Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (237K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (83)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Ladomery, M.
Right arrow Articles by Sommerville, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ladomery, M.
Right arrow Articles by Sommerville, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 1995 Oxford University Press 965-973

Footnote

Xp54, the Xenopus homologue of human RNA helicase p54, is an integral component of stored mRNP particles in oocytes

Xp54, the Xenopus homologue of human RNA helicase p54, is an integral component of stored mRNP particles in oocytes Michael Ladomery + , Eleanor Wade and John Sommerville*

School of Biological and Medical Sciences, Bute Buildings, University of St Andrews, St Andrews , Fife KY16 9TS, UK

Received December 2, 1996; Revised and Accepted January 20, 1997 DDBJ/EMBL/GenBank accession nos X92421, X94243

ABSTRACT

In investigating the composition of stored (maternal) mRNP particles in Xenopus oocytes, attention has focussed primarily on the phosphoproteins pp60/56, which are Y-box proteins involved in a general packaging of mRNA. We now identify a third, abundant, integral component of stored mRNP particles, Xp54, which belongs to the family of DEAD-box RNA helicases. Xp54 was first detected by its ability to photocrosslink ATP. Subsequent sequence analysis identifies Xp54 as a member of a helicase subfamily which includes: human p54, encoded at a chromosomal breakpoint in the B-cell lymphoma cell line, RC-K8; Drosophila ME31B, encoded by a maternally-expressed gene, and Saccharomyces pombe Ste13, cloned by complementation of the sterility mutant ste13 . Expression studies reveal that the gene encoding Xp54 is transcribed maximally at early oogenesis: no transcripts are detected in adult tissues, other than ovary. Using a monospecific antibody raised against native Xp54, its presence in mRNP particles is confirmed by immunoblotting fractions bound to oligo(dT)-cellulose and separated by rate sedimentation and buoyant density. On isolating Xp54 from mRNP particles, it is shown to possess an ATP-dependent RNA helicase activity. Possible functions of Xp54 are discussed in relation to the assembly and utilization of mRNP particles.

INTRODUCTION

For many years, it has been apparent that pools of non-translating, non-polysomal or `free' mRNP particles exist in the cytoplasm of eukaryotic cells, being particularly prominent in the oocytes of many organisms, including Xenopus ( 1 ). Oogenesis in Xenopus occurs over several months, during which time each oocyte accumulates a vast pool of ~10 12 ribosomes and 2 * 10 11 stored mRNP complexes, eventually brought together for translation at oocyte maturation, fertilization and early embryogenesis ( 2 ). During the rapid cell divisions which follow fertilization, transcription is severely limited ( 3 ), and only after the mid-blastula transition is zygotic transcription initiated ( 4 ). Thus, the embryo relies on the pool of stored, maternal mRNP to drive the early stages of its development.

The mRNP particles isolated from Xenopus oocytes contain a set of at least four abundant proteins with apparent molecular masses on SDS-PAGE in the range of 50-60 kDa ( 5 ). The two proteins of largest apparent mass, pp60/mRNP4 and pp56/mRNP3, have been characterized as `masking' proteins, because they are tightly bound to mRNA ( 6 ), and are able to repress translation in vitro ( 7 ), an activity regulated via their phosphorylation by an mRNP-associated protein kinase ( 8 , 9 ). More recently, the masking proteins have been identified as belonging to the family of Y-box proteins ( 10 - 12 ), a family with dual roles in transcription regulation and mRNA packaging ( 13 ). However, the other abundant mRNP proteins have remained unidentified.

In this report we describe a 54 kDa protein, which is an abundant component of mRNP particles. It turns out to belong to the family of DEAD-box RNA helicases, proteins which can regulate RNA secondary structure in translation initiation, splicing and ribosome biogenesis ( 14 , 15 ). DEAD-box proteins contain a set of conserved motifs necessary for RNA helicase activity, including the NTPase `A' (AXXGXXGKT) and `B' (DEAD) motifs, involved in ATP binding and hydrolysis. Within this increasingly large group of proteins, there are distinct subfamilies. Xenopus Xp54 belongs to a subfamily which includes: human p54, found at a chromosomal breakpoint in the cell line RC-K8, derived from a diffuse large B-cell lymphoma ( 16 ) and now described as a putative proto-oncogene ( 17 ); a mouse equivalent ( 18 ); Drosophila ME31B, maternally-expressed in oocytes and nurse cells ( 19 ); Schizosaccharomyces pombe Ste13 cloned by functional complementation of the sterility mutant ste13 ( 20 ) and Saccharomyces cerevisiae DHH1 ( 21 ). We describe the structure of Xp54, its developmental expression, and its presence and activity in mRNP particles. With reference to what is known about its putative homologues p54, ME31B and Ste13, we suggest possible functions for Xp54.

MATERIALS AND METHODS

Cells and tissues

Oocyte stages of Xenopus laevis are listed according to Dumont ( 22 ), and developmental stages according to Nieuwkoop and Faber ( 23 ). XTC cells were cultured as described previously ( 24 ).

cDNA cloning

Ovary containing only previtellogenic (stage I) oocytes was dissected from an immature female X.laevis . cDNA was synthesized from poly(A) + RNA extracted from glycerol gradient fractions enriched for polysomes ( 9 ). Double-stranded cDNA was cloned directionally into the bacteriophage [lambda] expression vector Uni-ZapXR (Stratagene). Two libraries of 0.8 * 10 5 clones (XlaIp1) and 3.7 * 10 5 clones (XlaIp2) were constructed and each was amplified to give 10 9 p.f.u./ml. For screening purposes equal volumes from each library were mixed.

Isolation of mRNP particles, proteins and peptides

Poly(A) + RNP particles were isolated from clarified homogenates of previtellogenic ovary by affinity chromatography using oligo(dT)- cellulose (Pharmacia) as described previously ( 25 ). Binding was performed in a solution containing: 0.3 M KCl; 2 mM MgCl 2 ; 2 mM dithiothreitol; 0.5% Nonidet P-40; 10 mM Tris-HCl, pH 7.5. After extensive washing with binding buffer, mRNP particles were eluted in 5 mM Tris-HCl pH 7.5.

Differential elution of proteins could be achieved by increasing the salt concentation in the binding buffer. Whereas the mRNA-masking proteins, pp60 (also known as FRGY2a) and pp56 (FRGY2b) remain stably bound to the column in the presence of 2 M NaCl, other mRNP-associated proteins could be eluted over the range of 0.4-1 M NaCl.

Proteins were also separated into two classes on the basis of thermostability. On heating the isolated poly(A) + RNA fraction to 80oC for 10 min, followed by cooling to 0oC and centrifugation at 13 000 r.p.m. for 5 min in a microcentrifuge, the two masking proteins, pp56/60, remain in the supernatant, whereas the other proteins can be recovered from the pellet ( 26 ). Pellet fractions were raised in 80% formic acid and cyanogen bromide was added in the ratio 2 mg CNBr/1 mg of protein. The reaction proceeded at room temperature for 20 h in the dark. Polypeptide fragments were resolved by SDS-PAGE on 20% gels. Conditions for fragmentation and separation were determined using mRNP particles labelled with 125 iodine by the Iodigen (Pierce) reaction. Polypeptides were detected by staining gel transfers and individual bands were excised and partially sequenced using a gas-phase automated sequencer.

ATP binding

To test for ATP binding, mRNP particles were photocrosslinked to [[alpha]- 32 P]ATP. [[alpha]- 32 P]ATP (2 [mu]l) (Amersham International, 3000 Ci/mmol) was added to 100 ml containing ~30 mg of poly(A) + mRNP adjusted to 20 mM Tris-HCl, pH 7.5 and 2 mM MgCl 2 . Samples were photocrosslinked on ice for 20 min with UV-light at 254 nm, 600 J/m 2 /s. After photocrosslinking, samples were digested with RNase and analysed by SDS-PAGE and autoradiography.

Phospholabelling

To test for phosphorylation by the mRNP-associated protein kinase activity ( 9 ), poly(A) + mRNP were adjusted to 20 mM Tris-HCl, pH 7.5 and 2 mM MgCl 2 , as above. [[gamma]- 32 P]ATP (2 [mu]l) (Amersham International, 3000 Ci/mmol) was added to each sample. Reactions proceeded for 30 min at 37oC, then samples were digested with RNase and analysed by SDS-PAGE and autoradiography.

RNA extraction and hybridization

RNA was extracted from pools of: 100 oocytes (stages I and II); 50 oocytes (stages III and IV); 25 oocytes (stages V and VI); 25 embryos (stages 4, 8, 12, 18, 27 and 42), as described previously ( 27 ). Samples equivalent to two oocytes or embryos were denatured and separated on denaturing (formaldehyde) gels, using polyadenylated RNA standards as size markers. After vacuum transfer on to nylon membrane (BioRad, GT), the RNA was crosslinked by UV-irradiation. Radiolabelled antisense riboprobes were synthesized as run-off transcripts from an Eco RI- Xho I subclone of Xp54 in pBlueScript (Stratagene), using T7 RNA polymerase (Pharmacia) in the presence of [[alpha]- 32P ]CTP (400 Ci/mmol, Amersham). Hybridization of the probe to transfers was carried out at 65oC in a solution containing 1% dried skimmed milk, 1* SSC and 2% SDS.The transfers were then washed in decreasing salt concentrations to a final step of 0.1* SSC at 80oC, dried and exposed in contact with X-ray film (Agfa).

Immunoblotting

Antisera were raised in rabbits against an electrophoretically-purified protein of 54 kDa isolated from oocyte mRNP particles. IgG fractions were obtained by binding to, and elution from, protein A-Sepharose (Pharmacia). Affinity-purified antibodies were prepared by binding IgG to nitrocellulose membrane saturated with extracts of bacterially-expressed pGEX 4T/Xp54 fusion proteins. Samples equivalent to two oocytes or embryos, or to 10 5 cells or to 10 [mu]g of fusion protein, were separated by SDS-PAGE, transferred to nitrocellulose and reacted with anti-p54 at a dilution of 1/3000. Detection was with peroxidase-conjugated anti-rabbit IgG (Sigma) reacted with diaminobenzidine/ hydrogen peroxide.

Glycerol gradients

Samples containing ~150 [mu]g of poly(A) + mRNP were loaded on to gradients of 10-25% glycerol made up in gradient buffer: 100 mM KCl; 2 mM MgCl 2 ; 1 mM DTT; 10 mM Tris-HCl, pH 7.5. Centrifugation was at 18 000 r.p.m. for 14 h at 0oC, using a Beckman SW28 rotor.

Density gradients

Gradients of 20-60% Nycodenz in the buffer: 2 mM MgCl 2 ; 1 mM EDTA; 20 mM Tris-HCl, pH 7.5; were prepared according to the manufacturer's specifications (Nyegaard & Co., Oslo, Norway). Samples containing ~150 [mu]g of poly(A) + mRNP in 0.5 ml buffer were loaded on to 10 ml gradients, which were centrifuged at 36 000 r.p.m. for 18 h at 0oC using a Beckman SW55Ti rotor. Twenty-one 0.5 ml fractions were collected for analysis. Densities were determined by optical refractometry using the equation: density [rho] (g/cm 3 ) = 3.242[eta] - 3.323 where [eta] is the refractive index.

Riboprobe synthesis and helicase asssay

The vector pGEM-T (Promega) was used to synthesize complementary RNA transcripts from the T7 and an SP6 promoters. In order to generate transcripts of suitable lengths part of the polylinker region was deleted by cutting at the Nsi I and Pst I restriction sites, which were then ligated. T7 strand: the plasmid was linearized at the Spe I site, generating a 60 base transcript: 5'-GGGCGAATTGGGCC CGACGTCGCATGCTCCCGGCCGCCATGGCCGCGGGATTATCACTAG -3'. SP6 strand: the plasmid was linearized at the Apa I site, the 3' overhang of which was blunt-ended with T4 DNA polymerase, generating a 74 base transcript: 5'-GAATACTCAAGCTATGCAGGCGGCCGCA CTAGTGATAATCCCGCGGCCATGGCGGCCGGGAGCATGCGACGTCG- 3'. The complementary region is underlined (46 bases with a 67% GC content). The T7 transcript was labelled with [[alpha]- 32 P]CTP (Amersham International at 400 Ci/mmol).

To generate the double-stranded probe: 1 [mu]g of the labelled strand, specific activity 2.5 [mu]Ci/[mu]g RNA, was mixed with 2 [mu]g of cold strand, in a volume of 100 [mu]l of DEPC-treated dH 2 O. The mixture was denatured at 95oC for 5 min, then adjusted to 200 mM NaCl; 2 mM EDTA; 10 mM Tris-HCl, pH 7.5, and incubated at 60oC for 1 h for hybridization.

Double-stranded probes were also made (as detailed above) using sense and antisense transcripts from a subclone representing the 3' end of an oocyte-specific [beta]-tubulin gene. The annealed strands should generate compex stuctures containing regions of intrastrand duplex within the 280 nucleotide length of complementary sequence ( 28 ). These structures also present 5' single-stranded ends.

Any detectable RNA helicase activity unwinds and separates the strands, of which only one is radioactively labelled. Hence the activity is measured as a mobility shift towards the single-stranded form. As a control, the probe was denatured in 1 M glyoxal + 50% DMSO (dimethylsulfoxide) in 10 mM sodium phosphate buffer and placed at 50oC for 1 h. Helicase assays were performed in 50 [mu]l reactions in helicase buffer: 20 mM Tris-HCl, pH 7.5; 80 mM KCl; 1 mM MgCl 2 ; 1.5 mM DTT; with ATP (at 0-1 mM). Double-stranded probe (0.1 [mu]Ci per reaction) was included and protein samples (ranging from 2 to 500 ng protein) were tested. Reactions proceeded at 20oC for 20 min, after which 10 [mu]l of gel loading buffer was added (50% glycerol, 0.25% bromophenol blue, 0.25% xylene cyanol, in DEPC-treated dH 2 O) before loading the reactions on an acrylamide gel. The gel contained 6% acrylamide (sequencing grade) in TAE buffer (0.04 M Tris-acetate, 1 mM EDTA) and 10% glycerol. The gel was run for ~2 h at 200 V, fixed for 20 min in 10% acetic acid, dried and set up for autoradiography.

RESULTS

Characterization of a 54 kDa protein from mRNP particles


Figure 1 . Xp54 is a major component of mRNP particles detected by SDS-PAGE. ( A ) Proteins from mRNP particles are separated into two fractions after heat-treatment: the Y-box proteins pp60/56 remain in solution, whereas the other proteins, mostly in the range of 50-54 kDa, precipitate. Gel stained with Coomassie Brilliant Blue. ( B ) Autoradiograph showing that photocrosslinking of ATP occurs on two proteins of mRNP: at 54 and 68 kDa. This contrasts with endogenous phosphorylation, which occurs primarily on pp60/56. Whereas pp60/56 are crosslinked to RNA and released into the gel only after ribonuclease digestion, there is no evidence of either of the ATP-binding proteins being crosslinked to RNA. ( C ) Pattern of peptide fragments produced on digesting material from the heat-treatment pellet with cyanogen bromide. Of six peptides cut from the transfer and sequenced, four showed homology with the human RNA helicase, p54 and two of these (highlighted by asterisks) were found to be identical to sequences in p54.

Poly(A) + (polyadenylated) mRNP particles from previtellogenic oocytes are isolated by oligo(dT)-cellulose affinity chromatography and separated by SDS-PAGE (Fig. 1 ). Most abundant are the `masking' proteins FRGY2a/b, also known as pp60/56 ( 29 ), which belong to the family of Y-box transcription factors ( 10 - 12 ). The masking proteins can be efficiently photocrosslinked to a wide range of mRNA sequences ( 25 , 28 , 30 ). However, other mRNP proteins remain unidentified; particularly the group of abundant proteins in the 50-54 kDa range.

On photocrosslinking [[alpha]- 32 P]ATP to mRNP particles in solution, only two from the complete set of proteins are substantially covalently labelled. Autoradiography of SDS-PAGE gels shows labelled proteins of apparent mass of 68 and 54 kDa (Fig. 1 B). For comparison, parallel treatment of mRNP particles with [[gamma]- 32 P]ATP shows labelling of pp60/56 (FRGY2a/b) by the mRNP-associated protein kinase (CK2) activity. The ATP-binding proteins are distinct from the phospholabelled proteins in not being efficiently photocrosslinked to the RNA. As can be seen in Figure 1 B, the amount of crosslinked ATP does not increase in the 54 and 68 kDa bands after RNase treatment, whereas the amount of label (resulting from phosphorylation) resolved in the 56 and 60 kDa bands increases substantially after RNase treatment. It is not known if the phosphorylated material running below the 56 and 60 kDa bands is the 54 kDa ATP-binding protein: this protein is not phosphorylated in vivo , at least in immature oocytes ( 9 ), although it does contain potential phosphorylation sites (see Discussion). The slow migrating bands seen after RNase treatment of phosphorylated mRNP probably represent crosslinked FRGY2a/b dimers and multimers ( 25 ).

Steps were taken to isolate the 54 kDa ATP-binding protein. By heating suspensions of mRNP particles to 80oC followed by chilling and centrifugation, the protein components are separated into into two classes (Fig. 1 A): FRGY2a/b remain soluble whereas the other proteins are precipitated ( 26 ). The most abundant proteins present in the precipitates are in the size range of 52-54 kDa and include the 54 kDa ATP-binding protein. Digestion of the precipitates with cyanogen bromide yields a series of polypeptides, six of which, in the size range of 5-23 kDa were partially sequenced (Fig. 1 C). Four of the peptides could be aligned with the human RNA helicase, p54 ( 16 ), and two, (M)GWEKPSPIQ and (M)RQEHRNRVFH, provided a perfect match.

Cloning Xp54 cDNA from a cDNA library using PCR

PCR primers were designed around two of the sequenced peptides: (M)GWEKPSPIQ and (M)RQEHRNRVFH. Based on the alignment with human p54, the peptide sequence MGIFE MGWE was selected to design the forward primer: (5'-ATGGGNAT(C/A/T)TTYGARATGGGNTGGGA-3'), and the peptide sequence IHAK MRQEH to was selected to design the reverse primer: (5'-RTGYTCYTGNC(G/T)CATYTTNGCRTG(A/G/T)AT-3'). The template used for PCR amplification was double-stranded cDNA derived from stage I oocyte polysomal mRNA. A predicted 0.8 kb product was generated from 25 cycles, and ligated into the pGEM-T vector (Promega) for propagation. A radiolabelled probe was made from the 0.8 kb insert and was used to screen the cDNA library, constructed from stage I polysomal mRNA, for a full-length clone.

Analysis of Xp54 protein structure and homologies

A cDNA clone containing an insert of 2.5 kb was selected from the cDNA library and sequenced (EMBL accession number X92421). The length of the sequenced insert is 2491 bp, containing an open reading frame of 1445 bp extending from positions 204 to 1649. The proposed initiation codon occurs in a sequence context conforming to the eukaryotic consensus and to start sites for other proteins expressed in Xenopus oocytes. A polyadenylation site (AUUAAA) occurs 34 bp upstream from the 3'-terminal poly(A). The 3' UTR contains AU-rich stretches and three AUUUA motifs which could represent instability elements ( 31 ). The predicted molecular mass of the encoded protein is 54.1 kDa, matching the size of the ATP-crosslinked protein already described (Fig. 1 B). This protein is referred to as Xp54 ( Xenopus p54).

An alignment with the DEAD-box RNA helicase family (not shown) confirms that Xp54 is a member of a subfamily that includes human and mouse p54, Drosophila ME31B, S.pombe Ste13 and S.cerevisiae DHH1. The extent of conservation from yeast to man is on the whole impressive, and in particular, Xenopus Xp54 is 94% identical to human p54 at the amino-acid level. Among the five members of this subfamily, the overall amino acid sequence identity is 54%, and the overall level of similarity is at least 76% when conservative substitutions are taken into account. Figure 2 shows the alignment of Xp54 with its putative homologues.


Figure 2 . Alignment of amino acid sequences of five members of the subfamily of DEAD-box RNA helicases containing Xp54. Alignments were made using the PILEUP algorithm (Genetics Computer Group, Inc., Version 8.0) and displayed using Seqvu (The Garvan Institute of Medical Research, Version 1.0.1). Comparison is made between proteins from two vertebrates (Xp54 and human p54), Drosophila (ME31B) and two yeasts (Ste13 and DHH1). References are given in the text and the EMBL accession numbers are, in order: X92421; Z11685; M59926; D29795; X66057. Identical sequences are boxed.

Whereas all DEAD-box proteins share certain conserved motifs, there is considerable divergence between them in other regions of the proteins, particularly at the N- and C-termini ( 14 , 15 ). Auxiliary domains, additional to the conserved RNA helicase core, are thought to confer functional specificity to the many members of this family, for example by targeting specific RNA sequences with RNA-binding domains. Although no additional RNA-binding motifs are obvious in human p54 and Xp54, there is present an N-terminus which is rich in uncharged polar residues and may well interact with other macromolecules. It is interesting to note that a similar extension, rich in polar residues, is located at the C-terminus of the yeast proteins (Fig. 2 ).

Expression of Xp54 mRNA is developmentally regulated

The expression pattern of Xp54 mRNA was examined through oogenesis, early development and in adult tissues (Fig. 3 ). Hybridization of radiolabelled antisense riboprobes to transfers of poly(A) + RNA from ovary identifies a transcript of 2.6 kb, but no transcript larger than this, even on high level loading of the gel (Fig. 3 A). This observation compares well with the cloned cDNA, which is 2491 bp long and was derived from previtellogenic mRNA. Although a minor signal at 1.5 kb is also apparent, this would barely contain the coding region alone (1445 bp) and its identity remains unknown.


Figure 3 . Autoradiographs showing hybridization of radiolabelled antisense riboprobes to RNA extracted from ovary and staged oocytes. ( A ) The largest transcript detected in the total poly(A) + fraction from Xenopus ovary is 2.6 kb. A 100-fold increase in the amount of RNA loaded on the gel failed to reveal the 6.7 kb transcript obtained from mammalian cells. The positions of marker RNAs are indicated. ( B ) Expression of Xp54 mRNA occurs mainly in early (stage I and II) oocytes. The amounts of RNA run in each gel track are equivalent to the total RNA extracted from two oocytes. The concentration of Xp54 mRNA will drop enormously through oogenesis because of the 1000-fold increase in oocyte volume from stage I to VI. ( C ) The contrasting pattern of expression through oogenesis of mRNA of 0.5 kb encoding ribosomal protein L22 (EMBL accession number: X94243). The same samples were used but hybridized with an antisense riboprobe to the L22 clone.

On examining total RNA isolated from different stages of development, a peak of expression of the 2.6 kb transcript is found at stages I-II ( 22 ) of oogenesis (Fig. 3 B). A substantial decrease in hybridization signal occurs from oocyte stage III and into early embryogenesis (not shown). The high level of expression of Xp54 transcripts in small oocytes corresponds to the period of maximal production of stored mRNP particles: lower levels of transcript throughout the remainder of oogenesis and into embryogenesis may reflect the relatively small contribution to the net pool of mRNP at these times. Furthermore, we failed to detect any Xp54 transcripts in adult tissues (not shown) other than ovary. In comparison, transcripts encoding general growth components, such as ribosomal proteins (Fig. 3 C), can be detected in all tissues and stages of development tested. The failure to detect Xp54 transcripts in a range of somatic tissues is strange in view of the description of a 6.7 kb transcript encoding the homologue p54 in the equivalent human and mouse tissues ( 16 - 18 ). Although a band at ~7 kb was present after hybridization of RNA extracted from embryos and somatic tissues, it was removed after stringent washing of the transfers (not shown). Taken together, these observations lead us to believe that the Xp54 transcripts represent expression of an oocyte-specific gene.

Expression of fusion proteins and their immunoreactivity

GST (glutathione S -transferase) fusion proteins were prepared by subcloning Xp54 into pGEX-4T (Pharmacia) vectors. A polyclonal antiserum, raised against a band-excised mRNP protein of 54 kDa, recognized three out of four Xp54-GST fusion proteins (Fig. 4 A). Specific reactions were obtained with fusions containing the middle portion and the carboxyl end of Xp54: Pvu II- Pvu II; Dra I- Dra I; Xho I- Xho I. The antiserum did not recognize the Pvu II- Xho I fusion protein which encodes 14.3 kDa of Xp54 near the amino end, including the `A' motif involved in ATP-binding. This antiserum is referred to as anti-p54 and was affinity-purified by binding an IgG fraction to nitrocellulose saturated with bacterial extract containing the Pvu II- Pvu II fusion protein.


Figure 4 . Immunoblotting of fusion proteins and extracts from oocytes and embryos with anti-Xp54. ( A ) The antiserum anti-p54, raised against the native mRNP protein, is immunoreactive with a range of recombinant fusion proteins, excepting one containing a portion from near the N-terminal end of Xp54. The immunoblot on the right shows the specificity with induced (I) as opposed to uninduced (U) cells containing the Xho I- Xho I subclone. The 60 kDa band represents the fusion protein, whereas the 35 kDa band may represent the spontaneously cleaved Xp54 fragment. ( B ) Anti-p54 detects a protein of the same apparent mass throughout oogenesis and early embryogenesis and a protein of similar mass in rat ovary. The samples are equivalent to total protein from two oocytes (at stages I, III and VI) or two embryos (at cleavage, blastula, gastrula, neurula, tail-bud and swimming tadpole stages). Similar amounts of protein from Xenopus ovary (X) and rat ovary (R) were also compared.

Developmental expression of Xp54 protein

Anti-p54 was used to track expression of the Xp54 protein through oogenesis and early embryogenesis (Fig. 4 B). The level of Xp54, on a per oocyte/embryo basis, is at a maximum at Dumont stage I and remains fairly constant through to the end of oogenesis and, after fertilization, up to blastula. From blastula, through gastrula and neurula, there is a substantial decline in the level of Xp54. This pattern of expression is similar to that of the Y-box mRNA-packaging proteins, pp60/56 ( 32 ), and therefore correlates well with the relative abundance of maternal mRNP particles. However, one difference is that whereas pp60/56 are not detected much after blastula (stage 8), low levels of the immunostained 54 kDa band remain detectable through to at least the free-feeding tadpole (embryonic stage 42).

Although all evidence indicates that the 2.6 kb transcript which encodes Xenopus p54 is exclusively maternal, immunoblotting with anti-p54 shows that a 54 kDa protein is expressed in Xenopus culture cell lines (XTC, from metamorphosing tadpoles; XP, from adult kidney), indicating that a somatic transcript exists to direct the synthesis of a very similar protein. A 54 kDa protein is also detected with anti-p54 in rat ovary extracts (Fig. 4 B) and it is reasonable to suppose that similar proteins are expressed across vertebrate species.

Immunostaining of oocytes and culture cells with anti-p54

That Xp54 is a major cytoplasmic protein of small oocytes is seen directly by immunostaining ovarian sections with anti-p54. The fluorescent image reveals a widespread distribution of particulate structures in the cytoplasm (Fig. 5 A). Although no immunostaining is detected in the nucleoplasm, nuclear structures, including nucleoli and chromatin (seen more clearly in chromosome preparations, not shown), give a significant reaction, particularly in the smaller (stage I) oocytes. The cellular distribution of Xp54, then, appears to be similar to that of pp60/56, except for the more intense staining of nucleoli with anti-p54.


Figure 5 . Detection of Xp54 in situ . Sectioned ovary and whole XTC cells were immunostained with anti-p54 and examined by fluorescence microscopy. ( A ) An ovarian section showing accumulation of Xp54 in the cytoplasm of small oocytes. As with other mRNP proteins (32), the concentration declines as the oocytes increase in size. Note that an appreciable reaction also occurs with nuclear structures. ( B ) Optical section through XTC cells (a line derived from metamorphosing tadpoles) showing punctate immunostaining, which is more dense in the cytoplasm than in the nucleus. Bar represents 25 [mu]m.

Immunostaining of XTC cells with anti-p54 also shows a predominantly particulate cytoplasmic reaction (Fig. 5 B). Optical sections, made by confocal laser microscopy, indicate that smaller amounts of immunoreactive material are located in the nucleus. This image is very similar to that shown previously using polyclonal antibodies to human p54 (anti-rck/p54) with Raji cells ( 17 ).

Sedimentation properties of Xp54

In order to determine to what extent Xp54 is associated with particles sedimenting at a rate expected of mRNPs, clarified homogenates from previtellogenic oocytes were centrifuged through 15-40% glycerol gradients. It has been shown previously that mRNP particles sediment at 30-100S ( 5 , 9 ). On analysing gradient fractions by SDS-PAGE and immunoblotting, it is seen that a 54 kDa protein, which reacts specifically with anti-p54, mostly sediments between 42S and 80S marker peaks (Fig. 6 A). The observed distribution is similar to that of the mRNP packaging proteins pp60/56 using anti-FRGY2 (not shown). The coincidence of pp56/60 and Xp54 suggests that both packaging proteins and RNA helicase are bound to the same population of mRNA molecules. From the presence of some Xp54 near the top of the gradients, it is possible that in early oocytes excess RNA helicase occurs in RNA-free protein complexes, as has been described for pp60/56 and other mRNP proteins ( 9 , 33 ).

Analysis of mRNP density fractions


Figure 6 . Location of Xp54 in mRNP fractions separated by rate sedimentation and buoyant density centrifugation. ( A ) Immunoblotting of fractions obtained by centrifuging a homogenate of previtellogenic ovary through a glycerol gradient. Most of the RNA sediments in peaks at 80S (monosomes), 42S (storage particles containing 5S RNA and tRNA) and 7S (storage particles containing 5S RNA). Most of the Xp54 sediments between 80S and 42S, in the range of non-polysomal mRNP particles. ( B ) Immunoblotting of fractions obtained by centrifuging the same homogenate in a Nycodenz gradient. Xp54 bands at a density characteristic of mRNP particles.

Previous work with Nycodenz ( 34 ) and CsCl gradients (J.S. and M.L., unpublished), has shown a uniform density of mRNP particles, in which all classes of mRNA peak in the same gradient fractions. (Classes of mRNA include those that are translationally- repressed in immature oocytes, such as c- mos and cyclin B1, and those that are translated, such as ribosomal proteins and nucleolin.) The advantage of Nycodenz gradients is that the ionic conditions are not extreme and no prior fixation of RNA/protein complexes is required. On centrifuging poly(A) + mRNP on 20-60% Nycodenz gradients, the mRNP proteins peak in a fraction corresponding to a buoyant density of 1.21 g/cm 3 (Fig. 6 B). Since both Xp54 and pp60/56, detected by immunoblotting with anti-p54 (Fig. 6 B) and anti-FRGY2 (not shown), occur in this same density fractions, it is again suggested that both packaging proteins and RNA helicase are components of the same mRNP particles.

Separation of helicase activity from other mRNP components

On binding poly(A) + mRNP to oligo(dT)-cellulose, a subset of proteins, including pp56/60, remains bound to the resin at high salt concentration (2 M NaCl). These proteins are eluted under conditions which release the poly(A) + RNA (no salt or 60% formamide; 5 , 25 , 28 ). However, before eluting the salt-stable mRNP, individual proteins can be washed off the column by increasing salt concentration (Fig. 7 A). At 0.4 M NaCl, a 54 kDa protein is eluted, whereas at 0.6 and 1.0 M NaCl, a much wider range of mRNP proteins elute (Fig. 7 B). Selected fractions were immunoblotted with anti-p54 and anti-FRGY2. The immunoblots confirm that most of pp60/56 is only released in the final no salt elutions, although small amounts can be detected from the 0.6 M eluate onwards, but not in the 0.4 M eluate (not shown). In contrast, Xp54 is enriched in the 0.4 M eluate, but is also present in higher salt elutions up to 1.5 M NaCl (Fig. 7 C). Thus Xp54 appears to be bound to the mRNP through charge interactions; whether it is bound directly to mRNA, or to other mRNP proteins, is not known.


Figure 7 . Elution of Xp54 from mRNP bound to oligo(dT) cellulose. ( A and B ) Proteins (Coomassie stained after SDS-PAGE) associated with poly(A) + RNA are selectively released from the column by changing the salt concentration of the eluent. After extensive washing with buffer containing 0.2 M NaCl, the immunoblot ( C ) shows that Xp54 elutes mostly between the 0.4 and 1.0 M NaCl steps. Only the 0.4 M fraction is substantially free of other proteins.

Since the 0.4 M NaCl fraction contains mostly Xp54 kDa, it was tested in an RNA helicase assay (Fig. 8 ). In the presence of 0.5 mM ATP, the addition of ~2 ng of protein derived from the 0.4 M NaCl eluate was sufficient to dissociate the partially duplexed probe into two individual RNA strands. This activity was dependent on either ATP or GTP, at a concentration of >100 [mu]M for maximum effect (Fig. 8 A). The extent of unwinding can also be measured in terms of sensitivity to RNaseA, both interstrand and intrastrand base-paired regions being protected from digestion. These experiments were carried out using RNA sequences from the 3' UTR of an oocyte-specific [beta]-tubulin gene. In the absence of ATP, residual, labelled RNA fragments were detected after RNase digestion; in the presence of ATP, no labelled fragments remained, confirming complete unwinding of duplex structures (Fig. 8 B). The fraction containing partially purified RNA helicase activity was stored in 40% glycerol at -20oC, and retained activity at least 2 months after isolation. Subsequent experiments showed that the isolated RNA helicase activity could be blocked by addition of low concentrations (10 ng/ml) of anti-p54 IgG (Fig. 8 B) confirming that the activity observed is dependant on Xp54.


Figure 8 . Autoradiographs showing that ATP-dependent RNA helicase activity is detected in partially-purified Xp54. ( A ) Effects of increasing protein concentration and ATP concentration on the release of a radiolabelled single- stranded template (S) from an RNA duplex (D). The partly complementary RNA strands were synthesized from a modified pGEM vector. Note that GTP is as efficient as ATP as an energy source. ( B ) ATP-dependent release by p54 of single-standed RNA (S) from structures formed by annealing sense and antisense transcripts (D) synthesized from the 3' end of an oocyte-specific [beta]-tubulin gene. Intrastrand, as well as interstrand, duplex regions form in such structures as is evident from the ribonuclease-resistant fragments (arrows in middle panel) remaining in the absence of ATP. The panel on the right shows that preincubation of the protein extract with anti-p54 IgG (10 ng/ml) blocks helicase activity, whereas preincubation with anti-FRGY2 IgG (YB, up to 1 [mu]g/ml) has no negative effect.

DISCUSSION

The RNA helicase Xp54 is an abundant and integral component of stored (non-translating) mRNP in Xenopus oocytes. Xp54 was first identified through peptide sequencing and ATP crosslinking, and then cloned by PCR using degenerate primers. A partially purified fraction containing Xp54 was shown to possess an ATP-dependent RNA helicase activity. Xp54 belongs to the family of DEAD-box proteins, and includes the conserved motifs that are the hallmark of that family. More specifically, Xp54 belongs to a subfamily that includes human p54, to which it is 94% identical, mouse p54, Drosophila ME31B, S.pombe Ste13 and S.cerevisiae DHH1. Information in the literature describing these putative homologues can now be related to Xp54.

The first member of this subfamily to be cloned was Drosophila ME31B , a maternally expressed gene ( 19 ). It is expressed in germ-line cells, including the 15 nurse cells and oocytes, but not the surrounding somatic cells. ME31B mRNA is detectable only in the early embryo, 0-2 h after fertilization. The S.pombe gene STE13 was cloned by functional complementation of a sterility mutant ( 20 ). Prior information indicated that STE13 is essential for nitrogen-starvation-induced G 1 arrest, leading to the initiation of sexual development ( 35 ). The yeast protein is therefore required for the progression of meiosis. Yeast mutants were successfully complemented with a cDNA construct encoding Drosophila ME31B, but not by one encoding Vasa, a well characterized maternally-expressed RNA helicase, consistent with ME31B being the functional homologue of Ste13. Maekawa et al. ( 20 ) suggested that Ste13 may have a role in the translational control of meiotic mRNAs.

Human p54 was first described by Dan and Yunis ( 16 ). These authors were investigating the chromosomal translocation t(11;14)(q23;q32) found in the cell line RC-K8 derived from a diffuse, large B-cell lymphoma. A putative RNA helicase, p54, 75% identical to Drosophila ME31B, was found at this breakpoint. The expression of its mRNA was detected at high levels, in a variety of tissues, in the form of a 6.7 kb transcript. More recently, Akao et al. ( 17 ) have used an anti-p54 antiserum to detect the 54 kDa protein in different tissues. Significantly, they detect moderate amounts of p54 in the neuroblastoma cell line IMR-32 and glioblastoma cell line T98G, and higher levels in the rhabdomyosarcoma cell line RMS-YM and lung cancer cell lines LU99A and LU99B. These cell lines are derived from tissues in which the same authors do not detect p54, leading to the suggestion that p54 is a candidate proto-oncogene.

As in the case of Drosophila ME31B ( 19 ), we were unable to detect Xp54 mRNA in adult tissues. Highest levels of Xp54 mRNA are seen in early oogenesis, when the demand for mRNP proteins is highest. However, Xp54 protein is detected on Western blots at least until the free-feeding tadpole stage, and is detected in the tadpole cell line XTC and the adult kidney cell line XP. It is therefore likely that the cDNA described in this paper is a germ cell-specific transcript, and that a somatic transcript directs the synthesis of a similar protein. The presence of other germ-cell specific transcripts in Xenopus oocytes is well documented ( 32 ).

What, then, is the specific function of Xp54? The Xenopus oocyte can be considered to be in a mode of suspended cell proliferation. Until oocyte maturation, the oocyte is stalled in the first meiotic prophase. During this time, the lampbrush chromosomes are highly active in transcribing genes whose products will drive early development. For example, c- mos is transcribed from early oogenesis onwards, but its mRNA is not translated until oocyte maturation ( 36 ). Another example is c- myc mRNA which accumulates from early oogenesis and is stored for translation during early embryonic development ( 37 , 38 ). Two possibilities arise. The first is that Xp54, as an integral component of stored mRNP, is required for the efficient translational recruitment of stored mRNAs. More specifically, Xp54 might unwind duplex structures in the 5' UTR during translation initiation (mimicking the role of eIF4A), or may even unwind duplexes in the coding region and 3' UTR that might impede elongation. The key property would be the ability to enhance translation at a time when large quantities of product are required. Akao et al. ( 17 ) have detected p54 on the rough ER, consistent with a role in translation and our own immunostaining studies on XTC cells lead to a similar conclusion. An alignment of 45 DEAD- and DEXH-box RNA helicases representing all known subfamilies (not shown), suggests that the Xp54 subfamily is more closely related to eIF4A than to any other helicase, again suggesting that Xp54 has a role in translation initiation.

An alternative function might relate to the formation of stored mRNP particles, a process which appears to be initiated in the nucleus ( 13 ). In this scenario, Xp54 would unwind RNA sequences to facilitate protein binding, notably of the mRNA-packaging Y-box proteins, FRGY2a/b, which show a marked preference for single-stranded RNA ( 25 ). Whereas immunostaining of cell sections (Fig. 5 ) indicates that Xp54 can be detected in the nucleus, an exclusively nuclear function would not explain the high levels of Xp54 which are maintained in cytoplasmic mRNP. Like the Y-box proteins, which package the mRNA, Xp54 levels decline on progression from rapid embryonic cell cleavage to mid-blastula, when stored maternal mRNP particles are mostly used up and zygotic transcription takes over ( 4 ).

In considering what might regulate the onset of Xp54 helicase activity, two aspects are worth mentioning. (i) It has been shown previously that mRNP particles in oocytes carry an associated casein kinase II (CK2) activity ( 9 ) and that phosphorylation of FRGY2a/b stabilizes its binding to mRNA ( 28 , 30 ). Xp54 also has multiple potential CK2 phosphorylation sites: four, out of a total of five, being located near the C-terminus. However, it is significant that Xp54, in comparison with FRGY2a/b, is inefficiently phosphorylated both in vitro and in vivo in immature oocytes ( 9 ). Perhaps the turnover of phosphates in Xp54 is much slower, or else the CK2 sites are blocked during the assembly of mRNP particles, only becoming accessible for phosphorylation at some later stage. Modification at these sites, whether by phosphorylation or dephosphorylation, might act as a trigger for helicase activation at an appropriate stage of development. (ii) Full helicase activity in vivo may require the assistance of an additional protein factor, much in the same way that eIF4A requires eIF4B ( 39 ). Such a cofactor might only be available at certain times of development, and/or might only bind the mRNP complex in response to an appropriate change in the phosphorylation status of Xp54. It is possible that a cofactor is present in the column fraction used in this report to demonstrate helicase activity, since Xp54 was not purified.

The combination of Xp54, Y-box proteins and CK2 with maternal mRNA should provide a useful model to explore the functioning of stored mRNP particles. Findings would be relevent, not only to germ cells ( 32 ) and early development, but also to proliferating somatic cells in which high levels of Y-box proteins are detected ( 40 ) and to somatic cells in which an association of Y-box proteins with stored mRNA has been demonstrated ( 41 ).

ACKNOWLEDGEMENTS

We thank Dr Graham Kemp (St Andrews) for kind assistance in peptide sequencing.This work was supported by a grant from The Wellcome Trust.

REFERENCES

1 Spirin, A. S. (1994) Mol. Reprod. Dev., 38, 107-117.

2 Davidson, E. H. (1986) Gene Activity in Early Development, Academic Press, New York.

3 Almouzni, G. and Wolffe, A. P. (1995) EMBO J., 14, 1752-1765. MEDLINE Abstract

4 Newport, J. and Kirschner, M. (1982) Cell 30, 675-686. MEDLINE Abstract

5 Darnborough, C. H. and Ford, P. J. (1981) Eur. J. Biochem., 113, 415-424.

6 Dearsly, A. L., Johnson, R. M., Barrett, P. and Sommerville, J. (1985) Eur. J. Biochem., 150, 95-103.

7 Richter, J. D. and Smith, L. D. (1984) Nature (London), 309, 378-380.

8 Kick, D., Barrett, P., Cummings, A. and Sommerville, J. (1987) Nucleic Acids Res., 15, 4099-4109. MEDLINE Abstract

9 Cummings, A. and Sommerville, J. (1988) J. Cell Biol., 107, 45-56. MEDLINE Abstract

10 Deschamps, S., Viel, A., Garrigos, M., Denis, H. and Le Maire, M. (1992) J. Biol. Chem., 267, 13799-13802. MEDLINE Abstract

11 Murray, M. T., Schiller, D. T. and Franke, W. W. (1992) Proc. Natl. Acad. Sci. USA, 89, 11-15.

12 Tafuri, S. R. and Wolffe, A. P. (1992) The New Biologist, 4, 1-11.

13 Sommerville, J. and Ladomery, M. (1996) FASEB J., 10, 435-443. MEDLINE Abstract

14 Schmid, S. R. and Linder, P. (1992) Mol. Microbiol. 6, 283-292.

15 Gorbalenya, A. E. and Koonin, E. V. Curr. Opin. Str. Biol. 3, 419-429.

16 Dan, L. and Yunis, J. J. (1992) Nucleic Acids Res., 20, 1967-1972.

17 Akao, Y., Marukawa, O., Morikawa, H., Nakao, K., Kamei, M., Hachiya, T. and Tsujimoto, Y. (1995) Cancer Res., 55, 3444-3449. MEDLINE Abstract

18 Seto, M., Yamamoto, K., Takahashi, T. and Ueda, R. (1995) Gene, 166, 293-296. MEDLINE Abstract

19 De Valoir, T., Tucker, M. A., Belikoff, E. J., Camp, L. A., Bolduc, C. and Beckingham, K. (1991) Proc. Natl. Acad. Sci. USA, 88, 2113-2117. MEDLINE Abstract

20 Maekawa, H., Nakagawa, T., Uno, Y., Kitamura, K. and Shimoda, C. (1994) Mol. Gen. Genet., 244, 456-464. MEDLINE Abstract

21 Strahl-Bolsinger, S. and Tanner, W. (1993) Yeast 9, 429-432.

22 Dumont, J. N. (1972) J. Morphol. 136, 153-180.

23 Nieuwkoop, P. D. and Faber, J. (1967) Normal Table of Xenopus laevis (Daudin). North-Holland Publ., Amsterdam.

24 Smith, J. C. and Tata, J. R. (1991) Methods Cell Biol., 36, 635-654.

25 Marello, K., La Rovere, J. and Sommerville, J. (1992) Nucleic Acids Res., 20, 5593-5600. MEDLINE Abstract

26 Deschamps, S., Viel, A., Denis, H. and Le Maire, M. (1991) FEBS Lett., 282, 110-114.

27 Evans, J. P. and Kay, B. K. (1991) Methods Cell Biol., 36, 143-145.

28 Ladomery, M. and Sommerville, J. (1994) Nucleic Acids Res., 22, 5582-5589. MEDLINE Abstract

29 Sommerville, J. (1990) J. Reprod. Fert. Suppl., 42, 225-233.

30 Murray, M. T. (1994) Biochemistry, 33, 13910-13917.

31 Chen, C. Y. A. and Shyu (1995) Trends Biochem. Sci. 20, 465-470.

32 Sommerville, J. and Ladomery, M. (1996) Chromosoma, 104, 469-478. MEDLINE Abstract

33 Murray, M. T., Krohne, G. and Franke, W. W. (1991) J. Cell Biol., 112, 1-11.

34 Tafuri, S. R. and Wolffe, A. P. (1993) J. Biol. Chem., 268, 24255-24261.

35 Kitamura, K., Nakagawa, T. and Shimoda, C. (1990) Curr. Genet., 18, 315-321.

36 Sagata, N., Oskarsson, M., Copeland, T., Brumbaugh, J. and Vande Woude, G. F. (1988) Nature, 335, 519-525. MEDLINE Abstract

37 Godeau, F., Persson, H., Gray, H. E. and Pardee, A. B. (1986) EMBO J., 5, 3571-3577. MEDLINE Abstract

38 Taylor, M. V., Gusse, M., Evan, G. I., Dathan, N. and Mechali, M. (1986) EMBO J., 5, 3563-3570.

39 Pause, A., Methot, N., Svitkin, Y., Merrick, W. C. and Sonenberg, N. (1994) EMBO J., 13, 1205-1215. MEDLINE Abstract

40 Ladomery, M. and Sommerville, J. (1995) BioEssays, 17, 9-11. MEDLINE Abstract

41 Evdokimova, V. M., Wei, C., Sitikov, A. S., Simonenko, P. N., Lazarev, O. A., Vasilenko, K. S., Ustinov, V. A., Hershey, J. W. B. and Ovchinnikov, L. P. (1995) J. Biol. Chem., 270, 3186-3192.


Return

*To whom correspondence should be addressed. Tel: +44 1334 463583; Fax: +44 1334 463600; Email: js15@st-and.ac.uk

+ Present address: MRC Human Genetics Unit, Western General Hospital, Edinburgh EH4 2XU, UK
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
P. K. Arthur, M. Claussen, S. Koch, K. Tarbashevich, O. Jahn, and T. Pieler
Participation of Xenopus Elr-type Proteins in Vegetal mRNA Localization during Oogenesis
J. Biol. Chem., July 24, 2009; 284(30): 19982 - 19992.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
A. Wilczynska, N. Minshall, J. Armisen, E. A. Miska, and N. Standart
Two Piwi proteins, Xiwi and Xili, are expressed in the Xenopus female germline
RNA, February 1, 2009; 15(2): 337 - 345.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. A. M. Braks, G. R. Mair, B. Franke-Fayard, C. J. Janse, and A. P. Waters
A conserved U-rich RNA region implicated in regulation of translation in Plasmodium female gametocytes
Nucleic Acids Res., March 27, 2008; 36(4): 1176 - 1186.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Minshall, M. H. Reiter, D. Weil, and N. Standart
CPEB Interacts with an Ovary-specific eIF4E and 4E-T in Early Xenopus Oocytes
J. Biol. Chem., December 28, 2007; 282(52): 37389 - 37401.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. R. Belak and N. Ovsenek
Assembly of the Yin Yang 1 Transcription Factor into Messenger Ribonucleoprotein Particles Requires Direct RNA Binding Activity
J. Biol. Chem., December 28, 2007; 282(52): 37913 - 37920.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S. Voltmer-Irsch, S. Kneissel, P. G. Adenot, and M. S. Schmidt-Zachmann
Regulatory mechanisms governing the oocyte-specific synthesis of the karyoskeletal protein NO145
J. Cell Sci., April 15, 2007; 120(8): 1412 - 1422.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. J. Tanaka, K. Ogawa, M. Takagi, N. Imamoto, K. Matsumoto, and M. Tsujimoto
RAP55, a Cytoplasmic mRNP Component, Represses Translation in Xenopus Oocytes
J. Biol. Chem., December 29, 2006; 281(52): 40096 - 40106.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Rouget, C. Papin, and E. Mandart
Cytoplasmic CstF-77 Protein Belongs to a Masking Complex with Cytoplasmic Polyadenylation Element-binding Protein in Xenopus Oocytes
J. Biol. Chem., September 29, 2006; 281(39): 28687 - 28698.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
P. Linder
Dead-box proteins: a family affair--active and passive players in RNP-remodeling
Nucleic Acids Res., September 10, 2006; 34(15): 4168 - 4180.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
G. R. Mair, J. A. M. Braks, L. S. Garver, J. C. A. G. Wiegant, N. Hall, R. W. Dirks, S. M. Khan, G. Dimopoulos, C. J. Janse, and A. P. Waters
Regulation of sexual development of Plasmodium by translational repression.
Science, August 4, 2006; 313(5787): 667 - 669.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. Weston and J. Sommerville
Xp54 and related (DDX6-like) RNA helicases: roles in messenger RNP assembly, translation regulation and RNA degradation
Nucleic Acids Res., June 14, 2006; 34(10): 3082 - 3094.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Nashchekin, J. Zhao, N. Visa, and B. Daneholt
A Novel Ded1-like RNA Helicase Interacts with the Y-box Protein ctYB-1 in Nuclear mRNP Particles and in Polysomes
J. Biol. Chem., May 19, 2006; 281(20): 14263 - 14272.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
C. J. Decker and R. Parker
CAR-1 and Trailer hitch: driving mRNP granule function at the ER?
J. Cell Biol., April 24, 2006; 173(2): 159 - 163.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
T. Matsui, K. Hogetsu, J. Usukura, T. Sato, T. Kumasaka, Y. Akao, and N. Tanaka
Structural insight of human DEAD-box protein rck/p54 into its substrate recognition with conformational changes
Genes Cells, April 1, 2006; 11(4): 439 - 452.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
P. R. Boag, A. Nakamura, and T. K. Blackwell
A conserved RNA-protein complex component involved in physiological germline apoptosis regulation in C. elegans
Development, November 15, 2005; 132(22): 4975 - 4986.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
A. Audhya, F. Hyndman, I. X. McLeod, A. S. Maddox, J. R. Yates III, A. Desai, and K. Oegema
A complex containing the Sm protein CAR-1 and the RNA helicase CGH-1 is required for embryonic cytokinesis in Caenorhabditis elegans
J. Cell Biol., October 24, 2005; 171(2): 267 - 279.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
L. J. Colegrove-Otero, A. Devaux, and N. Standart
The Xenopus ELAV Protein ElrB Represses Vg1 mRNA Translation during Oogenesis
Mol. Cell. Biol., October 15, 2005; 25(20): 9028 - 9039.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
M. A. Ferraiuolo, S. Basak, J. Dostie, E. L. Murray, D. R. Schoenberg, and N. Sonenberg
A role for the eIF4E-binding protein 4E-T in P-body formation and mRNA decay
J. Cell Biol., September 12, 2005; 170(6): 913 - 924.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
Z. CHENG, J. COLLER, R. PARKER, and H. SONG
Crystal structure and functional analysis of DEAD-box protein Dhh1p
RNA, August 1, 2005; 11(8): 1258 - 1270.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. Bergkessel and J. C. Reese
An Essential Role for the Saccharomyces cerevisiae DEAD-Box Helicase DHH1 in G1/S DNA-Damage Checkpoint Recovery
Genetics, May 1, 2004; 167(1): 21 - 33.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
N. Minshall and N. Standart
The active form of Xp54 RNA helicase in translational repression is an RNA-mediated oligomer
Nucleic Acids Res., February 24, 2004; 32(4): 1325 - 1334.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. S.-I Tseng-Rogenski, J.-L. Chong, C. B. Thomas, S. Enomoto, J. Berman, and T.-H. Chang
Functional conservation of Dhh1p, a cytoplasmic DExD/H-box protein present in large complexes
Nucleic Acids Res., September 1, 2003; 31(17): 4995 - 5002.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
U. Sheth and R. Parker
Decapping and Decay of Messenger RNA Occur in Cytoplasmic Processing Bodies
Science, May 2, 2003; 300(5620): 805 - 808.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
D. A. Smillie and J. Sommerville
RNA helicase p54 (DDX6) is a shuttling protein involved in nuclear assembly of stored mRNP particles
J. Cell Sci., January 15, 2002; 115(2): 395 - 407.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
K. Hashimoto, Y. Nakagawa, H. Morikawa, M. Niki, Y. Egashira, I. Hirata, K. Katsu, and Y. Akao
Co-overexpression of DEAD box protein rck/p54 and c-myc protein in human colorectal adenomas and the relevance of their expression in cultured cell lines
Carcinogenesis, December 1, 2001; 22(12): 1965 - 1970.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
R. E. Navarro, E. Y. Shim, Y. Kohara, A. Singson, and T. K. Blackwell
cgh-1, a conserved predicted RNA helicase required for gametogenesis and protection from physiological germline apoptosis in C. elegans
Development, September 1, 2001; 128(17): 3221 - 3232.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
A. Nakamura, R. Amikura, K. Hanyu, and S. Kobayashi
Me31B silences translation of oocyte-localizing RNAs through the formation of cytoplasmic RNP complex during Drosophila oogenesis
Development, September 1, 2001; 128(17): 3233 - 3242.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
K. Matsumoto, K. Aoki, N. Dohmae, K. Takio, and M. Tsujimoto
CIRP2, a major cytoplasmic RNA-binding protein in Xenopus oocytes
Nucleic Acids Res., December 1, 2000; 28(23): 4689 - 4697.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. R. Ladomery, J. Slight, S. Mc Ghee, and N. D. Hastie
Presence of WT1, the Wilm's Tumor Suppressor Gene Product, in Nuclear Poly(A)+ Ribonucleoprotein
J. Biol. Chem., December 17, 1999; 274(51): 36520 - 36526.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S Zhang, C Herrmann, and F Grosse
Pre-mRNA and mRNA binding of human nuclear DNA helicase II (RNA helicase A)
J. Cell Sci., January 4, 1999; 112(7): 1055 - 1064.
[Abstract] [PDF]


Home page
FASEB J.Home page
S. K. Swamynathan, A. Nambiar, and R. V. Guntaka
Role of single-stranded DNA regions and Y-box proteins in transcriptional regulation of viral and cellular genes
FASEB J, May 1, 1998; 12(7): 515 - 522.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (237K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (83)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Ladomery, M.
Right arrow Articles by Sommerville, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ladomery, M.
Right arrow Articles by Sommerville, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?