A novel nucleic acid-binding protein that interacts with human Rad51 recombinase
A novel nucleic acid-binding protein that interacts with human Rad51 recombinaseOleg V. Kovalenko1, Efim I. Golub1, Patricia Bray-Ward1, David C. Ward1,2 and Charles M. Radding1,2,*
1Department of Genetics and 2Department of Molecular Biophysics and Biochemistry, Yale University School of Medicine, 333 Cedar Street, New Haven, CT 06510, USA
Received September 4, 1997;Revised and Accepted October 22, 1997
Using the yeast two-hybrid system, we isolated a cDNA encoding a novel human protein, named Pir51, that strongly interacts with human Rad51 recombinase. Analysis in vitro confirmed the interaction between Rad51 and Pir51. Pir51 mRNA is expressed in a number of human organs, most notably in testis, thymus, colon and small intestine. The Pir51 gene locus was mapped to chromosome 12p13.1-13.2 by fluorescence in situ hybridization. The Pir51 protein was expressed in Escherichia coli and purified to near homogeneity. Biochemical analysis shows that the Pir51 protein binds both single- and double-stranded DNA, and is capable of aggregating DNA. The protein also binds RNA. The Pir51 protein may represent a new member of the multiprotein complexes postulated to carry out homologous recombination and DNA repair in mammalian cells.
Eukaryotic Rad51 protein is a homolog of bacterial RecA recombinase, which plays a central role in homologous recombination by carrying out the pairing of homologous DNA molecules and initiating the strand exchange reaction (1 ,2 ). Both genetic and biochemical data suggest that Rad51 protein is intimately involved in a variety of recombination events in the eukaryotic cell. In Saccharomyces cerevisiae, the RAD51 gene belongs to the RAD52 epistasis group of genes, mutations in which show defects in genetic recombination and repair of double-strand breaks in mitosis and meiosis (3 ). Vertebrate Rad51 homologs are highly expressed in reproductive and lymphoid organs (4 -6 ). Nuclear foci of Rad51 protein are detected on synaptonemal complexes of mouse spermatocytes (7 ,8 ), in cultured human cells after DNA damage (7 ), in stimulated lymphocytes (9 ) and in primary murine B cells that undergo class switch recombination (10 ). The formation of a RecA-like nucleoprotein filament on single- and double-stranded DNA, DNA-dependent ATPase activity, homologous pairing and strand exchange reactions further support the premise that the Rad51 protein is a eukaryotic homolog of the RecA protein (11 -15 ).
Considering the biochemical complexity of recombination systems in eukaryotes, it is conceivable that the Rad51 protein would interact with other proteins. Most of the data on Rad51 interactions come from analysis in budding yeast. A number of genetic interactions among members of the RAD52 epistasis group have been established and some of these interactions were confirmed by use of the yeast two-hybrid system and biochemical analysis in vitro. In particular, yeast Rad51 protein was shown to interact with yeast Rad52, Rad54 and Rad55 proteins (16 -19 ). Recently, the Rad51-Rad52 and Rad51-Rad54 interaction of mammalian proteins was also demonstrated (20 ,21 ).
The fact that the mammalian Rad51 gene is essential for cell proliferation (22 ), whereas the RAD51 gene of baker's yeast is not, suggests the former's involvement in some very fundamental processes that might include replication and chromosome segregation, as well as DNA repair and recombination. Indeed, human Rad51 protein has been shown to interact in vitro and/or in vivo with the tumor suppressors p53 (23 ), BRCA1 (24 ) and BRCA2 (25 ) and a ubiquitin-conjugating enzyme Ubc9 (26 ). Clearly, further biochemical and genetic analysis of these and other Rad51 protein-protein interactions should greatly facilitate our understanding of the roles of Rad51 protein.
In this study, we present data on identification of a new protein that interacts with human Rad51 protein. The biochemical characterization of this novel protein, which we named Pir51, shows that it is capable of binding and aggregating DNA and binding RNA. The Pir51 protein might represent a novel member of a putative multiprotein recombination complex of mammalian cells.
The two-hybrid system analysis of HsRad51 protein interactions was carried out as described previously (26 ), using a Matchmaker two-hybrid cDNA library from HeLa S3 cells (Clontech). Two isolated clones that contained parts of Pir51 coding sequence were designated p13-3 and p23-10 (Fig. 1 ). To obtain the complete 5' sequence of Pir51 cDNA, PCR was carried out from the Matchmaker library, using primers EG280 (GAGATCCTAGAACTAGTGGATCC) and EG281 (CTTCACCAGGTGCAAAGTCTGG). Primer EG280 is complementary to the vector sequence just upstream of the cDNA insert, and EG281 is complementary to a region of coding strand of Pir51 cDNA located between nt 533 and 551 from the 5'-end of clone p23-10. PCR amplification yielded an ~700 bp fragment which was cloned in pCRII vector (Invitrogen) and then sequenced. An ATG codon was identified in this fragment that was located just 6 nt upstream of the 5'-end of the p23-10 clone.
Additional two-hybrid fusions of Pir51 protein with Gal4 DNA-binding and activation domains were made using vectors pGBT9 and pGAD GH, respectively, obtained from Clontech, as follows: to make plasmids pOK18 and pOK23 (Fig. 1 and Table 1 ), a fragment of Pir51 coding sequence was amplified by PCR from clone p23-10 using primers EG256 (CGAGGATCC GATGGCTTTAGATGACAAGCTC) and EG263 (CAGGAGATCTCCCAACCAAACATTCC). In both oligomers, homology with Pir51 nucleotide sequence is underlined. The PCR products were inserted into pGAD GH and pGBT9, respectively. To make plasmids pOK24 and pOK31, PCR was done from the Matchmaker library using primer EG287 (GTGGATCCACATATGGTGCGGCCTGTGAGACATAAG) and EG263 (see above), and the resulting fragment inserted into pGAD GH and pGBT9, respectively.
Two-hybrid interactions were quantitated in yeast reporter strain SFY526 (27 ), using o-nitrophenyl-[beta]-d-galactopyranoside as a substrate. The data presented in Table 1 are the average from experiments with at least three independent liquid cultures.
A human genomic DNA library in [lambda] phage DASH II (Stratagene) was used for isolation of a genomic clone of Pir51. The phages (~6 × 105 pfu) were plated on E.coli XL1-Blu MPA/2 (Stratagene) and plaques were transferred onto Hybond-N membrane (Amersham). The Pir51 cDNA insert from two-hybrid clone p23-10 was labeled with 32P by random priming and used as a probe. Four positive genomic clones (numbered 5.1, 6.3, 8.1 and 8.2) were isolated, and PCR analysis confirmed that the clones contain Pir51 sequences.
Clone 8.1 was labeled with digoxigenin-dUTP by nick translation and hybridized to normal human metaphase chromosomes together with an Alu repeat-specific oligonucleotide GM009 labeled with biotin (28 ). Hybridization, post-hybridization washes and detection were done as previously described (29 ). Digitized images were captured using a cooled CCD camera (Photometrics) attached to a Zeiss Axioskop fluorescence microscope. After pseudocoloring and merging, the position of the clone on chromosome 12 was determined initially from a few metaphase spreads that had both Alu banding and clone 8.1 signal. The band assignment was confirmed by FLpter (fractional length from pter) measurements (30 ). A pool of clones 5.1, 6.3, 8.1 and 8.2 were also mapped in a separate experiment, with the same result.
The DNA fragment encoding the 23.3 kDa segment of the 36.7 kDa Pir51 protein (Fig. 1 ) was amplified from the two-hybrid clone p23-10, using PCR with primers EG256 and EG263 (see above), that carry BamHI and BglII restriction sites, respectively. The fragment was inserted into pQE-31 expression vector (Qiagen), that had been digested with BamHI, producing plasmid pEG13. The plasmid was transformed into E.coli strain M15 carrying pREP4 plasmid (Qiagen). The bacteria were grown in LB medium containing 100 µg ampicillin/ml and 30 µg kanamycin/ml until OD600 = 0.6. The protein was induced by the addition of 1 mM IPTG for 3 h. Cell lysis and protein purification in denaturing conditions on Ni-NTA resin (Qiagen) were carried out following instructions from the manufacturer. The 6× His-tagged Pir51 protein was eluted from a Ni-NTA column in 0.1 M Na-phosphate buffer, 8 M urea, 250 mM imidazole, pH 6.0. Refolding of the protein was achieved by step-wise dialysis at 4°C against buffer of 50 mM Na-phosphate, pH 6.2, 400 mM NaCl, 5 mM [beta]-mercaptoethanol ([beta]-ME) containing 4 M and then 2 M urea, for 2 h with each buffer, and then overnight against the same buffer without urea and containing 250 mM NaCl and 5% glycerol. The dialyzed protein was diluted three times with 50 mM Na-phosphate, pH 6.2, and loaded onto a Mono-S 5/5 column (Pharmacia), pre-equilibrated with 50 mM Na-phosphate, pH 6.2, 50 mM NaCl, 1 mM [beta]-ME. The column was developed with a linear 0-1 M NaCl gradient. Pure Pir51 fractions from Mono-S were dialyzed against 20 mM Na-phosphate, pH 6.5, 150 mM NaCl, 2 mM [beta]-ME, 0.1 mM EDTA and 5% glycerol, and stored at 4°C.
Two-hybrid interactions of Rad51 and Pir51 proteins
Gal4 DBD plasmid
Gal4 AD plasmid
Gal4 DBD protein fusion
Gal4 AD protein fusion
Units of [beta]-galactosidase
pEG918
p13-3
HsRad51
Pir51
1.4 x 101
pEG918
p23-10
HsRad51
Pir51
2.6 x 101
pEG918
pOK18
HsRad51
Pir51
1.0 x 102
pEG918
pOK24
HsRad51
Pir51
2.3 x 101
pOK23
pEG960
Pir51
HsRad51
3.2 x 102
pOK31
pEG960
Pir51
HsRad51
2.0 x 102
pEG918
pEG960
HsRad51
HsRad51
2.0 x 101
pOK34
pEG960
Pir51*
HsRad51
<1
pOK23
pOK18
Pir51
Pir51
<0.5
pEG978
pOK18
ScRad51
Pir51
<0.5
pOK22
pOK18
HsDmc1
Pir51
<0.5
DBD and AD stand for DNA-binding and activation domain of Gal4, respectively. The Miller units of [beta]-galactosidase are the average values from experiments with at least three liquid cultures.
Pir51* stands for the alternatively spliced form of Pir51 with altered C-teminus (see Fig. 1 and text for details).
The DNA fragment encoding the 31.4 kDa form of Pir51 protein (Fig. 1 ) was amplified by PCR from p23-10 using primers EG287 and EG263. After digestion with NdeI and BglII, it was ligated into expression vector pRSET B (Invitrogen), resulting in plasmid pOK28. The protein was expressed from this plasmid using IPTG induction in E.coli strain FB810 (obtained from Dr S.West, Imperial Cancer Research Fund, UK) that harbors plasmid pREP4, in a way similar to induction of the 23.3 kDa fragment of Pir51. The cells were lysed by a combination of lysozyme and freezing/thawing treatments in buffer of 50 mM Tris-HCl, pH 7.7, 75 mM NaCl, 1 mM EDTA, 2 mM [beta]-ME, 1 mM PMSF. The lysate, cleared by centrifugation at 30 000 g for 30 min, was subjected to ammonium sulfate precipitation (40% saturation). The pellet was resuspended in and dialysed against the lysis buffer, and loaded on a column of DEAE-Sepharose CL-6B. Proteins eluted from DEAE-Sepharose by lysis buffer with 150 mM NaCl (without PMSF) were loaded on a Mono-Q column, which was developed with a linear 0-1 M NaCl gradient. Pir51 protein, which eluted at ~250 mM NaCl, was dialysed against 50 mM Na-phosphate, pH 7.4, 0.5 mM EDTA, 2 mM [beta]-ME and loaded on a Mono-S column. A linear 0-1 M NaCl gradient was applied, and Pir51 protein was eluted at ~350 mM NaCl. The final fractions were dialyzed against storage buffer of 20 mM Na-phosphate, pH 7.4, 150 mM NaCl, 0.1 mM EDTA, 2 mM [beta]-ME, 5% glycerol and stored at 4°C.
Human Rad51 protein was expressed in E.coli and purified as described earlier (15 ).
The protein binding reaction (20 µl) contained 20 mM Tris-HCl, pH 7.2, 25 mM NaCl, 2 mM MgCl2, 0.75 µM HsRad51 protein, 2.5 µM Pir51 protein (the 6× His-tagged 23.3 kDa fragment) and 50 µg BSA/ml. The control reaction contained no Pir51 protein. The proteins were incubated for 1 h at 22°C, after which a 2 µl aliquot was taken. Then, 5 µl of a 50% slurry of Ni-NTA beads equilibrated with reaction buffer plus 0.05% Tween-20 was added and incubation was continued for 15 min with occasional mixing. The reaction mixture was centrifuged at 800 g for 2 min, and 2.5 µl of supernatant was taken. The sedimented beads were washed five times with 200 µl of reaction buffer plus 0.05% Tween-20 and 50 mM imidazole, pH 8.0, and then proteins bound to the beads were eluted with 400 µl of the same buffer but with 300 mM imidazole. The presence of Rad51 protein in various fractions was analyzed by `dot-Western': the aliquots taken before addition of the beads and after incubation with the beads were diluted 50, 150, 450 and 1350 times in reaction buffer and 3 µl of each dilution spotted on nitrocellulose membrane (Biotrace NT, Gelman Sciences); similarly, 3 µl of 3-, 9-, 27- and 81-fold diluted eluate from the beads was spotted. Rad51 protein was detected by using polyclonal rabbit anti-Rad51 antibody and alkaline phosphatase-conjugated anti-rabbit IgG.
Binding of Pir51 protein to DNA was studied by a gel-mobility shift assay as follows. Reactions were carried out at 22°C in a binding buffer of 20 mM Tris-HCl, pH 7.2, 50 mM NaCl, 1 mM MgCl2 and 50 µg BSA/ml. Pir51 protein (either 23.3 or 31.4 kDa form) was pre-incubated for 5 min at various concentrations in reaction buffer, and then radiolabeled single-stranded oligonucleotide W16(-) (15 ) was added at a final concentration of 3 µM (in terms of nucleotides). Incubation was continued for 15 min at room temperature, after which the reaction mixture was analyzed on a 0.8% agarose gel run in 40 mM Tris-acetate, pH 7.4. The same conditions were used for the study of binding of Pir51 to 6.4 kb long linear and circular double-stranded M13 DNA. To make labeled linear M13 DNA, the circular DNA was cut with BamHI and radiolabeled with [[gamma]-32P]ATP using T4 polynucleotide kinase. To visualize circular M13 duplex DNA in the gel-shift assay, the agarose gels were dried and hybridized with radiolabeled W16(-) oligonucleotide, which is complementary to a region of M13 DNA, following the procedure by M.Mather (31 ).
For the DNA aggregation assay (32 ), 3.6 µM radiolabeled linear duplex M13 DNA was pre-incubated in the binding buffer for 15 min at 22°C with 1.2 µM Pir51 protein (31.4 kDa form) in 20 µl total reaction volume. Two 3 µl aliquots were taken (`pre-spin' fraction), and the rest of the reaction was spun down at 10 000 g in a microcentrifuge. Another two 3 µl aliquotes were taken (`supernatant' fraction), and 12 µl of 30% TCA was added to the remaining 8 µl of the reaction. After 15 min incubation on ice and 15 min centrifugation at 4°C, the TCA-soluble fraction was obtained. Two 7.5 µl aliquots of the TCA-soluble fraction, as well as the aliquots taken earlier, were Cherenkov counted. Counts obtained from TCA-soluble fractions were subtracted from values of the pre-spin and supernatant fractions. In parallel to this experiment, identical binding reactions were set up and analyzed directly on an agarose gel.
32P-labeled RNA, ~400 nt long, was produced by in vitro transcription from the T3 phage promotor of PvuII-linearized plasmid pRK100 as previously described (33 ). About 1/13 of the transcription product (1.5 µl) was used for one binding reaction. Binding reactions and analysis of their products were carried out as in the study of Pir51-DNA interaction.
A human multiple tissue Northern blot II (Clontech) was used to analyze Pir51 mRNA expression. The sequence of Pir51 insert in clone p23-10 was amplified by PCR. The resulting fragment was labeled with [[alpha]-32P]dCTP by random priming and used as the hybridization probe.
We used human Rad51 protein as a bait in a two-hybrid screen of a cDNA library prepared from human HeLa cells. Two positive clones with ~2 kb cDNA inserts, named p23-10 and p13-3, were recovered. The inserts contained sequences that would code for polypeptides of 282 and 299 aa, respectively, fused to the Gal4 part of the two-hybrid vector. The nucleotide sequences of the clones were identical for most of their length, with the exception of an in-frame insert of 150 nt present in p13-3 (Fig. 1 ). The use of PCR amplification (see Materials and Methods for details) allowed us to obtain additional sequence 5' to that present in these cDNA clones and which contained a putative ATG initiation codon. The sequence context of this ATG codon, namely GGGACCATGG, matches well to the Kozak consensus sequence, GCCACCATGG (34 ). The composite sequence of this Rad51-interacting clone is presented in Figure 2 . The longest open reading frame in this sequence encoded a protein of 335 aa that exhibited no significant homology to any currently known protein, and no well-defined structural motifs were apparent. Overall, the protein is quite hydrophilic, with lysine, arginine, glutamic and aspartic acid residues accounting for one-third of the amino acid composition. The predicted isoelectric point of the 335 aa protein is 9.95. We call this novel protein Pir51, for protein interacting with Rad51.
We expressed in E.coli and purified to near homogeneity two forms of Pir51 protein: (i) the 215 aa fragment (predicted Mr = 23.3 kDa) that starts from an internal ATG codon and lacks the 50 aa insert described above, and (ii) the 285 aa form (predicted Mr = 31.4 kDa) that starts from the 5'-most ATG codon, and also lacks the insert (Fig. 2 ). The first form, designated 6× His-Pir51, which contained a tag of six histidine residues on its N-terminus, was purified under denaturing conditions on Ni-NTA resin followed by renaturation of the protein (see Materials and Methods for details). The use of denaturing conditions reduced the amount of degradation products in the 6× His-Pir51 preparation. The second form of Pir51 was purified under native conditions by ion-exchange chromatography as described in Materials and Methods. The purification results are shown in Figure 4 . It is interesting that neither of the two forms migrates to the predicted position on SDS-PAGE gels. Instead, the 23.3 kDa form (plus 1.5 kDa tag) migrates as a polypeptide of ~33 kDa, and the 31.4 kDa form as a ~39 kDa protein. We note that both proteins are positively charged (predicted isoelectric points are 7.28 and 9.55, respectively), which may explain the observed migration differences.
The 6× His-tagged 23.3 kDa form of Pir51 was used to study the interaction with Rad51 in vitro. This form (but without the 6× His tag) shows the strongest interaction with Rad51 in the two-hybrid system (see above). In the binding experiment in vitro , 6× His-Pir51 was incubated with purified HsRad51 protein, then Ni-NTA beads that bind the 6× His tag were added, and Rad51 that remained associated with the beads after several washes was detected by using the dot-Western method (see Materials and Methods). In the control reaction, Pir51 protein was omitted. As shown in Figure 5 , there was a substantial retention of HsRad51 protein by the beads when Pir51 protein was present. In contrast, almost no Rad51 is detected on the beads without Pir51. This experiment shows that purified HsRad51 and Pir51 proteins interact in vitro.
The fact that Pir51 interacts with human Rad51 protein, which is a DNA-binding recombination enzyme, prompted us to examine whether Pir51 itself can bind DNA. A gel mobility shift assay was used for this purpose. First, two types of DNA substrates were utilized: (i) a single-stranded 83mer oligonucleotide, and (ii) linearized 6.4 kb double-stranded DNA of M13 phage. Indeed, we found that both 23.3 and 31.4 kDa forms of Pir51 protein bound both types of DNA in our assay (Figs 6 and 7 B). The binding to an oligonucleotide substrate was observed in a near-equimolar range of protein:nucleotide concentrations, whereas a lower protein:DNA ratio was sufficient to observe a gel mobility shift with long DNA. Moreover, at higher ratios of Pir51:DNA, a high-molecular weight protein-DNA complex was formed that barely moved into the 0.8% agarose gel used in the assay (Fig. 6 ). The binding of Pir51 to DNA, as detected by gel-shift assay, appears to be resistant to NaCl concentrations of up to at least 600 mM, and does not require Mg2+ ions (data not shown).
Using a gel mobility shift assay we have found that Pir51 protein (31.4 kDa form) binds to RNA (Fig. 8 ). The binding takes place under the same conditions as binding of Pir51 to DNA. At higher Pir51 concentration the Pir51-RNA complexes do not enter a 0.8% agarose gel and can be found only in the wells. Thus, Pir51 protein binds to both DNA and RNA, and at higher concentrations produces high molecular weight aggregates.
In this study, we identified a novel protein that interacts with human Rad51 recombinase, the Pir51 protein. Biochemical analysis shows that Pir51 is a DNA-binding protein that is capable of binding both single- and double-stranded DNA in a non-sequence specific manner and forming large protein-DNA complexes. The Pir51 protein also binds to RNA.
The best-characterized interactions of Rad51 protein are with the members of the yeast RAD52 epistasis group. It is presumed that proteins of this group may function together as a multiprotein complex in yeast cells, carrying out reactions of homologous recombination (17 ). The molecular interactions within the RAD52 group seem to be conserved in higher eukaryotes as well, since interactions of human Rad51 with human Rad52 and Rad54 proteins were also identified (20 ,21 ). Other interactions of mammalian Rad51 protein include those with the breast and ovarian cancer-associated proteins BRCA1 and BRCA2 (24 ,25 ). These data point to the possible existence of several types of Rad51-containing protein complexes that may be involved in various aspects of homologous recombination and DNA repair. It is unclear at the moment what type of complex(es) Pir51 protein is a part of. Further analysis should be done to see whether Pir51 can also interact with other members of the RAD52 epistasis group, in particular with human Rad52 and Rad54 proteins. Our current data show that Pir51 does not interact with a meiosis-specific Rad51 homolog, the Dmc1 protein, and yeast Rad51 (Table 1 ), or with the human ubiquitin-conjugating enzyme Ubc9 (data not shown), which interacts with Rad51 in the two-hybrid system (27 ).
The Pir51 protein might have a role in regulation of the biochemical activities of Rad51. The strand-exchange activities of human and yeast Rad51 protein can be modulated by a eukaryotic single-stranded DNA binding protein, RPA (13 ,35 ). The effect of RPA can be further attenuated by a heterodimer of yeast Rad55 and Rad57 proteins. In particular, Rad55-Rad57 complex can relieve the inhibitory effect of high RPA concentration on the yeast Rad51-mediated strand exchange (36 ). We may expect that Pir51 protein would affect some Rad51 reactions on DNA, especially taking into consideration the ability of the protein to bind and aggregate DNA. Similar properties are observed in many biologically interesting proteins. Some examples include RecA protein (32 ), yeast strand exchange protein 1 (37 ) and its stimulatory factor SF1 (38 ), yeast RPA (39 ), various yeast single-stranded DNA-binding proteins (40 ) and histone proteins (41 ). Aggregation of DNA can stimulate homologous pairing between single- and double-stranded DNA that can be followed by strand exchange (42 ).
When our manuscript wasin preparation, we learned about the study of Mizuta et al. (43 ), in which a mouse protein, called Rab22, was cloned by virtue of its interaction with human Rad51 protein in the two-hybrid system. Sequence comparison shows that Rab22 appears to be a mouse homolog of Pir51, with 63% identity and 67% similarity at the amino acid level shared by the two proteins. The Rab22 gene was mapped by Mizuta et al. on mouse chromosome 6 to a region that corresponds to locus 12p13 on the human chromosome, consistent with our localization of Pir51 gene.Like Pir51, Rab22 protein also interacted with Rad51 in vitro, and the C-terminal portion of Rab22 was sufficient for this interaction. The latter is consistent with our analysis of clone pOK27. Moreover, Rab22 and Rad51 proteins were shown by Mizuta et al. to co-localize in nuclear foci in hamster cells that were co-transfected with Rab22 and Rad51 expression constructs. Taken together, these data point to a functional importance of the interaction between Rad51 and Pir51-Rab22 proteins. Further work is required to ascertain the functional significance of the biochemical properties of Pir51 protein described here, and the role it plays by interacting with Rad51.
We thank Dr Ravi Gupta for purification of Rad51 protein and Zhufang Li for purification of M13 phage DNA. This study was supported by grants from National Institutes of Health to C.M.R. (5PO1 CA39238-09 and 5R37 GM33504-13) and D.C.W. (2 RO1 HG-00272).
4 Bezzubova, O., Shinohara, A., Mueller, R. G., Ogawa, H. and Buerstedde, J. (1993) Nucleic Acids Res., 21, 1577-1580.MEDLINE Abstract
5 Maeshima, K., Morimatsu, K., Shinohara, A. and Horii, T. (1995) Gene, 160, 195-200.MEDLINE Abstract
6 Yamamoto, A., Taki, T., Yagi, H., Habu, T., Yoshida, K., Yoshimura, Y., Yamamoto, K., Matsushiro, A., Nishimune, Y. and Morita, T. (1996) Mol. Gen. Genet., 251, 1-12.MEDLINE Abstract
7 Haaf, T., Golub, E. I., Reddy, G., Radding, C. M. and Ward, D. C. (1995) Proc. Natl. Acad. Sci. USA, 92, 2298-2302.MEDLINE Abstract
8 Plug, A. W., Xu, J., Reddy, G., Golub, E. I. and Ashley, T. (1996) Proc. Natl. Acad. Sci. USA, 93, 5920-5924.MEDLINE Abstract
9 Tashiro, S., Kotomura, N., Shinohara, A., Tanaka, K., Ueda, K. and Kamada, N. (1996) Oncogene, 12, 2165-2170.MEDLINE Abstract
10 Li, M. -J., Peakman, M. -C., Golub, E. I., Reddy, G., Ward, D. C., Radding, C. M. and Maizels, N. (1996) Proc. Natl. Acad. Sci. USA, 93, 10222-10227.MEDLINE Abstract
13 Benson, F. E., Stasiak, A. and West, S. C. (1994) EMBO J., 13, 5764-5771.MEDLINE Abstract
14 Baumann, P., Benson, F. and West, S. C. (1996) Cell, 87, 757-766.MEDLINE Abstract
15 Gupta, R., Bazemore, L. R., Golub, E. I. and Radding, C. M. (1997) Proc. Natl. Acad. Sci. USA, 94, 463-468.MEDLINE Abstract
16 Johnson, R. D. and Symington, L. S. (1994) Mol. Cell. Biol.,15,4843-4850.
17 Hays, S. L., Firmenich, A. A. and Berg, P. (1995) Proc. Natl. Acad. Sci. USA, 92, 6925-6929.MEDLINE Abstract
18 Jiang, H., Yie, Y., Houston, P., Stemke-Hale, K., Mortensen, U. H., Rothstein, R. and Kodadek, T. (1996) J. Biol. Chem., 271, 33181-33186.MEDLINE Abstract
19 Clever, B., Interthal, H., Schmuckli-Maurer, J., King, J., Sigrist, M. and Heyer, W.D. (1997) EMBO J., 16, 2535-2544.MEDLINE Abstract
20 Shen, Z., Cloud, K. G., Chen, D. J. and Park, M. S. (1996) J. Biol. Chem., 271, 148-152.MEDLINE Abstract
21 Golub, E. I., Kovalenko, O. V., Gupta, R. C., Ward, D. C. and Radding, C. M. (1997) Nucleic Acids Res., 25, 4106-4110MEDLINE Abstract
22 Tsuzuki, T., Fujii, Y., Sakumi, K., Tominaga, Y., Nakao, K., Sekiguchi, M., Matsushiro, A., Yoshimura, Y. and Morita, T. (1996) Proc. Natl. Acad. Sci. USA, 93, 6236-6240.MEDLINE Abstract
23 Sturzbecher, H.-W., Donzelmann, B., Henning, W., Knippschild, U. and Buchop, S. (1996) EMBO J., 15, 1992-2002.MEDLINE Abstract
24 Scully, R., Chen, J., Plug, A., Xiao, Y., Weaver, D., Feunteun, J., Ashley, T. and Livingston, D. M. (1997) Cell, 88, 265-275.MEDLINE Abstract
25 Sharan, S. K., Morimatsu, M., Albrecht, U., Lim, D.-S., Regel, E., Dinh, C., Sands, A., Eichele, G., Hasty, P. and Bradley, A. (1997) Nature, 386, 804-810.MEDLINE Abstract
26 Kovalenko, O. V., Plug, A. W., Haaf, T., Gonda, D. K., Ashley, T., Ward, D. C., Radding, C. M. and Golub, E. I. (I996) Proc. Natl. Acad. Sci., USA93, 2958-2963.
27 Bartel, P., Chien, C.T., Sternglanz, R. and Fields, S. (1993) BioTechniques, 14, 920-924.MEDLINE Abstract
28 Matera, A. G. and Ward, D. C. (1992) Hum. Mol. Genet., 1, 535-539.MEDLINE Abstract
29 Lichter, P., Chieh-Ju, C. T., Call, K., Hermanson, G., Evans, G. A., Housman, D. and Ward, D. C. (1990) Science, 247, 64-69.MEDLINE Abstract
30 Bray-Ward, P., Menninger, J., Lieman, J., Desai, T., Mokady, N., Banks, A. and Ward, D. C. (1996) Genomics, 32, 1-14.MEDLINE Abstract
37 Johnson, A. W. and Kolodner, R. D. (1994) J. Biol. Chem., 269, 3664-3672.MEDLINE Abstract
38 Norris, D. and Kolodner, R. D. (1990) Biochemistry, 29, 7903-7910.MEDLINE Abstract
39 Alani, E., Thresher, R., Griffith, J. D. and Kolodner, R. D. (1992) J. Mol. Biol., 227, 54-71.MEDLINE Abstract
40 Hamatake, R. K., Dykstra, C. C. and Sugino, A. (1989) J. Biol. Chem., 264, 13336-13342.MEDLINE Abstract
41 De Bernardin, W., Losa, R. and Koller, T. (1986) J. Mol. Biol., 189, 503-517.MEDLINE Abstract
42 Gonda, D. K. and Radding, C. M. (1986) J. Biol. Chem., 261, 13087-13096.MEDLINE Abstract
43 Mizuta, R., LaSalle, J. M., Cheng, H.-L., Shinohara, A., Ogawa, H., Copeland, N., Jenkins, N. A., Lalande, M. and Alt, F.W. (1997) Proc. Natl. Acad. Sci. USA, 94, 6927-6932.MEDLINE Abstract
O. S. Gildemeister, J. M. Sage, and K. L. Knight Cellular Redistribution of Rad51 in Response to DNA Damage: NOVEL ROLE FOR Rad51C
J. Biol. Chem.,
November 13, 2009;
284(46):
31945 - 31952.
[Abstract][Full Text][PDF]
M. Takaku, S. Machida, N. Hosoya, S. Nakayama, Y. Takizawa, I. Sakane, T. Shibata, K. Miyagawa, and H. Kurumizaka Recombination Activator Function of the Novel RAD51- and RAD51B-binding Protein, Human EVL
J. Biol. Chem.,
May 22, 2009;
284(21):
14326 - 14336.
[Abstract][Full Text][PDF]
K. Obama, S. Satoh, R. Hamamoto, Y. Sakai, Y. Nakamura, and Y. Furukawa Enhanced Expression of RAD51 Associating Protein-1 Is Involved in the Growth of Intrahepatic Cholangiocarcinoma Cells
Clin. Cancer Res.,
March 1, 2008;
14(5):
1333 - 1339.
[Abstract][Full Text][PDF]
O. V. Kovalenko, C. Wiese, and D. Schild RAD51AP2, a novel vertebrate- and meiotic-specific protein, shares a conserved RAD51-interacting C-terminal domain with RAD51AP1/PIR51
Nucleic Acids Res.,
October 6, 2006;
(2006)
gkl665v3.
[Abstract][Full Text][PDF]
K. Iwabata, A. Koshiyama, T. Yamaguchi, H. Sugawara, F. N. Hamada, S. H. Namekawa, S. Ishii, T. Ishizaki, H. Chiku, T. Nara, et al. DNA topoisomerase II interacts with Lim15/Dmc1 in meiosis
Nucleic Acids Res.,
October 12, 2005;
33(18):
5809 - 5818.
[Abstract][Full Text][PDF]
M. Tarsounas, T. Morita, R. E. Pearlman, and P. B. Moens Rad51 and Dmc1 Form Mixed Complexes Associated with Mouse Meiotic Chromosome Cores and Synaptonemal Complexes
J. Cell Biol.,
October 18, 1999;
147(2):
207 - 220.
[Abstract][Full Text][PDF]
K. Komori, T. Miyata, H. Daiyasu, H. Toh, H. Shinagawa, and a. Y. Ishino Domain Analysis of an Archaeal RadA Protein for the Strand Exchange Activity
J. Biol. Chem.,
October 20, 2000;
275(43):
33791 - 33797.
[Abstract][Full Text][PDF]
CiteULike 
Connotea 
Del.icio.us What's this?
