this end we converted both sites, either alone or in combination, to canonical GT or GC boxes by making base substitutions at four positions. Region I was changed from CGCCTGCGG to gGggTGtGG (GT box) and region III from GAGGCCGTA to GgGGCgGgc (GC box). EMSA analysis confirmed that these mutations indeed led to a dramatic increase in stability of the bound Sp1 complex (data not shown). Surprisingly, both mutations, in particular in combination, resulted in a clear loss of cell cycle-regulated repression in G0 cells (Table 1 ). Thus the change of both sites to high affinity GT boxes reduced cell cycle regulation to 1.8-fold (activity in growing cells relative to G0 cells). From these results we conclude that the transient nature of Sp1/Sp3 binding to the cdc25C core promoter sites is a requirement for cell cycle-regulated transcription.
Transcription of the human cdc25C gene is largely S/G2 specific (3 ,4 ). We have previously described that this cell cycle-regulated transcription is due to phase-specific binding of a repressor (CDF-1) to two contiguous co-repressor elements, the CDE and CHR, in the region of the basal promoter (4 ,5 ). CDF-1 is thought to interfere with interaction of the basal transcriptional machinery with the constitutively bound upstream activators NF-Y and Sp1 (4 ,6 ). In the present study we have analyzed the promoter downstream from the CDE-CHR, which is the region of transcription initiation (4 ; Fig. 1 ). Multiple transcription start sites were mapped throughout this region, which is a characteristic of many TATA-less promoters which also lack a consensus Inr element (9 ). This observation provided the first hint that this region of the cdc25C gene represents the core promoter.
Substitution of the low affinity Sp1/Sp3 binding sites in the cdc25C core promoter with canonical high affinity binding sites leads to deregulated transcription due to a loss of repression in G0 cells
Construct
Relative activity in quiescent cells (G0)
Relative activity in growing cells (Gr)
Cell cycle regulation (Gr/G0)
C290
0.15 ± 0.04
1.00
6.5
C290-GTa
0.27 ± 0.07
1.00 ± 0.11
3.7
C290-GCb
0.46 ± 0.06
1.41 ± 0.43
3.1
C290-GT-GCc
0.69 ± 0.02
1.41 ± 0.27
2.0
aGT box in region I.bGC box in region III.
cGT box in region I and GC box in region III.
RLU values obtained in transient luciferase assays are expressed as relative activities normalized to C290 in growing cells. Values represent the average of three independent experiments ± SD.
Several additional lines of evidence support this conclusion: (i) in vivo DMS and OP-Cu footprinting of this region did not reveal any stable protein binding (Fig. 2 ); (ii) the same region harbors numerous DNase I hypersensitive nucleotides (Fig. 3 ), indicating an open chromatin structure (17 ,26 ); (iii) multiple regions of clear KMnO4 hypersensitivity were detectable in vivo (Fig. 4 ), indicating single-stranded sequences (16 ,17 ,27 ,28 ); (iv) this region of the promoter has transcriptional activity, which could be associated with specific sites (Fig. 5 ). All these observations fit the conclusion that the region immediately downstream of the CDE-CHR is the cdc25C core promoter. The fact that basal promoter activity was observed in transient luciferase assays (Fig. 5 ) in the absence of any stable protein binding (Fig. 2 ) suggests that transiently associating transcription factors mediate the effect on transcription. This idea is also in agreement with the fact that this region of the promoter is part of the transcribed region, where stable binding of transcription factors might hinder RNA synthesis.
This conclusion is also supported by in vitro investigations. Using HeLa nuclear extract in EMSAs we were able to identify specific complexes between two regions of the core promoter and Sp1 family members (Fig. 6 ). A good correlation was found between binding of Sp1 and Sp3 to mutant sites and the ability of these sites to support maximum levels of transcription (Fig. 7 ). In agreement with the considerations made above we found that these Sp1/Sp3-DNA complexes formed only transiently on the cdc25C promoter in vitro (Fig. 8 ), an observation which would also account for our failure to detect protein binding by in vivo DMS or OP-Cu footprinting (Fig. 2 ). Transient Sp1/Sp3 binding may thus act to recruit and nucleate the assembly of preinitiation complexes at the cdc25C promoter through its association with TBP-associated factors (TAFs) or other cofactors, such as PC-4 (29 ,30 ), hTAFII55 (31 ) and hTAFII130 (32 ), the human homolog of dTAFII110 (33 ). Sp1/Sp3 binding may thus play a role in determining start site positions, as has been reported previously for several other GC-rich, TATA-less promoters (34 -37 ), but in none of these cases was a transient binding of Sp1/3 observed.
Interestingly, transient binding of the Sp1/Sp3 complexes is necessary in order to preserve cell cycle-regulated transcription. When either site in the cdc25C core promoter was converted to an element which stably binds Sp1, cell cycle-regulated repression in G0 cells was greatly reduced and when both sites were converted to canonical Sp1 sites repression was almost abolished (Fig. 8 ). Taken together, these findings point to a positive role for transient binding of Sp1 to non-canonical lower affinity sites downstream of the CDE-CHR co-repressor in supporting transcription from the cdc25C promoter and strongly suggest that the transient kinetics of this binding is a requirement for normal cell cycle regulation of this promoter. It is possible that stable Sp1/Sp3 interactions with the core promoter interfere with CDF-1 binding or the interaction of CDF-1 with its target proteins. Alternatively, the presence of high affinity Sp1 sites may change the mechanism of transcription initiation in a way that is no longer responsive to CDF-1-mediated repression. These questions cannot be clarified at present, but will be addressed once the mechanism of CDF-1-mediated repression has been unraveled. In this context it will also be of great interest to investigate whether the observed clustering of KMnO4 hypersensitive sites in the core promoter (26 ), which points to RNA polymerase pausing, is associated with cell cycle-regulated repression.
We are grateful to D.Eick for help with the KMnO4 footprinting, to M.Truss, M.Beato and K.Seifart for useful discussions, to G.Suske for antibodies against Sp1 and Sp3 and for recombinant Sp1, to B.Lüscher for recombinant YY-1, to R.Treisman for NIH 3T3 cells and to Dr M.Krause for synthesis of oligonucleotides. This work was supported by grants from the DFG (SFB397 and Mu601/9-2) and the BMBF. K.K. was the recipient of a fellowship from the Graduiertenkolleg `Zell- und Tumorbiologie'.
*To whom correspondence should be addressed. Tel: +49 6421 286236; Fax: +49 6421 288923; Email: mueller@imt.uni-marburg.de +Present address: Washington University School of Medicine, 660 South Euclid Avenue, St Louis, MO 63110-1093, USA
The authors wish it to be known that, in their opinion, the first three authors should be considered as joint First Authors
C. E. Grossman, Y. Qian, K. Banki, and A. Perl ZNF143 Mediates Basal and Tissue-specific Expression of Human Transaldolase
J. Biol. Chem.,
March 26, 2004;
279(13):
12190 - 12205.
[Abstract][Full Text][PDF]
S.-P. Wang, I. Krits, S. Bai, and B. S. Lee Regulation of Enhanced Vacuolar H+-ATPase Expression in Macrophages
J. Biol. Chem.,
March 8, 2002;
277(11):
8827 - 8834.
[Abstract][Full Text][PDF]
M. Um, J. Yamauchi, S. Kato, and J. L. Manley Heterozygous Disruption of the TATA-Binding Protein Gene in DT40 Cells Causes Reduced cdc25B Phosphatase Expression and Delayed Mitosis
Mol. Cell. Biol.,
April 1, 2001;
21(7):
2435 - 2448.
[Abstract][Full Text]
K. Korner and R. Muller In Vivo Structure of the Cell Cycle-regulated Human cdc25C Promoter
J. Biol. Chem.,
June 16, 2000;
275(25):
18676 - 18681.
[Abstract][Full Text][PDF]
K. Korner, V. Jerome, T. Schmidt, and R. Muller Cell Cycle Regulation of the Murine cdc25B Promoter. ESSENTIAL ROLE FOR NUCLEAR FACTOR-Y AND A PROXIMAL REPRESSOR ELEMENT
J. Biol. Chem.,
March 23, 2001;
276(13):
9662 - 9669.
[Abstract][Full Text][PDF]
CiteULike 
Connotea 
Del.icio.us What's this?
