ABSTRACT
Two types of enzyme utilizing light from the blue and near-UV spectral range (320
-
520 nm) are known to have related primary structures: DNA photolyase, which repairs UV-induced DNA damage in a light-dependent manner, and the blue light photoreceptor of plants, which
mediates light-dependent regulation of seedling development. Cyclobutane pyrimidine
dimers (CPDs) and pyrimidine (6
-
4) pyrimidone photoproducts [(6-4)photoproducts] are the two major photoproducts produced in DNA by UV
irradiation. Two types of photolyases have been identified, one specific for
CPDs (CPD photolyase) and another specific for (6-4)photoproducts [(6-4)photolyase]. (6-4)Photolyase activity was first found in
Drosophila melanogaster
and to date this gene has been cloned only from this organism. The deduced
amino acid sequence of the cloned gene shows that (6-4)photolyase is a member of the CPD photolyase/blue light photoreceptor
family. Both CPD photolyase and blue light photoreceptor are flavoproteins and
bound flavin adenine dinucleotides (FADs) are essential for their catalytic
activity. Here we report isolation of a
Xenopus laevis
(6-4)photolyase gene and show that the (6-4)photolyase binds non- covalently to stoichiometric amounts of FAD. This is the first indication of FAD as the chromophore of (6-4)photolyase.
Light is essential for life on Earth and organisms have evolved various method
for efficient utilization of light energy. Within the spectrum of sunlight,
near-UV/blue light (320-520 nm) is utilized very efficiently and elegantly by two related systems. (i) In
contrast to the many beneficial effects of solar light, the UV component is harmful to
living cells, producing cytotoxic, mutagenic and carcinogenic lesions in DNA (
1
-
3
). This DNA damage can be repaired by near-UV/blue light by the DNA repair enzyme DNA photolyase (
4
,
5
). (ii) Numerous environmental factors influence plant development. Of these,
light has an especially important role as a stimulus for many developmental
processes. Blue light markedly affects growth and development of higher plants,
including such phenomena as phototropism, chloroplast rearrangement, stomatal opening and inhibition of hypocotyl elongation. These responses are
mediated by a blue light photoreceptor, cryptochrome (
6
).
The phenomenon of photoreactivation, the reduction of the lethal and mutagenic
effects of UV radiation by simultaneous or subsequent irradiation with near-UV/blue light, has been identified in a variety of organisms. The enzyme responsible, CPD photolyase, binds
to UV-damaged DNA and on absorption of a near-UV/blue light photon splits the cyclobutane ring, restoring the bases to their native form (
7
). In this reaction, the near-UV/blue light photon is used to excite FADH- and flavin in the excited state then donates an electron to the CPD and thus
FAD is essential for the reaction. The CPD photolyase gene has been isolated
from 13 organisms and, on the basis of deduced amino acid sequence
similarities, the genes have been grouped into two classes: Class I and Class
II (
8
,
9
).
Light-dependent plant development, a complex process called photomorphogenesis,
is controlled by the combined action of several photoreceptor systems (
10
). In higher plants there are at least three different families of photoreceptors: the red/far-red light receptor (phytochromes), the blue light receptor (cryptochrome; CRY) and a receptor for UV light. Although the best-studied signaling pathway in plants involves phytochrome,
considerable research has been carried out in the past decade to characterize
blue light perception and the signal transduction pathway (
6
). Recently, the first blue light photoreceptor in plants was characterized at
the molecular level (
11
). This protein (CRY1) shows close homology to Class I CPD photolyase, although
it exhibits no photolyase activity. CRY1 also binds FAD (
12
), suggesting that CRY1 mediates a light-dependent redox reaction similar to CPD photolyase.
Recently, we discovered another type of photolyase in
Drosophila melanogaster
that catalyzes the light-dependent repair of (6-4)photoproducts instead of CPDs and named this molecule (6-4)photolyase (
13
). Subsequently, the same enzymatic activity was identified in
Xenopus laevis
,
Crotalus atrox
(
14
) and
Arabidopsis thaliana
(
15
). It was previously thought that photoenzymatic reversal of (6-4)photoproducts was very unlikely for the following reasons. The formation of (6-4)photoproducts involves the transfer of the group at the C-4 position (-NH or -OH) of the 3' base of the dinucleotide to the C-5 position of the 5' base concomitant with the
formation of a sigma bond between the C-6 of the 5' base and the C-4 of the 3' base. Even if an enzyme breaks the sigma bond joining
the two adjacent pyrimidines, the bases would not be restored to their original
forms. Thus, the mechanism of photoreactivation of (6-4)photoproduct is different from that of CPD (
16
). The gene encoding (6-4)photolyase was cloned from
Drosophila
(
17
). Unexpectedly, the deduced amino acid sequence of (6-4)photolyase was found to be similar to the Class I CPD photolyase and
CRY1. Thus we call these proteins the DNA photolyase/blue light photoreceptor family. Based on the amino acid sequence similarity, we set out to clone the
Xenopus
(6-4)photolyase cDNA by polymerase chain reaction (PCR). Here, we describe
the isolation and characterization of a cDNA encoding (6-4)photolyase from
X.laevis
. We show that (6-4)photolyase binds FAD similarly to other member of the DNA
photolyase/blue light photoreceptor family, although CPD and (6-4)photolyase operate by different mechanisms.
Isolated ovaries were homogenized in 1 ml buffer containing 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 5 mM dithiothreitol (DTT) and 0.5 mM phenylmethylsulfonyl fluoride (PMSF). To the homogenate was added 1 ml ice-cold solution containing 10 mM Tris-HCl, pH 8.0, 5 mM DTT, 25% sucrose and 50% glycerol. After
mixing gently, 160 [mu]l 5 M NaCl was added, mixed for 20 min at 4oC and then centrifuged at 15 000
g
for 20 min at 4oC. The supernatant was used as crude extract. Aliquots of 2 [mu]g crude extract were used for gel shift assays as described previously
(
13
,
18
).
Unless otherwise noted, all DNA and RNA manipulations were carried out using
standard techniques (
19
).
To prepare the probe for hybridization, PCR was carried out with
Xenopus
ovary cDNA and degenerate oligonucleotides (64PRN1, 5'-T[A/G/C/ T]GC[A/G/C/T]TGG[A/C]G[A/G/C/T]GA[A/G]TT[T/C]-TA-3'; 64PRC1, 5'-CC[T/C]TC[T/C]TCCCA[A/G/C/T][G/C][A/T][A/G/T]ATCCA-3'; 64PRC2, 5'-TG[A/G/C/T]C[G/T]GGC[A/G/C/ T]AG[A/G]TG[A/G]TG[A/G/C/T]ATCCA-3') based on regions conserved between CPD photolyase and (6-4)photolyase (
17
). Two rounds of PCR were carried out. The first round was carried out with
primers 64PRN1 and 64PRC1 and aliquots of the first round PCR product were used
for the second round of PCR with primers 64PRN1 and 64PRC2. A 160 bp amplified
product was sequenced and found to be related to
Drosophila
(6-4)photolyase and this was used to screen a
Xenopus
oocyte cDNA library (Clontech). Four positive clones were isolated, the longest
of which was recloned into pUC19 and sequenced on both strands by the standard
dideoxy chain termination method (
19
).
Plasmid pGEX-Xl64PR was constructed by inserting the coding sequence of
Xenopus
(6-4)photolyase cDNA into
Bam
HI/
Eco
RI-digested pGEX-4T-2 (Pharmacia) and used for transformation of
Escherichia coli
SY2(
uvrA-
,
recA-
,
phr-
) (
20
). Transformed cells were grown at 26oC in 3 l LB medium containing 150 mg/l ampicilin (
19
) until an A
600 of 0.9-1.0 was reached. Expression was induced by addition of 0.1 mM isopropyl [beta]-D-thiogalactopyranoside (IPTG) and growth was continued at 26oC for 9 h. Cells were harvested by centrifugation
and resuspended in 50 ml phosphate-buffered saline (PBS). Cell extract was prepared by sonication of the cell suspension, followed by centrifugation at 15 000
g
for 60 min at 4oC. The supernatant (Fraction I) was applied to a glutathione-Sepharose column (10 ml). Purification using glutathione-Sepharose and removal of glutathione S-transferase (GST) by cleavage with thrombin were
performed according to the manufacture's instructions (Pharmacia). The eluate
from the glutathione-Sepharose column (Fraction II) was treated with thrombin and the thrombin-cleaved sample (Fraction III) was applied to a UV-irradiated DNA affinity column equilibrated with 50 mM
phosphate buffer, pH 7.5, containing 50 mM KCl. After washing with 15 ml
equilibration buffer, bound protein was eluted with 15 ml elution buffer (50 mM phosphate buffer containing 2 M KCl). The eluted sample was concentrated using Centriprep 50 (Amicon) and elution buffer was replaced with equilibration buffer. Finally, 1 ml
protein solution was obtained (Fraction IV). Starting from 3 l
E.coli
culture, 700 mg cell extract (Fraction I), 5 mg protein eluate from glutathione-Sepharose (Fraction II) and 1.4 mg UV-irradiated DNA affinity column purified protein (Fraction IV) were
recovered. The concentration of protein was determined with a Bradford assay kit (BioRad). The UV-irradiated DNA affinity column was prepared as described previously (
21
). Photoreactivation treatment and ELISA were carried out as described
previously (
13
,
17
). For ELISA and for the repair assay using a (6-4)photoproduct-containing oligonucleotide, 0.1 and 1 [mu]g Fraction III were used respectively.
The deoxyoligonucleotide 28mer substrate [d(CCCGAACAGACAGT[6-4]TAACCACGCAAACG)] containing a (6-4)photoproduct at the central TT site was constructed by ligation
of a (6-4)photoproduct-containing 8mer [d(CAGT[6-4]TAAC)] with a 10mer [d(CCCGAACAGA) and d(CACGCAAACG] after annealing with a 32mer [d(TTCGTTTGCGTGGTTAACTGTCTGTTCGGGTT)] using
the procedure described previously (
22
). Resultant duplex DNA was purified by gel electrophoresis and labelled with [[gamma]-32P]ATP (3000 Ci/m mol) and T4 polynucleotide kinase. The labelled DNA (5 * 104 c.p.m.) was mixed with purified
Xenopus
recombinant protein (1 [mu]g Fraction III) and exposed to fluorescent lamps for 30 min. After
irradiation the DNA was then extracted with phenol/chroloform and precipitated with ethanol. The DNA was digested with
Hpa
I (10 U) and separated on 10% polyacrylamide sequencing gels.
Recombinant
Xenopus
(6-4)photolyase purified with a UV-irradiated DNA affinity column (Fraction IV) was denatured at pH
3.0 by heating at 65oC for 10 min. The released chromophore was recovered by filtering out the
denatured protein using Microcon 30 followed by Microcon 3 (Amicon).
Escherichia coli
photolyase apoenzyme was prepared as described previously (
23
). Reconstitution of enzymatic activity with either authentic FAD or chromophore isolated from
Xenopus
(6-4)photolyase was conducted by incubating the apoenzyme (400 [mu]M) with the indicated chromophore (40 [mu]M) at 10oC for 24 h (
24
). The concentration of chromophore was based on the absorbance at 450 nm ([epsilon]
450 = 1.12 * 104 M-1 cm-1).
The oligo(dT)
20 substrate containing CPDs was prepared by acetone-photosensitized irradiation under a cold nitrogen atmosphere. Since CPD has no absorption at 265 nm, the increase in absorbance at 265
nm was used to estimate CPD repair (
25
). For the photoreactivation assay, enzyme (4 [mu]M) was mixed with substrate (30 [mu]M) in 200 [mu]l buffer containing 50 mM Tris-HCl, pH 7.4, 50 mM NaCl, 1 mM EDTA, 5 mM DTT and 10% glycerol. The reaction mixture was placed in a cuvette,
deoxygenated under a gentle stream of cold nitrogen and exposed to filtered camera flashes
(340 nm cut-off filter) prior to irradiation with photoreactivating light (350-450 nm) at 10oC.
Previously we have shown that in
Drosophila
DNA photolyase genes are expressed at a very high level in the ovary and its
translated products are stored in eggs (
9
,
17
). This suggests that ovary is a good candidate for testing (6-4)photolyase activity to screen mRNA in
X.laevis
. We tested binding activity specific for (6-4)photoproduct in cell extracts from
Xenopus
ovaries using the same gel shift assay as reported previously (
17
). We detected a factor which binds specifically to (6-4)photoproduct in
Xenopus
ovary cell extracts (Fig.
1
). To generate a probe to screen a
Xenopus
cDNA library, we used PCR with primers based on regions conserved between the
DNA photolyase/blue light photoreceptor family (see Materials and Methods). A
160 bp DNA fragment amplified from cDNA prepared from
Xenopus
ovaries was used as a probe to screen a
Xenopus
oocyte cDNA library and we identified a 2.5 kb cDNA clone. Sequencing of the
cDNA clone revealed the presence of a single long open reading frame capable of
encoding a protein of 526 amino acids, corresponding to a predicted molecular
mass of 60.6 kDa. The sequence of the cDNA predicted a protein that showed 58-54% amino acid identity to
Drosophila
(6-4)photolyase and its human homologue and 20-24% identity to the class I CPD photolyase and the blue light
photoreceptor over the entire protein (data not shown). Thus the cloned cDNA is
a member of the DNA photolyase/blue light photoreceptor family.
To verify that the isolated cDNA clone encodes (6-4)photolyase, we measured enzymatic activity of the recombinant protein
expressed in
E.coli
. The cDNA was inserted into a prokaryotic expression vector designed to produce
a GST fusion protein and named pGEX-Xl64PR.
Escherichia coli
does not photoreactivate (6-4)photoproduct and thus would show increased resistance to UV light on
expression of (6-4)photolyase in the presence of photoreactivating light. As expected, the
plasmid pGEX-Xl64PR conferred light-dependent UV resistance on
recA
-
uvrA
-
phr
+
E.coli
(Fig.
2
A). The recombinant protein was purified from
E.coli
cell extract as a single 60 kDa band on SDS-PAGE (Fig.
2
B). Its absorption spectrum indicated that the purified protein eluted from the UV-irradiated DNA affinity column did not contain a second chromophore and possessed fully oxidized FAD (see below). Thus, the thrombin-cleaved glutathione-Sepharose eluate (Fraction III) was used for determination of (6-4)photolyase activity. Enzyme-linked immunosorbent assay (ELISA) showed that
the purified recombinant protein eliminated (6-4)photoproduct from UV-irradiated DNA in a light-dependent manner, although it had no effect on CPDs (Fig.
2
C). Furthermore, the recombinant protein repaired (6-4)photoproduct, as shown in Figure
2
D. A 32 bp DNA containing a (6-4)photoproduct at a TT sequence in the
Hpa
I site (5'-TTAA-3') was resistant to digestion with
Hpa
I, whereas it became
Hpa
I-sensitive after photoreactivation with the purified recombinant protein.
Together these results show that the cDNA clone in pGEX-Xl64PR encodes the (6-4)photolyase.
Purified
Xenopus
(6-4)photolyase was a yellow colour and had an absorption spectrum
resembling those of many flavoproteins (Fig.
3
). The chromophore was released by heat or acid treatment of
Xenopus
(6-4)photolyase, indicating that it was non-covalently bound to the enzyme. The absorption spectrum of the free
chromophore was identical to that of fully oxidized flavin adenine dinucleotide
(FAD) (Fig.
3
). The identity of the chromophore as FAD was also suggested by thin layer
chromatography and an increase in fluorescence intensity on acidification (data not shown). To determine that this chromophore was indeed FAD, we reconstituted
E.coli
CPD photolyase activity from its apoenzyme and the chromophore isolated from
Xenopus
(6-4)photolyase.
Escherichia coli
CPD photolyase requires bound FAD as a catalytic cofactor. The holoenzyme (FAD-bound
E.coli
photolyase) showed high affinity for CPDs (Fig.
4
A, lane 5) and repaired them in a light-dependent manner, although the apoenzyme had no affinity for CPDs (Fig.
4
A, lane 2) and no photocatalytic activity (Fig.
4
B) (
23
). When the apoenzyme was mixed with the chromophore isolated from
Xenopus
(6-4)photolyase, the resulting reconstituted photolyase restored both binding (Fig.
4
A, lane 3) and photocatalytic activity (Fig.
4
B). The molar ratio of FAD released from
Xenopus
(6-4)photolyase relative to its apoprotein was 0.95 as calculated from the
coefficients of the apoprotein ([epsilon]
280 = 1.30 * 105 M-1cm-1). The excitation coefficient for the
Xenopus
(6-4)photolyase apoprotein was calculated using the number of tryptophan
(18; [epsilon]
280 = 5800 M-1cm-1) and tyrosine (18; [epsilon]
280 = 1405 M-1cm-1) residues determined from the DNA sequence of the
Xenopus
(6-4)photolyase gene. Together, these results show that
Xenopus
(6-4)photolyase binds FAD.
CPDs and (6-4)photoproducts are the two major classes of cytotoxic, mutagenic and
carcinogenic photoproducts produced in DNA when cells are irradiated with UV
light (
2
,
3
,
5
). These lesions are repaired by the nucleotide excision repair pathway, although CPDs are repaired less efficiently than (6-4)photoproduct. CPDs are most efficiently repaired by DNA photolyase (
4
). It has long been believed that CPDs are the only substrate for DNA
photolyase. As a consequence, it has become common practice to expose UV-irradiated cells to photoreactivating light (350-450 nm) to study the effects of (6-4)photoproduct. Any residual mutagenic or cytotoxic effects remaining following photoreactivation
are ascribed to (6-4)photoproduct (
3
). In contrast to the general belief that CPDs are the only substrate for
photolyase, we discovered a new type of photolyase in
D.melanogaster
which catalyzed light-dependent repair of (6-4)photoproduct [(6-4)photolyase] (
13
). In this paper we have identified the
Xenopus
(6-4)photolyase gene. This is the first molecular description of a (6-4)photolyase gene in a vertebrate. An enzymatic activity of (6-4)photolyase has also been detected in the rattlesnake and
a higher plant (
14
,
15
), indicating that (6-4)photolyase might be widely distributed among present organisms. Thus, interpretations of the effects of
photoreactivation on UV-irradiated cells reported previously should be reconsidered. In frog cells
(ICR 2A) (6-4)photoproduct was removed rapidly from DNA of UV-irradiated cells following photoreactivation (
26
). This might show photoreactivation of (6-4)photoproduct in ICR 2A cells, although it was interpreted that the
removal of CPDs following photoreactivation led to an increase in the
capability for excision of (6-4)photoproduct (
26
).
This work was supported by a Grant-in-Aid for Scientific Research on Priority Areas and Scientific
Research (C) from the Ministry of Education, Sciences, Sports and Culture of
Japan (nos 08280101, 08255230 and 08836005).
*To whom correspondence should be addressed. Tel: +81 75 753 7554; Fax: +81 75
753 7564; Email: todo@house.rbc.kyoto-u.ac.jp
REFERENCES
Return