Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (221K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (34)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Shayeghi, M.
Right arrow Articles by Watts, F. Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shayeghi, M.
Right arrow Articles by Watts, F. Z.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© 1997 Oxford University Press 1162-1170

Footnote

Characterisation of Schizosaccharomyces pombe rad31 , a UBA-related gene required for DNA damage tolerance

Characterisation of Schizosaccharomyces pombe rad31 , a UBA-related gene required for DNA damage tolerance Maryam Shayeghi , Claudette L. Doe , Manoochehr Tavassoli and Felicity Z. Watts*

Biochemistry, School of Biological Sciences, University of Sussex, Falmer, Brighton BN1 9QG, UK

Received December 16, 1996; Revised and Accepted February 3, 1997 DDBJ/EMBL/GenBank accession no. Y08805

ABSTRACT

The fission yeast rad31-1 mutant is sensitive to both UV and ionising radiation and exhibits a growth defect at 35 o C. In addition, the mutant displays defects in cell morphology and nuclear division at 26 o C which are exaggerated at 35 o C. We have cloned the rad31 gene and have shown that it is not essential for viability, although cells containing a disrupted rad31 gene grow slowly. The null allele has similar cell and nuclear morphologies to the original allele and displays an extremely high frequency of loss of minichromosomes. rad31 is not required for either the S/M or G2/M checkpoint, however double mutant analysis indicates that rad31 acts in a process which is defective in the checkpoint rad mutants and which involves hus5 . Sequence analysis indicates that rad31 encodes a protein which is related to ubiquitin activating proteins and more particularly to an ORF in Saccharomyces cerevisiae and to the Arabidopsis thaliana AXR1 and human APP-BP1 genes. We have isolated the S.cerevisiae sequence, which we have named RHC31 ( r ad31 homologue in S. c erevisiae ), since we show that it can complement the slow growth phenotype and radiation sensitivity of S.pombe rad31 .

INTRODUCTION

Co-ordination of cell cycle events is essential if cells are to undergo successful mitoses and pass on faithful copies of their genetic material to daughter cells. Thus, controls exist which ensure that mitosis is dependent on the completion of DNA replication and repair of DNA damage ( 1 - 3 ). This dependency of mitosis on DNA structure has been investigated through the analysis of checkpoint mutants in both Saccharomyces cerevisiae and Schizosaccharomyces pombe ( 1 - 4 ). Inhibition of DNA synthesis brought about by inhibitors such as hydroxyurea (HU) or cell cycle ( cdc ) mutants evokes the S/M checkpoint which, in S.pombe , arrests the cell cycle through tyrosine phosphorylation of the p34 cdc2 protein ( 5 , 6 ). The presence of DNA damage also results in cell cycle arrest ( 2 , 3 ).

In S.pombe , the DNA damage checkpoint requires the action of chk1 ( 4 , 7 ), rad24 and rad25 ( 8 ). It also requires the checkpoint rad genes which include rad1 , rad3 , rad9 , rad17 , rad26 and hus1 . These six genes are also needed for the replication checkpoint ( 2 - 4 , 9 ). Exposure of the corresponding checkpoint mutants to either DNA synthesis inhibitors or DNA damaging agents results in mitotic catastrophe, as observed by a ` cut' phenotype ( 10 ). In addition to their requirement for the S/M and damage checkpoints, the checkpoint rad genes have been proposed to have a further function which is required for the recovery from irradiation or S phase arrest ( 4 , 9 ). This is based on the observation that the checkpoint rad mutants are substantially more sensitive to radiation than mutants defective solely in the checkpoint function, such as chk1 ( 4 , 7 ). In addition to the checkpoint rad genes, this recovery process or damage tolerance mechanism has been shown to require the hus5 gene ( 11 ). hus5 mutants are moderately sensitive to radiation and HU, but are not defective in either the replication or damage checkpoints. The hus5 gene encodes a ubiquitin conjugating enzyme, deletion of which results in microcolonies which display multiple mitotic abnormalities.

In the present study we have analysed a new radiation and HU sensitive mutant of S.pombe , rad31 , which displays a ` cut' phenotype in a small percentage of cells, even in the absence of radiation, in a manner reminiscent of hus5.62 ( 11 ). To further investigate the role of the rad31 gene, we cloned it by complementation of the UV sensitive and slow growth phenotypes. The gene product has homology to the Arabidopsis AXR1 protein ( 12 ), the human APP-BP1 protein ( 13 ), an S.cerevisiae open reading frame (ORF), as well as the N-terminal region of ubiquitin activating proteins (UBAs) (e.g. 14 ). We also demonstrate that the S.cerevisiae ORF complements the slow growth and radiation sensitive phenotypes of the rad31.d null allele. The Rad31 protein appears to be a novel member of a conserved family of UBA-related proteins which do not contain the conserved cysteine required for ubiquitin activation. Disruption of the gene is not lethal, however the cells grow slowly with a high proportion of the cells containing condensed chromosomes. The disruptants have a very high loss of minichromosomes. Epistasis analysis indicates that rad31 functions in a process which is defective in the checkpoint rad mutants, and more specifically, in a process requiring hus5 . The potential role of the Rad31 protein in damage tolerance/recovery from radiation is discussed.

MATERIALS AND METHODS

Strains and growth media

Schizosaccharomyces pombe strains used are listed in Table 1 . Escherichia coli strains, procedures and growth media used for the routine culture and maintenance of S.pombe strains were as described previously ( 15 ).

Table 1 . Schizosaccharomyces pombe strains Reference

sp.011

ade6-704, leu1-32, ura4-D18, h -

15

sp.074

rad15P, leu1-32, h +

15

sp.096

rad9::ura4, ade6.704, leu1-32, h -

23

sp.101

ade6-704, leu1-32, ura4-D18, h 90

15

sp.134

rad31-1, ade6-707, ura4-D18, leu1-32, h -

22

sp.148

rad17::ura4, ade6-704, leu1-32, h -

29

sp.150

rhp51::ura4, ade6-704, leu1-32, h +

27

sp.188

rad8::ura4, ade6.704, leu1-32, h +

28

sp.221

rad13::ura4, ade6-704, leu1-32, h +

25

sp.276

rad32::ura4, ade6-704, leu1-32, h +

22

sp.304

cdc10, ura4-D18, h +

V. Simanis pers. comm.

sp.306

wee1-50, ura4-D18, leu1-32, ade6.704, h +

31

sp.374

chk1::ura4, h +

4

sp.380

hus1::leu1, h +

9

sp.382

cdc22.M45, ade6-704, urad4-D18, leu1-32, h +

30

sp.376

hus5-62, ura4-D18, ade6-704, leu1-32, h +

11

sp.1235

Ch16(ade6-M216), ade6-M210, ura4-D18, leu1-32, h +

20

sp.X29

hhp2::leu1, ura4-D18, leu1-32, h +

26

Strains created during this study

sp.333

rad31::ura4, ade6-704, leu1-32, h -

sp.340

rad31::ura4, rad13::ura4, ade6-704, ura4-D18, leu1-32

sp.341

rad31::ura4, ade6-704, leu1,-32, h +

sp.385

rad31::ura4, chk1::ura4, ade6-704, leu1-32, h +

sp.387

rad31::ura4, hus1::leu1, ade6-704, h +

sp.389

rad31::ura4, hus5-62, ade6-704, h -

sp.400

rad31::ura4, wee1-50 ade6-704, h -

sp.414

rad31::ura4, cdc10, h +

sp.415

rad31::ura4, cdc22.M45, leu1-32, h -

sp.X31

rad31::ura4, Ch16(ade6-m216) , , ade6-m210, ura4-D18, h -

sp.X34

rad31::ura4, rad8::ura4, ade6-704, leu1-32 h -

sp.X35

rad31::ura4, hhp2::leu1, ade6-704, h +

sp.X36

rad31::ura4, rad17::ura4, ade6-704, leu1-32 h -

Cloning of the rad31 gene and cDNA from S.pombe and the RHC31 gene from S.cerevisiae

The pURSP1 and pURSP2 S.pombe genomic libraries ( 16 ) were used to transform a rad31-1 ura4-D18 strain (sp.134) to uracil prototrophy. Two selection procedures were used to isolate the rad31 gene. In one, the transformation plates were incubated for 12 h at 26oC and then shifted to 35oC for 5 days. In the other, 20 000 ura + transformants, obtained following incubation of the plates at 26oC for 5 days, were subjected to three rounds of selection following exposure to increased doses of UV irradiation as described in our previous work ( 15 ). Both procedures resulted in the isolation of an identical plasmid, pMS1. The rad31 cDNA was amplified by PCR using an S.pombe cDNA library ( 17 ) with the primers MS14 (GAAGAGGCCATGGGGAATCACA) and MS15 (TAGAAGGATCCTAAATAACAGAATACC). The amplified product was cloned into a T vector.

The RHC31 gene was amplified using S.cerevisiae (strain Y153) genomic DNA by PCR using primers Sc31a (ATCAGTAACCATGGATATG) and Sc31b (AGGTATGTAGATATCTAAA) and cloned into pREP1N (a modified version of pREP1 ( 18 ) in which the Nde I site has been replaced with an Nco I site).

DNA sequence analysis

The 3.5 kb Pst I- Sph I fragment containing the rad31 gene was cloned into M13 in both orientations and one clone was subjected to exonuclease III deletions as described by Henikoff ( 19 ). Overlapping deletions were sequenced and aligned by computer analysis. The opposite strand was sequenced using synthetic oligonucleotide primers. The four introns were confirmed by sequence analysis, using synthetic oligonucleotides, of the rad31 cDNA. The sequence has been submitted to the EMBL database and has the accession number Y08805.

Disruption of the rad31 gene


Figure 1 . Radiation survival. Comparison of UV ( a ) and ionising radiation ( b ) sensitivity of rad31-1 to other rad mutant strains and complementation of the rad31-1 mutation. sp.011, wt ( rad + ); rad9.d, sp.096; rad15P, sp.074; rad31, sp.134; rad32.d, sp.276; r31/MS1, sp.134 transformed with pMS1.

Two constructs were made in which the coding sequence of the rad31 gene was disrupted. In one, the 2.0 kb Eco RV fragment, encoding the C-terminal two thirds of the Rad31 protein, was replaced by the ura4 gene by the method described by Barbet et al . ( 16 ). Since this construct also removed 1.2 kb of sequence 3' to the rad31 gene and potentially disrupted other coding sequences a second construct was prepared by cloning the ura4 gene into the Hin dIII site within the coding region of the rad31 gene. Both disruption constructs were excised as Pst I- Sph I fragments and used to transform the diploid S.pombe strain sp.101. Two stable integrants from each transformation were shown, by Southern hybridisation, to contain a single ura4 insert at one of the two chromosomal rad31 loci (data not shown). Sporulation and tetrad analysis indicated that each tetrad yielded four haploid colonies, two rad31 - ura + and two rad + ura - . sp.333 contains the ura4 gene inserted at the Hin dIII site, while sp.341 contains the Eco RV deletion construct (Fig. 3 A). Both disruption strains have the same phenotype.

Table 2 . Percentage of aberrant morphologies in cultures of rad31 and hus5
Strain

Ennucleates

Stretched/fragmented

Condensed

cdc

cut

chromatin

chromosomes

rad31-1

25oC

2

6

7.5

18

2.5

35oC 3 h

2.5

7.5

15

20

4

rad31.d

25oC

1

3.5

10

24

2.5

35oC 3 h

3.5

7

12.5

28

5.5

hus5-62

25oC

0.5

1.5

2.5

11

0.5

35oC 3 h

1.5

5.5

12

20

3

% cells with aberrant morphologies was estimated as described by Al-Khodairy et al . (11).

Radiation survival and minichromosome loss assay

Gamma irradiation was carried out using a 137 Cs gamma source with a dose rate of 12 Gy/min. UV irradiation was carried out directly on freshly plated cells using a Stratagene `Stratalinker'. The minichromosome loss assay of Niwa et al . ( 20 ) was used as described in our previous work ( 21 ).

RESULTS

Characterisation of the rad31-1 mutant phenotype

The rad31-1 mutant was isolated during a search for new ionising radiation sensitive mutants undertaken with a view to identifying novel genes involved in recombination ( 22 ). The radiation sensitive phenotypes of the rad31-1 mutant were investigated following exposure to both UV and gamma irradiation (Fig. 1 a and b). At high doses of both UV and gamma radiation rad31-1 displays similar sensitivities to known recombination mutants, such as rad32.d ( 22 ) and is much less sensitive to both UV and ionising radiation than the checkpoint rad mutant rad9 ( 23 ). It is also much less sensitive to UV radiation than a nucleotide excision repair mutant, such as rad15 ( 15 ). However, at low doses of radiation (<600 Gy or 100 J/m 2 ) rad31-1 is relatively insensitive to both UV and ionising radiation, with sensitivities close to wild-type levels.

During routine handling, it was noted that cultures of rad31-1 mutant cells grew slowly (with 50% greater doubling time at 25oC and 66% greater at 35oC than wild-type cells) and stationary phase cultures contained a high proportion of inviable cells (5-6-fold that observed with wild-type cultures). Cell and nuclear morphologies of rad31-1 were therefore compared to wild-type. DAPI staining and microscopic analysis indicated that rad31-1 cells display an aberrant cell morphology and an apparent defect in chromosome segregation (Fig. 2 ). Cells were generally elongated and irregularly shaped, displaying a ` cut' phenotype in 2-3% cells at 25oC (Table 2 ), with the defects being more severe at 35oC. This aberrant morphology, seen even in the absence of DNA damage, suggests that the rad31 gene is likely to be required for a process in addition to, or other than, DNA repair. This phenotype is reminiscent of the `constant cut' phenotype of hus5.17 observed by Enoch et al . ( 9 ).


Cloning and sequencing of rad31


Figure 2 . Phenotypes of rad31-1 and rad31.d cells. ( a ) sp.011 ( rad + ); all cells have a single nucleus. ( b ) rad31 , an example of stretched chromatin (1) and a cdc phenotype (2). (c-e) rad31.d . ( c ) Examples of the different aberrant morphologies observed with rad31.d : fragmented chromatin (3), condensed chromosomes (4) and a ` cut' phenotype (5). ( d ) C ells at 25oC and ( e ) cells after 3 h incubation at 35oC.


Figure 3 . Molecular analysis of the rad31 gene. ( A ) Structure of the rad31 gene. (a) Restriction map of the rad31 gene. B, Bam HI; E, Eco RI; H, Hin dIII; P, Pst I; Sp, Sph I; V, Eco RV. Hatched boxes indicate vector sequences. (b) The Sph I- Pst I fragment complements the rad31-1 mutation whereas the Pst I- Eco RI and Hin dIII- Bam HI fragments do not. (c) The rad31 open reading fame (open boxes) is interrupted by four introns (closed boxes). (d) The two disruption constructs, where the ura4 gene has been inserted into the Hin dIII site or replaces the Eco RV fragment. ( B ) Comparison of the predicted Rad31 protein with the S.cerevisiae RHC31, Arabidopsis AXR1 and human APP-BP1 proteins. # = identical amino acids, ~ = conservative substitution. ( C ) Schematic diagram showing the relatedness of Rad31, Arabidopsis AXR1 and S.cerevisiae Uba1. * indicates position of conserved cysteine in Uba proteins.
Two selection procedures were used for the isolation of the rad31 gene, i.e. independent complementation of the radiation and temperature sensitive phenotypes of the rad31-1 mutant. Both procedures resulted in the isolation of an identical plasmid, pMS1 (Fig. 3 A), which is fully able to complement the UV and ionising radiation sensitive phenotypes of rad31-1 (Fig. 1 a and b).

DNA sequence analysis of pMS1 and a corresponding cDNA indicates a potential protein of 307 amino acids (aa) (Fig. 3 A) if four introns are present in the genomic sequence as suggested by the cDNA. The predicted protein has a molecular mass of 35 kDa and a PI of 5.3. Computer searches of the DNA databases indicate that the Rad31 sequence has homology to ubiquitin activating proteins (UBAs) (Fig. 3 B and C, Table 3 ), with the greatest identity in the N-terminal 100 aa (37%). More interestingly, the protein has homology to an ORF on chromosome XVI of S.cerevisiae , the Axr1 protein from Arabidopsis thaliana ( 12 ) and the human APP-BP1 protein which binds the C-terminal region of the amyloid precursor protein ( 13 ). Rad31 and the S.cerevisiae ORF (Swissprot accession number P30138), which we have renamed RHC31 (rad31 homologue in S.cerevisiae ) are more related to each other than either is to AXR1 or APP-BP1 (Table 3 ). As is also the case with Axr1 and APP-BP1, the Rad31 and RHC31 protein sequences do not contain the equivalent of the cysteine residue at aa 626 in the UBAs which has shown to be required for ubiquitin activation ( 24 ).

Disruption of the rad31 gene results in slow growth and mitotic defects

To determine whether the rad31 gene is essential for viability two gene disruption constructs were created as described in Materials and Methods (Fig. 3 A). We decided to create two constructs, since the first results in removal of 2 kb of DNA, but includes 1.2 kb of sequence downstream of the gene and hence may affect an adjacent gene, while the other involves disruption of the ORF at amino acid 77. Cells containing either of the disruptions are viable with the same mutant phenotype and the radiation and aberrant cell morphology phenotypes of both alleles can be complemented by the rad31 cDNA cloned in pREP41 (data not shown), indicating that all detectable phenotypes result from loss of a single gene. Cultures derived from rad31.d ura + spores grew slowly compared to wild-type strains and accumulated cells with aberrant cell and nuclear morphologies. DAPI staining of DNA indicated a number of differences between rad31.d and wild-type cells (Fig. 2 , Table 2 ). Firstly, the DNA in many rad31.d cells appeared to be in a condensed state (10% at 25oC), unlike the DNA in wild-type cells. In a small proportion of cells (~1% at 25oC) three discrete DAPI stained entities were detected, presumably representing the three S.pombe chromosomes. Secondly, 2.5% of cells at 25oC and 5.5% of the cells at 35oC displayed a ` cut' phenotype with septation occurring prior to completion of nuclear division and in some cases (1% at 25oC) there was evidence of stretched chromatin. Thirdly, at 35oC, 7% of the cells displayed spotty staining suggesting that the chromatin was being fragmented. Extensive culturing of the rad31.d strain resulted in cells with extremely low cell viability, presumably due to loss or fragmentation of the chromosomes (Fig. 4 a).

Table 3 Relatedness of Rad31 protein to other proteins

Rad31

RHC31

AtAXR1

APP-BP1

UBA1

Rad31

100

57/31

54/30

53/28

55/32

RHC31

100

55/30

55/36

58/30

AtAXR1

100

61/39

46/22

APP-BP1

100

49/23

UBA

100

UBA, S.cerevisiae UBA1 (14). First number of each pair, % identity; second number, % similarity.

Table 4 Minichromosome transmission
rad locus

Temperature

% loss/generation

Fold increase

(oC)

over wild-type at 23oC

Wild-type

23

0.019

1

Wild-type

35.5

0.029

1.5

rad31.d

23

9.95

524

rad31.d

35.5

13.45

708

rad32.d a

30

1.52

304

rad2.d b

30

0.63

126

rad9.d b

30

0.04

2

a Data from Tavassoli et al . (22). b Data from Murray et al . (21).

rad31-deleted cells retain the DNA damage and replication checkpoints

To determine whether the ` cut' phenotype observed in the absence of radiation was due to loss of the replication checkpoint, exponentially growing cells were exposed to 20 mM HU and sampled hourly. Unlike the checkpoint rad mutants, rad31.d cells are only slightly sensitive to HU (Fig. 4 b). Microscopic analysis of cell morphology after exposure to HU indicates that there is no increase in the frequency of the ` cut' phenotype in the first 6 h, and that cells are generally more elongated than untreated rad31.d cells (data not shown), indicating that the replication checkpoint is still intact. Exposure to 250 Gy ionising radiation also resulted in cell cycle arrest and elongated cells (data not shown) indicating that the radiation checkpoint is also functioning in rad31.d cells.

rad31-deleted strains show a very high incidence of loss of minichromosomes

The aberrant nuclear morphologies suggest that rad31 is defective in chromosome segregation. To investigate this, the minichromosome-loss assay of Niwa et al. ( 20 ) was used. The rad31.d and rad + strains containing the Ch16 minichromosome, sp.X31 and sp.1235 respectively, were grown at 25 and 35oC for 10 generations and then plated at 25oC and scored for loss of Ch16 (Table 4 ). The rad31.d strain showed a very high incidence of loss of the minichromosome, 9.9 and 13.4% loss per generation at 25 and 35.5oC respectively, compared to rad + cells (0.019 and 0.029%). a) b)


Figure 4 . Effect of stationary phase and exposure to HU on rad31.d cells. ( a ) Percent viability of stationary phase cells incubated at 25oC for 7 days and ( b ) effect of 20 mM HU on viability of wt (sp.011), rad31.d (sp.333) and rad17.d (sp.148).

Epistasis analysis

The phenotypes of both the original rad31-1 mutant and the null allele, rad31.d , suggest that rad31 functions in a pathway other than or in addition to a DNA repair pathway, but not an S/M or G2/M checkpoint process. To determine whether rad31 acts in any of the previously identified DNA damage response processes double mutants were created between rad31.d and rad13.d [defective in a nucleotide excision repair pathway, ( 25 )] and hhp2.d [deleted for one of the casein kinase II genes ( 26 )]. As anticipated, analysis of the radiation sensitivities of these double mutants (Fig. 5 a and b) indicate that rad31 functions in pathways other than nucleotide excision repair and other than one involving hhp2 . Attempts to create double mutants with rhp51.d ( 27 ) were unsuccessful which may suggest that rhp51 is required to repair damage present in rad31.d cells. Double mutants with rad8.d ( 28 ) indicate that rad31 functions in a process which is not defective in rad8 (Fig. 5 c). Double mutants with hus1.d (Fig. 5 d), a checkpoint rad mutant ( 9 ), indicate that rad31 and hus1 have a defect in a common pathway and this is confirmed with similar results for a double mutant with rad17.d (Fig. 5 e; 29 ). Double mutants with chk1.d ( 4 ) are extremely sensitive to radiation (Fig. 5 f), to virtually the same extent as a checkpoint rad mutant, in a manner reminiscent of hus5 ( 11 ). We therefore investigated whether rad31 and hus5 are required for a common process by analysing a rad31.d / hus5.d double mutant. This double mutant indicates no increase in sensitivity over that of the rad31.d single mutant (Fig. 5 g), indicating that indeed the rad31 and hus5 mutants are defective in a common process.

Genetic interactions


Figure 5 . UV survival analysis of rad31.d double mutants. rad31.d (sp.333) double mutants with ( a ) rad13.d (sp.221), ( b ) hhp2.d (sp.X29), ( c ) rad8.d (sp.188), ( d ) hus1.d (sp.380), ( e ) rad17.d (sp.148), ( f ) chk1.d (sp.374), ( g ) hus5-62 (sp.376). rad31 , by epistasis analysis, does not function in the nucleotide excision repair pathway nor in pathways involving hhp2 or rad8 , but falls into the damage tolerance pathway (defined by hus5 ), which is dependent on the checkpoint rad genes but not chk1 .

The hus5.62 mutant, in common with other S.pombe mutants defective in the feedback controls required for the dependency relationships within the cell cycle, displays a rapid death phenotype at 36oC in either a cdc22 or wee1.50 background ( 11 ). To investigate whether similar phenotypes are observed with rad31, double mutants were created with cdc10 , cdc22 ( 30 ) and wee1-50 ( 31 ) . In all cases cells showed loss of viability at 36oC compared to the rad31 , cdc10, cdc22 and wee1 single mutants (Fig. 6 ).


Figure 6 . Effect of temperature shift on rad31.d /cell cycle double mutants. ( a ) rad31 / cdc22 (31.d/c22), ( b ) rad31 / cdc10 (31.d/c10) and ( c ) rad31 / wee1 (31.d/w1) . Loss of viability is observed in double mutants of rad31.d with cdc22 (defective in ribonucleotide reductase), cdc10 (which displays pre-S phase arrest) and wee1 (which display small cell size at division).

A related gene exists in S.cerevisiae which can functionally complement the rad31D phenotype

Analysis of the sequence databases indicates that, apart from the UBA family of proteins, there are three other sequences related to Rad31, namely the AXR1 protein ( 12 ), the human APP-BP1 protein ( 13 ) and an ORF in S.cerevisiae identified through the genome sequencing project. The S.cerevisiae sequence [renamed here as rad homologue in S.cerevisiae ( RHC31 )] was isolated by PCR as described in Materials and Methods, and cloned into the S.pombe expression plasmid pREP1N. The RHC31 sequence was able to complement the slow growth and the radiation sensitive phenotypes of rad31.d (Fig. 7 ) indicating that rad31 and RHC31 are likely to be functional homologues.


Figure 7 . Complementation of the UV radiation sensitivity of rad31.d by S.cerevisiae RHC31 . sp.011, rad + ; 31.d/RHC31, rad31.d transformed with RHC31 cloned in pREP1N; 31.d/RN, rad31.d transformed with pREP1N alone. All cultures were grown in thiamine free minimal medium for 24 h prior to assay.

DISCUSSION

In S.pombe the DNA damage and replication checkpoints have been shown to require the functions of the checkpoint rad genes, rad1 , rad3 , rad9 , rad17 , rad26 and hus1 ( 2 - 4 , 9 ). The gene products are thought to act as a guardian complex and to signal to the mitotic machinery to arrest mitosis. The proteins have also been proposed to be required for a damage tolerance or recovery activity following the blocking of replication in the presence of DNA damage ( 9 ). The basis of this damage tolerance is unknown, but the fact that it is independent of the checkpoint functions has been demonstrated through analysis of the rad26.T12 allele which retains the damage checkpoint activity, but not the damage tolerance function ( 4 ). In contrast, the chk1 gene is required solely for the damage checkpoint function but not the damage tolerance activity ( 4 , 7 ).

Although the nature of the damage tolerance process is unknown, it has been shown to require a ubiquitin conjugating enzyme, Hus5 ( 11 ). Several recent reports on the human homologue to hus5 suggest that it interacts with a range of proteins including Rad51 ( 32 ), three subunits of the centromere DNA-binding core complex, CBF3 ( 33 ) and the human papilloma type 16 E1 replication protein ( 34 ). This range of interactions may explain the pleiotropic nature of the hus5 mutation which results in slow growth and defects in chromosome segregation and mitosis.

We have characterised a new S.pombe mutant which displays a `constant cut' phenotype reminiscent of hus5 , with low viability in stationary phase, indicating the rad31 gene product is required even in the absence of radiation and in non-cycling cells. The mutant also has a very high rate of loss of minichromosomes.

A single plasmid species (pMS1) was obtained independently by complementation of the radiation sensitivity and slow growth phenotype at 35oC. Despite extensive culturing, it was not possible to integrate pMS1 into the genome to formally prove that the gene is identical to the one where the original mutation lies, so the possibility exists that pMS1 encodes a suppressor. However, we believe that this is unlikely since the same plasmid was isolated by complementation of two different phenotypes, and that the phenotype of the genomic disruptions is similar to that of the rad31-1 mutant.

Sequence analysis indicates that the gene encodes a novel member of a ubiquitin activating protein-related family. Ubiquitin activating proteins (UBAs) are required for the initial step in the selective targeting of proteins by the covalent attachment of ubiquitin (reviewed in 35 ). The UBAs are involved in activating ubiquitin through the formation of a high energy thiol-ester linkage between a cysteine residue in the UBA and the C-terminal glycine residue of ubiquitin. The significance of the homology of the Rad31 protein to UBAs is unknown, particularly since the Rad31 protein does not contain the conserved cysteine required for ubiquitin activation in UBAs ( 24 ). It is interesting to note that the S.pombe and S.cerevisiae members are similar in length to one another and appear to be functional homologues. The AXR1 and APP-BP1 proteins both contain, in addition to the sequences conserved in the yeast proteins, an extra internal domain. In APP-BP1 this domain has been shown to be involved in the binding of the Alzheimer's amyloid precursor protein ( 13 ), suggesting that the domain is required for specific targeting of the protein. None of the four proteins contains the equivalent of the conserved cysteine residue required for activation of ubiquitin. While the involvement of AXR1 and APP-BP1 in ubiquitin-related processes has been speculated about ( 12 , 13 ), our data showing that rad31 and hus5 [a UBC, ( 11 )] are required for a common process strongly suggest that the rad31 member of this family is required for a ubiquitin-dependent process.

Ubiquitin-related processes have been shown to be associated with several cell cycle events. For example, there are several examples of ubiquitin-dependent modification and/or proteolysis of cyclins (e.g. 36 - 40 ). Other cell cycle-related events involve the requirement for a ubiquitin-conjugating protein (Cdc34) for passage from G1 to S ( 41 ) and in S.pombe the mts2 gene, which is required for chromosome segregation, has been shown to encode the 26S protease required for ubiquitin-dependent proteolysis ( 42 ). The S.cerevisiae homologue to hus5 ( UBC9 ) has been implicated in cyclin B destabilisation ( 39 ). However, the equivalent proteins in Xenopus and clam have not been demonstrated to have the ability to ubiquitinate cyclins ( 37 ). Unlike the case in S.cerevisiae , deletion of hus5 is not lethal ( 11 ) suggesting that in S.pombe hus5 may also not be involved with cyclin destruction.

Cyclosomes or APCs (anaphase promoting complexes) have recently been identified as cell cycle-regulated ubiquitin-protein ligases ( 34 ). They are required for entry into anaphase and have been demonstrated to be involved in cyclin B destruction. In addition, they have also been shown to be required for the ubiquitination of other proteins, e.g. proteins which function to inhibit sister chromatid separation, such as Cut2 ( 43 ). The phenotypes displayed by hus5 and rad31 mutants lead us to speculate that the gene products may be involved in directing ubiquitination of proteins other than cyclins which are targeted by the cyclosome.

Our results presented here provide the first indication that a member of this UBA-related family of proteins is actually associated with a ubiquitin-related process, however, the precise role of rad31 and the nature of the events for which it is required remain to be elucidated. We are now in a position to investigate whether there is Hus5-dependent ubiquitination of, for example, certain replication proteins and whether Rad31 has a role in this process.

ACKNOWLEDGEMENTS

We thank A.M. Carr and J.M. Murray for helpful discussions. The work was supported in part by CRC grants SP2212/0101 and SP2212/0102. CLD was supported by a BBSRC studentship. FZW thanks the Royal Society and the Wellcome Trust for travel grants.

REFERENCES

1 Weinert,T.A. and Hartwell,L.H. (1988) Science, 241, 317-322. MEDLINE Abstract

2 Al-Khodairy,F. and Carr,A.M. (1992) EMBO J., 11, 1343-1350.

3 Rowley,R., Subramani,S. and Young,P. (1992) EMBO J., 11, 1335-1342. MEDLINE Abstract

4 Al-Khodairy,F., Fotou,E., Sheldrick,K.S., Griffiths,D.J.F., Lehmann,A.R. and Carr,A.M. (1994) Mol. Biol. Cell, 5, 147-160.

5 Enoch,T. and Nurse,P. (1990) Cell, 60, 665-673. MEDLINE Abstract

6 Sheldrick,K.S. and Carr,A.M. (1993) Bioessays, 15, 775-782. MEDLINE Abstract

7 Walworth,N., Davey,S. and Beach,D. (1993) Nature, 363, 368-371. MEDLINE Abstract

8 Ford,J.C., Al-Khodairy,F., Fotou,E., Sheldrick,K.S., Griffiths,D.J.F. and Carr,A.M. (1994) Science, 265, 533-537. MEDLINE Abstract

9 Enoch,T., Carr,A.M. and Nurse,P. (1992) Genes Dev., 6, 2035-2046. MEDLINE Abstract

10 Hirano,T., Funahashi,S., Uemura,T. and Yanagida,M. (1986) EMBO J., 5, 2973-2979.

11 Al-Khodairy,F., Enoch,T., Hagan,I.M. and Carr,A.M. (1995) J. Cell Sci., 108, 475-486.

12 Leyser,H.M.O., Lincoln,C.A., Timpte,C., Lammer,D., Turer,J. and Estelle,M. (1993) Nature, 364, 161-164.

13 Chow,N., Korenberg,J.R., Chen,X.-N. and Neve,R.L. (1996) J. Biol. Chem., 271, 11393-11346.

14 McGrath,J.P., Jentsch,S. and Varshavsky,A. (1991) EMBO J., 10, 227-236. MEDLINE Abstract

15 Murray,J.M., Doe,C.L., Schenk,P., Carr,A.M., Lehmann,A.R. and Watts,F.Z. (1992) Nucleic Acids Res., 20, 2673-2678. MEDLINE Abstract

16 Barbet,N., Muriel,W.J. and Carr,A.M. (1992) Gene, 114, 59-66. MEDLINE Abstract

17 Fikes,J.D., Becker,D.M., Winston,F. and Guarente,L. (1990) Nature, 346, 291-294. MEDLINE Abstract

18 Maundrell,K. (1990) J. Biol. Chem., 265, 10857-10864. MEDLINE Abstract

19 Henikoff,S. (1984) Gene, 28, 351-359. MEDLINE Abstract

20 Niwa,O., Matsumoto,T. and Yanagida,M. (1986) Mol. Gen. Genet., 203, 397-405.

21 Murray,J.M., Tavassoli,M., Al-Harithy,R., Sheldrick,K.S., Lehmann,A.R., Carr,A.M. and Watts,F.Z. (1994) Mol. Cell. Biol., 14, 4878-4888. MEDLINE Abstract

22 Tavassoli,M., Shayeghi,M., Nasim,A. and Watts,F.Z. (1995) Nucleic Acids Res., 23, 383-388. MEDLINE Abstract

23 Murray,J.M., Carr,A.M., Lehmann,A.R. and Watts,F.Z. (1991) Nucleic Acids Res., 19, 3525-3531. MEDLINE Abstract

24 Hatfield,P.M. and Vierstra,R.D. (1992) J. Biol. Chem., 267, 14799-14803. MEDLINE Abstract

25 Carr,A.M., Sheldrick,K.S., Murray,J.M., Al-Harithy,R., Watts,F.Z. and Lehmann,A.R. (1993) Nucleic Acids Res., 21, 1345-1349. MEDLINE Abstract

26 Dhillon,M. and Hoekstra,M.F. (1994) EMBO J., 13, 2777-2788.

27 Muris,D.F.R., Vreeken,K., Carr,A.M., Broughton,B.C., Lehmann,A.R., Lohmann,P.H.M. and Pastink,A. (1993) Nucleic Acids Res., 21, 4586-4591.

28 Doe,C.L., Murray,J.M., Shayeghi,M., Hoskins,M., Lehmann,A.R., Carr,A.M. and Watts,F.Z. (1993) Nucleic Acids Res., 21, 5964-5971. MEDLINE Abstract

29 Griffiths,D.J.F., Barbet,N.C., McCready,S., Lehmann,A.R. and Carr,A.M. (1995) EMBO J., 14, 5812-5823.

30 Nasmyth,K.A. and Nurse,P. (1981) Mol. Gen. Genet., 182, 119-124.

31 Nurse,P. (1975) Nature, 256, 547-551.

32 Kovalenko,O.V., Plug,A.W., Haaf,T., Gonda,D.K., Ashley,T., Ward,D.C., Radding,C.M. and Golub,E.I. (1996) Proc. Natl. Acad. Sci USA., 93, 2958- 2963. MEDLINE Abstract

33 Jiang,W. and Koltin,Y. (1996) Mol. Gen. Genet., 251, 153-160. MEDLINE Abstract

34 Yasugi,T. and Howley,P.M. (1996) Nucleic Acids Res., 24, 2005-2010. MEDLINE Abstract

35 Hochstrasser,M. (1995) Curr. Opin. Cell Biol., 7, 215-223. MEDLINE Abstract

36 Murray,A.W., Solomon,M. and Kirschner,M.W. (1989) Nature, 339, 280-286. MEDLINE Abstract

37 King,R.W., Peters,J.-M., Tugendreich,S., Rolfe,M., Hieter,P. and Kirschner,M.W. (1995) Cell, 81, 279-288. MEDLINE Abstract

38 Irniger,S., Piatti,S., Michaelis,C. and Nasmyth,K. (1995) Cell, 81, 269-277. MEDLINE Abstract

39 Seufert,W., Futcher,B. and Jentsch,S. (1995) Nature, 373, 78-81. MEDLINE Abstract

40 Bai,C., Sen,P., Hofman,K., Ma,L., Goebl,M., Harper,J.W. and Elledge,S. (1996) Cell, 86, 263-274. MEDLINE Abstract

41 Goebl,M.G., Yochem,J., Jentsch,S., McGrath,J.P., Varshavsky,A. and Byers,B. (1988) Science, 241, 1331-1335. MEDLINE Abstract

42 Gordon,C., McGurk,G., Dillon,P., Rosen,C. and Hastie,N.D. (1993) Nature, 366, 355-357. MEDLINE Abstract

43 Funabiki,H., Yamano,H., Kumada,K., Nagao,K., Hunt,T. and Yanagida,M. (1996) Nature, 381, 438-441. MEDLINE Abstract


Return

*To whom correspondence should be addressed. Tel: +44 1273 678257; Fax: +44 1273 678433; Email: f.z.watts@sussex.ac.uk
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Plant Physiol.Home page
S. A. Saracco, M. J. Miller, J. Kurepa, and R. D. Vierstra
Genetic Analysis of SUMOylation in Arabidopsis: Conjugation of SUMO1 and SUMO2 to Nuclear Proteins Is Essential
Plant Physiology, September 1, 2007; 145(1): 119 - 134.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
E. A. Andrews, J. Palecek, J. Sergeant, E. Taylor, A. R. Lehmann, and F. Z. Watts
Nse2, a Component of the Smc5-6 Complex, Is a SUMO Ligase Required for the Response to DNA Damage
Mol. Cell. Biol., January 1, 2005; 25(1): 185 - 196.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
Y. Azuma, A. Arnaoutov, and M. Dasso
SUMO-2/3 regulates topoisomerase II in mitosis
J. Cell Biol., November 10, 2003; 163(3): 477 - 487.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
D. L. Taylor, J. C. Y. Ho, A. Oliver, and F. Z. Watts
Cell-cycle-dependent localisation of Ulp1, a Schizosaccharomyces pombe Pmt3 (SUMO)-specific protease
J. Cell Sci., March 15, 2002; 115(6): 1113 - 1122.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. C. Y. Ho, N. J. Warr, H. Shimizu, and F. Z. Watts
SUMO modification of Rad22, the Schizosaccharomyces pombe homologue of the recombination protein Rad52
Nucleic Acids Res., October 15, 2001; 29(20): 4179 - 4186.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S.-J. Li and M. Hochstrasser
The Yeast ULP2 (SMT4) Gene Encodes a Novel Protease Specific for the Ubiquitin-Like Smt3 Protein
Mol. Cell. Biol., April 1, 2000; 20(7): 2367 - 2377.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
K. Tanaka, J. Nishide, K. Okazaki, H. Kato, O. Niwa, T. Nakagawa, H. Matsuda, M. Kawamukai, and Y. Murakami
Characterization of a Fission Yeast SUMO-1 Homologue, Pmt3p, Required for Multiple Nuclear Events, Including the Control of Telomere Length and Chromosome Segregation
Mol. Cell. Biol., December 1, 1999; 19(12): 8660 - 8672.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
J. C. Pozo, C. Timpte, S. Tan, J. Callis, and M. Estelle
The Ubiquitin-Related Protein RUB1 and Auxin Response in Arabidopsis
Science, June 12, 1998; 280(5370): 1760 - 1763.
[Abstract] [Full Text]


Home page
Genes Dev.Home page
D. Lammer, N. Mathias, J. M. Laplaza, W. Jiang, Y. Liu, J. Callis, M. Goebl, and M. Estelle
Modification of yeast Cdc53p by the ubiquitin-related protein Rub1p affects function of the SCFCdc4 complex
Genes & Dev., April 1, 1998; 12(7): 914 - 926.
[Abstract] [Full Text]


Home page
Genes Dev.Home page
M. Ruegger, E. Dewey, W. M. Gray, L. Hobbie, J. Turner, and M. Estelle
The TIR1 protein of Arabidopsis functions in auxin response and is related to human SKP2 and yeast Grr1p
Genes & Dev., January 15, 1998; 12(2): 198 - 207.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
Y.-i. Kawabe, M. Seki, T. Seki, W.-S. Wang, O. Imamura, Y. Furuichi, H. Saitoh, and T. Enomoto
Covalent Modification of the Werner's Syndrome Gene Product with the Ubiquitin-related Protein, SUMO-1
J. Biol. Chem., July 7, 2000; 275(28): 20963 - 20966.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (221K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (34)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Shayeghi, M.
Right arrow Articles by Watts, F. Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shayeghi, M.
Right arrow Articles by Watts, F. Z.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?