Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (369K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (126)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Vispe, S.
Right arrow Articles by Defais, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vispe, S.
Right arrow Articles by Defais, M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research Pages 2859-2864  

Overexpression of Rad51 protein stimulates homologous recombination and increases resistance of mammalian cells to ionizing radiation
Introduction
Materials And Methods
   Bacteria and mammalian cell culture
   Genotoxic treatments and cell survival curves
   Cell cycle analysis and aphidicolin synchronisation
   Cloning and sequencing of hamster RAD51 cDNA
   Expression and recombination vectors, DNA transfection
   Southern blot analysis
   Western blot analysis
Results
   Cloning and expression of the hamster Rad51 cDNA
   CgRad51 is not induced after genotoxic treatment
   Overexpression of Rad51 stimulates in vivo homologous recombination between two adjacent homologous alleles
   Overexpression of CgRad51 confers a specific G2 resistance to ionizing radiation killing
Discussion
Acknowledgements
References

Overexpression of Rad51 protein stimulates homologous recombination and increases resistance of mammalian cells to ionizing radiation

Overexpression of Rad51 protein stimulates homologous recombination and increases resistance of mammalian cells to ionizing radiation

Stéphane Vispé, Christophe Cazaux, Claire Lesca, Martine Defais*

Institut de Pharmacologie et de Biologie Structurale, Centre National de la Recherche Scientifique, UPR 9062, 205 route de Narbonne, 31077 Toulouse cédex, France

Received March 24, 1998; Revised and Accepted April 28, 1998

DDBJ/EMBL/GenBank accession no. Y08202

ABSTRACT

Rad51 proteins share both structural and functional homologies with the bacterial recombinase RecA. The human Rad51 (HsRad51) is able to catalyse strand exchange between homologous DNA molecules in vitro. However the biological functions of Rad51 in mammals are largely unknown. In order to address this question, we have cloned hamster Rad51 cDNA and overexpressed the corresponding protein in CHO cells. We found that 2-3-fold overexpression of the protein stimulated the homologous recombination between integrated genes by 20-fold indicating that Rad51 is a functional and key enzyme of an intrachromosomal recombination pathway. Cells overexpressing Rad51 were resistant to ionizing radiation when irradiated in late S/G2 phase of the cell cycle. This suggests that Rad51 participate in the repair of double-strand breaks most likely by homologous recombination involving sister chromatids formed after the S phase.

INTRODUCTION

Homologous recombination is a fundamental process shared by organisms from bacteria to man. In Escherichia coli, recombination is catalysed by RecA protein and is involved in horizontal genetic transfer as well as repair of DNA damage such as DNA crosslinks, strand breaks and post-replication gaps (1). In eukaryotes it is well established that homologous recombination is essential during meiosis for correct segregation of homologous chromosomes and as a source of genetic diversity. But the role of recombination in DNA repair and tolerance is not well defined in higher eukaryotes. However, several results support the idea that homologous recombination plays a role in DNA repair in mammals (2). First, treatment of cells with various genotoxic agents increases the homologous recombination frequency between selectable genes (3-5). Second, hamster cells defective in the DNA-dependent protein kinase (DNA-PK) repair pathway of double-strand breaks (DSBs), are much more resistant to ionizing radiation when exposed in late S/G2 than in G1/early S phases of the cell cycle (6). This indicates a possible role of homologous recombination between newly-formed sister chromatids in DSB repair. Finally, the identification, from yeast to man, of E.coli RecA protein homologues, called Rad51, has greatly opened the research field of homologous recombination in eukaryotes (7).

The RecA homologue from Saccharomyces cerevisiae (ScRad51) shares both sequence and functional homologies with the bacterial protein (8-10). Like RecA, ScRad51 is able to catalyse in vitro strand exchange between homologous DNAs, though less efficiently (11,12). The reaction is stimulated by the addition of yeast proteins Rad55, Rad57, Rad52 and replication protein A (RP-A) (13-16). In vivo, ScRad51 is necessary for DSB repair occurring during mitotic and meiotic recombination, or following treatment with ionizing radiation and methyl methane sulfonate (MMS) (10,17,18). Like RecA, ScRad51 is transcriptionally induced after genotoxic treatment (8-10). cDNAs coding for RecA homologous proteins have also been isolated from many higher eukaryotes (19-21). Like ScRad51, the human HsRad51 protein has been shown by electron microscopy observation to form protein filaments on DNA which are similar to those formed by RecA (22,23). Furthermore, HsRad51 catalyses strand exchange reaction in vitro (24-26). As in yeast, this reaction is slow and requires additional factors such as human RP-A and HsRad52 (24,25,27). In vivo, Rad51 has been shown to associate with mouse meiotic chromosomes undergoing homologous recombination, and to relocalise to nuclear foci in cells treated by genotoxic agents (28,29). These results are consistent with possible roles of mammalian Rad51 in meiotic recombination as well as DNA repair. Rad51 is essential for mouse embryonic development and cell growth, suggesting a gain of function of the mammalian protein compared to RecA and ScRad51 (30,31). Accordingly, Rad51 has recently been shown to fulfil an essential role in the repair of endogeneous chromosome breaks in proliferating chicken B lymphocytes (32).

In order to investigate the recombination and DNA repair functions of Rad51 protein, we have cloned the Chinese hamster Cricetulus griseus corresponding cDNA (CgRAD51). The encoded protein CgRad51 was 98% identical to HsRad51. As Rad51 is an essential protein the development of overexpressing cells appeared to be a powerful tool to explore Rad51 functions. We show here that a 2-3-fold overexpression of CgRad51 in CHO cells stimulated 20-fold the spontaneous homologous recombination between chromosomal integrated genes. Interestingly, CgRad51 overproducing cells were resistant to ionizing radiation when irradiated specifically in late S/G2 phase of the cell cycle. These results indicate a key role of CgRad51 in both homologous recombination and ionizing radiation resistance.

MATERIALS AND METHODS

Bacteria and mammalian cell culture

Bacteria were grown in LB broth supplemented when required with zeocin (Cayla) at 20 µg/ml. AA8 Chinese Hamster Ovary (CHO) fibroblasts were obtained from the American Type Culture Collection (ATCC). These cells were grown in l-glutamine containing [alpha]-MEM medium (Gibco) supplemented with 10% foetal calf serum (Gibco), penicillin G-Streptomycin sulphate (Sigma).

Genotoxic treatments and cell survival curves

Cells were trypsinized, counted and 1 × 106 cells were plated in 10 cm dishes. Forty eight hours later, exponentially growing cells were incubated with fresh medium containing various concen-trations of either MMS, N-methyl-N[prime]-nitro-N-nitrosoguanidine (MNNG) obtained from Aldrich; mitomycin C (MMC) or cis-diamminedichloroplatinum(II) (cisplatin) obtained from Sigma. UV irradiation was done using a germicidal lamp emitting predominantly at 254 nm. [gamma]-irradiation was carried out at CERT ONERA (Toulouse) with a 60Co source at a dose rate of 2 Grays/min. At different times following these treatments cells were collected for protein, RNA or cell cycle analysis.

For survival measurements, cells were trypsinized after genotoxic treatment, counted, and various cell dilutions were seeded in 6 cm dishes. Cells were grown for 7-10 days, fixed, stained with crystal violet and colonies were counted.

Cell cycle analysis and aphidicolin synchronisation

To analyse the cell cycle distribution, cellular nuclear DNA was labelled with propidium iodide according to the Vindelov procedure (33) and analysed on a Becton Dickinson FACScan. To synchronise the cells in late S/G2, 25 cm2 flasks containing 9 × 105 cells were incubated in [alpha]-MEM containing 1 µg/ml aphidicolin (Sigma) for 14 h. The cells were then washed three times with 6 ml of medium and post-incubated 6-7 h before irradiation.

Cloning and sequencing of hamster RAD51 cDNA

Total RNAs were extracted from exponentially growing AA8 cells with a standard guanidin method (34). Poly(A) mRNA were purified using a Pharmacia Biotech mRNA Purification Kit[trade]. Corresponding cDNAs were synthesised using a Pharmacia T primed first strand kit[trade]. Two degenerated oligonucleotides including the two regions corresponding to the start and stop codons of mouse and human Rad51 proteins were designed, RAD51 sense: 5[prime]-ATGGCNATGCARATGCARCTTGA-3[prime] and RAD51 antisense: 5[prime]-CGCGGATCCTCYTTNGCRTCNCCNACNCCRTC-3[prime], where N is A+G+C+T, R is A+G and Y is C+T. These oligonucleotides served to PCR amplify a 1 kb fragment, using Pfu polymerase purchased from Stratagene for high fidelity of DNA synthesis. This fragment was subcloned in a pBluescript II KS (+/-) vector (pBS) purchased from Stratagene and sequenced on both strands. To sequence the 5[prime] and 3[prime] non-translated regions two pairs of internal oligonucleotides were designed, race5.1: GCAACAGCCTCCACCGTATG; race5.2: TAAGGATCCAGCTTCTTCTAATTTCTTC and race3.1: ACCAACCAGGTAGTAGCCCA; race3.2: TAAGGATCCGAAGAGGGGAGACCAGAATCT. RACE PCR was performed using a Clontech Marathon kit[trade]. Two amplified products were subcloned in a pBS vector and sequenced. These sequences were then used to amplify a cDNA containing the whole opened reading frame (ORF) which was then cloned in a pBS vector to generate a pBSRad51 vector.

EMBL accession number of the hamster RAD51 mRNA (CgRAD51) and of the deduced protein (CgRad51) sequences is Y08202.

Expression and recombination vectors, DNA transfection

CgRad51-overexpressing plasmid pZeoRad51 was constructed by PCR-amplifying the cDNA of CgRad51 from the pBSRad51 matrix with primers: TTTGGTACCATGGCTATGCAGATGCAGCTT and TTCTTCGAATCAGTCCTTGGCATCTCCTAC. The upstream oligonucleotide was designed in order to get an adenine at -3 position from the first ATG, which has been shown to strongly enhance gene expression (35). After a Asp718/BstBI double cut, the PCR product was inserted into a pZeoSV1 vector (Cayla VECT001) opened by the same endonucleasic digestion. pZeoSV1 gives high stable expression of proteins under the control of enhancer/promoter sequences from SV40 early region. This shuttle vector carries the Sh ble gene conferring resistance to zeocin and used as dominant marker for both E.coli and mammalian cell lines. pLrec plasmid contains a neo gene for selection of stable transfectants on G418 and two mutant bacterial lacZ genes, tandemly arranged. One copy, namely 5[prime][Delta]lacZ, is deleted in 5[prime] while the other, namely 3[prime]mut lacZ, is disrupted by a XhoI linker insertion. pNeoA carries an hygromycin resistance gene surrounded by two mutant neo genes in tandem. Both pLrec and pNeoA plasmids were kindly provided by Dr S. Meyn (36,37). CHO parental cells were transfected using the DMSO/polybrene shock procedure (38) by incubating cells with DNA/polybrene mixture for 6 h before treating them for 4 min with 30% DMSO. After a 62-h phenotypic expression, cells were diluted 1/10 then incubated in [alpha]-MEM medium supplemented with either 500 µg/ml zeocin, 600 µg/ml G418 (Sigma) or 350 µg/ml hygromycin (Clontech). Well isolated clones were picked after a 10-15-day selection. Stably transfected CHO cells were maintained in medium supplemented with 250 µg/ml zeocin, 350 µg/ml G418 or 250 µg/ml hygromycin. Recombination events were detected by [beta]-galactosidase production in confluent layer of pLrec transfected cells, fixed with 2% formaldehyde, 0.2% glutaraldehyde and incubated with 1 mg/ml Xgal (Biosynth AG), 2 mM MgCl2, 4 mM K ferricyanide, 4 mM K ferrocyanide during 6 h at 37°C. Recombination rates were derived from the number of positive LacZ cells or G418 resistant colonies detected and the total number of cells screened by using the fluctuation analysis tables provided by Capizzi and Jameson (39).

Southern blot analysis

Genomic DNA was purified from the cells using a standard procedure (40). These DNAs were restricted with BamHI enzyme and separated on a 0.7% agarose gel. DNA was transferred to a positively charged nylon membrane from Oncor, and prehybridised with 50% formamide, 10% dextran sulfate, 1% SDS and blocking reagents (Oncor). Genomic bands containing each lacZ gene were revealed using a 1.1 kb 32P-labelled pLrec SacI-ClaI fragment containing part of the lacZ gene. The correct integration of the vector generated a 4.2 kb fragment containing the 5[prime][Delta]lacZ copy and one or several larger junction fragments containing the 3[prime]mut lacZ copy along with genomic DNA (Fig. 2). 32P signals were revealed on a Storm scanner from Molecular Dynamics.

Western blot analysis

Twenty µg of cell extracts were electrophoresed in a 10% SDS-polyacrylamide gel. Proteins were transferred electrophoretically to PVDF membrane supplied by Millipore. Rad51 and actin proteins were revealed by incubating the membrane with purified rabbit polyclonal anti-human Rad51 at a dilution of 1/1000 (a generous gift of Dr C. Radding) and monoclonal anti-actin at a dilution of 1/10 000 (Chemicon International Inc.) respectively. These antibodies were revealed by alkaline phosphatase coupled antibodies (Sigma Immuno Chemicals) for chemifluorescence detection using the Amersham detection reagent. Protein expression was revealed by a Molecular Dynamics Storm scanner and quantified with the Image QuantR 4.2A software.

RESULTS

Cloning and expression of the hamster Rad51 cDNA

To study the role of Rad51 in repair and homologous recombination, we chose to use Chinese hamster cells as a model to take advantage of the variety of existing DNA repair mutants allowing future genetic studies. To clone the hamster Rad51 cDNA (CgRAD51) we designed degenerated oligonucleotides based on the sequences of the human and mouse Rad51 proteins, and amplified a 1 kb fragment by PCR. The product was subcloned in a pBS vector and sequenced. The 5[prime] and 3[prime] non-translated regions were obtained by RACE PCR, subcloned in a pBS vector and sequenced. The whole cDNA contains a potential ORF coding a 339 amino acid protein, with >98% identity with other mammalian Rad51 proteins. The CgRad51 differs by only 4 and 6 amino acids with the human and mouse proteins, respectively (data not shown). A NdeI-HindIII fragment of the cDNA was used to hybridise total and poly(A) RNAs extracted from AA8 cells, revealing two mRNA products, a major band migrating at 1.8 kb and corresponding probably to the mature mRNA, and a minor band migrating around 6.8 kb which could represent a pre-mRNA (data not shown). The corresponding protein detected by western blot had an estimated molecular weight of 40 kDa, identical to that observed in HeLa extracts (data not shown). The western blot was revealed with rabbit antibodies against HsRad51, taking advantage of the high identity of the two proteins.

CgRad51 is not induced after genotoxic treatment

In bacteria and yeast, RecA and ScRad51 are transcriptionally induced after genotoxic treatment. To determine the response of CgRad51 to such treatments, we exposed proliferating AA8 cells to various doses of the following DNA damaging agents: UV, [gamma]-rays, MMS, MNNG, cisplatin and MMC. At different times after these treatments, we quantified CgRad51 by western blot. Even though these agents gave rise to various lesions and lead to cell arrest in various phases of the cell cycle, no accumulation of CgRad51 was detected (data not shown).

Overexpression of Rad51 stimulates in vivo homologous recombination between two adjacent homologous alleles

In order to understand the biological roles of Rad51 protein in CHO cells, we cloned the cDNA in the pZeoSV1 vector, under the control of an SV40 enhancer promoter sequence. Extracts were prepared from cells stably transfected with either pZeoRad51 or pZeoSV1, as a control, and analysed by western blot (Fig. 1). Rad51 overexpression was determined in different clones after normalisation to the endogenous actin (Table 1). The mean overexpression ratio was ~3 ± 1.


Figure 1. Western blot detection of Rad51 expression in a pZeoSV1 transfected (SL2), and in three pZeoRad51 transfected clones (ZL6, ZL8, ZL9).


Figure 2. Southern blot of total BamHI restricted genomic DNA from control and overexpressing clones probed with a 32P-labelled SacI-ClaI fragment of pLrec. Lanes 1 and 2: control clones (SL1, SL2); lanes 3-6: overexpressing clones (ZL5, ZL6, ZL8, ZL9). The 4.2 kb fragment contains the 5[prime][Delta]lacZ copy and the junction fragments contain the 3[prime]mut lacZ.

Rad51 catalyses in vitro strand exchange. We therefore expected that an overexpression of the protein would influence in vivo homologous recombination. We thus transfected recombinase-overexpressing clones with a reporter vector for recombination, pLrec, carrying two different alleles of E.coli lacZ gene as recombination substrates surrounding a neo gene for selection of stable transformants (36). Correct integration of both recombination substrates was controlled by Southern blotting using a radiolabelled probe targeting both lacZ alleles (Fig. 2). We determined the proportions of cells expressing [beta]-galactosidase by X-gal staining pZeoSV1- or pZeoRad51-transfected cells having integrated pLrec (Fig. 3). The number of blue cells is directly correlated with the frequency of mitotic intrachromosomal recombination (Table 1). The mean recombination rate of control cells (2.7 × 10-5) was similar to those measured by other groups using vectors reporting intrachromosomal recombination in mouse (36,41), monkey (42) or hamster cells (5,43). pZeoRad51-transfected cells presented an increase in homologous recombination of ~20-fold (mean recombination rate of 59 × 10-5) compared to cells transfected with the control pZeoSV1 plasmid (Table 1). The results were confirmed by stably transfecting pZeoSV1 and pZeoRad51 cells, with the pNeoA vector in which the recombination substrates are two copies of differently mutated neo genes giving rise to G418 resistant clones upon recombination. In this system, homologous recombination rates in either overexpressing or control clones were comparable to those obtained with the pLrec system and the pZeoRad51 clones showed a 25-fold stimulation of recombination (Table 1).


Figure 3. Detection of recombination events by [beta]-galactosidase production. Cells were fixed, then incubated with X-Gal.(A) Control cells. (B) Rad51 overexpressing cells. Arrows indicate positive blue cells.

Overexpression of CgRad51 confers a specific G2 resistance to ionizing radiation killing

The repair of DSBs is primarily carried out by the Ku-DNA-PK repair pathway in mammalian cells while in yeast it is driven by proteins of the Rad52 epistasis group (44). However, there are some indications that homologous recombination could also be involved in DSB repair in mammalian cells (2,44). We therefore asked whether CgRad51 overexpression influences cell resistance to ionizing radiation. When an asynchronous CHO population was irradiated, no significant difference in the survival of both cell types was observed, except at high doses for which overexpressing cells were slightly less sensitive (Fig. 4E). In asynchronous population, cells were mostly in G1 and S phases (Fig. 4A and B). Because homologous recombination is thought to act more frequently once sister chromatids are formed, we synchronised the same clones with aphidicolin. This base analogue blocks the cells in early S phase. Six to seven hours after release of this block, cells were mainly in late S and G2 phases (Fig. 4C and D). Microscopic observation of the cells stained with DAPI showed that the proportion of mitotic cells remained under 8% in these conditions (data not shown). As shown in Figure 4F, in G2 phase CgRad51 overexpressing cells were more resistant to ionizing radiation killing than control cells, suggesting that a recombination process has taken place leading to a better survival.

DISCUSSION

In this study, we cloned the cDNA coding the hamster Rad51 protein and found that the deduced protein was >98% identical to the human and mouse homologues, thereby confirming the high conservation of the protein among mammals. We could not detect any accumulation of CgRad51 after various genotoxic treatments. Similarly, in human cells, Rad51 has been shown to relocalize in nuclear foci rather than to accumulate after such treatment (28). It appears then that Rad51 regulation could be different in mammalian cells compared with Saccharomyces cerevisiae and E.coli, ScRad51 and RecA proteins being induced by DNA damage. A high constitutive level of CgRad51 in CHO cells could explain the absence of induction. Consistent with this hypothesis, it has been shown recently that immortal human cells possess more Rad51 than primary cells, suggesting then that a high amount of this protein could be a general feature of immortal cell lines (45).

Table 1. Intrachromosomal recombination rates in Rad51-overexpressing CHO cells
CHO transfected witha Clone
names		 Rad51 overexpression
ratiob		 Recombination rate = ×10-5
recombinants/cell generation
pLrec + pZeoSV1 SL1 1 3
  SL2 1 2.5
pNeoA + pZeoSV1 SN1 1 0.8
  SN2 1 3.5
pLrec + pZeoRad51 ZL5 NDc 34
  ZL6 2 63
  ZL8 3 50
  ZL9 3 89
pNeoA + pZeoRad51 ZN5 2 60
  ZN8 3 57
aParental cells were stably transfected with either plasmids pLrec or pNeoA and pZeoSV1 or pZeoRad51 as described in Materials and Methods.
bOverexpression ratios of Rad51 were determined by comparing immunodetected protein levels from extracts of cells transfected by pZeoRad51 and pZeoSV1.
cNot determined.

To investigate the role of Rad51 in homologous recombination and DNA repair, we analysed the consequences of overexpressing the protein in CHO cells. A 2-4-fold overexpression of Rad51 increased the rate of intrachromosomal recombination by a factor of 20 in hamster cells. In addition, CgRad51 was able to promote in vivo recombination in a [Delta]recA E.coli strain when expressed from the RecA promoter sequence, though less efficiently than RecA itself (data not shown). Taken together these results demonstrate clearly that Rad51 is a key protein for in vivo homologous recombination. Accordingly, a recent study reported that Rad51 is required for SV40 large T antigen induction of recombination in immortalised human cells (45). In vitro, human Rad51, purified from recombinant bacteria extracts, has been shown to efficiently promote DNA strand exchange only in the presence of protein cofactors such as hRPA and HsRad52 (25,27). Hence, other proteins are likely required for efficient recombination in the cell. We report that a relatively low level of overexpression of Rad51 induces a high rate of recombination in vivo. This implies that the intracellular pool of cofactors is not limiting and that the additional amount of Rad51 is able to recruit an efficient recombinosome.

The repair of DSBs is primarily mediated by the DNA-PK pathway (44,46). However, there is evidence that homologous recombination can contribute to survival when cells are irradiated in late S/G2 phase of the cell cycle (44). When asynchronous CgRad51 cells were irradiated, only a slight resistance compared to the control was observed at high doses (Fig. 4E). This improved survival may reflect a protective role of the increased pool of CgRad51 for the late S/G2 cell fraction overexpressing the protein (Fig. 4C and D). Strong evidence for a role of Rad51 in survival clearly appeared when both cell lines were irradiated in late S/G2 phase (Fig. 4F). The CgRad51 overproducer was significantly more resistant than the parental cell line when cells had just undergone DNA replication. This suggests that if the proper substrates (i.e., sister chromatids) are present, recombination repair of DSBs can occur. In support of this hypothesis, it has previously been reported that in S.cerevisiae, sister chromatids are preferred over homologous chromosomes as substrates for homologous recombination repair of X-ray damage (47). In yeast, the Rad52 epistasis group including Rad51 participate in DSB repair by recombination (10,17,18,48). Recently, overexpression of HsRad52 in monkey cells has also been reported to stimulate spontaneous homologous recombination and enhance resistance to gamma rays, though to a lower extent than that observed in this work, maybe due to a non-synchronisation of the cells (42). Thus, the radioresistance associated with the overproduction of Rad51 and Rad52 proteins provides evidence for the existence of a DSB repair pathway by homologous recombination in mammalian cells depending on both proteins and operating after DNA replication. It is then conceivable that other lesions such as post-replication gaps or DNA crosslinks could be substrates of this recombination repair process.


Figure 4. Survival to ionizing radiation treatment of asynchronous and late S/G2 synchronised Rad51 overexpressing and control cells.(A-D) Cell cycle distribution of control and overexpressing cells at the time of irradiation:(A) asynchronous control cells;(B) asynchronous overexpressing cells;(C) synchronised control cells; (D) synchronised overexpressing cells.(E) [gamma]-ray survival of two asynchronous representative clones; a control (closed triangles) and a CgRad51 overproducer (open circles). (F) [gamma]-ray survival of the same cells synchronised in late S/G2. The survival curves correspond to three independent experiments in which three dishes have been counted per dose.

ACKNOWLEDGEMENTS

We thank J. Bourrieau and L. Bonora from the CERT ONERA for making the 60Co source available and for help with the irradiation. We are indebted to B. Raynaud and M. Gares for help in the cloning experiments. We thank N. Johnson for critical reading of the manuscript. The work was partly supported by grants from the Association pour la Recherche sur le Cancer (ARC) nos 6211 and 9238 to M. Defais. Stéphane Vispé is a recipient of an ARC fellowship.

REFERENCES

1. Friedberg, E. C., Walker, G. C. and Siede, W. (1995) DNA Repair and Mutagenesis. ASM press, Washington.

2. Thompson, L. H. (1996) Mutat Res., 363, 77-88. MEDLINE Abstract

3. Hellgren, D. (1992) Mutat. Res., 284, 37-51. MEDLINE Abstract

4. Li, J., Ayyadevara, R. and Shmookler Reis, R. J. (1997) Mutat. Res., 385, 173-193. MEDLINE Abstract

5. Zhang, L. H. and Jenssen, D. (1994) Carcinogenesis, 15, 2303-2310. MEDLINE Abstract

6. Whitmore, G. F. (1989) Int. J. Radiat. Biol., 56, 657-665. MEDLINE Abstract

7. Brendel, V., Brocchieri, L., Sandler, S. J., Clark, A. J. and Karlin, S. (1997) J. Mol. Evol., 44, 528-541. MEDLINE Abstract

8. Aboussekhra, A., Chanet, R., Adjiri, A. and Fabre, F. (1992) Mol. Cell. Biol., 12, 3224-3234. MEDLINE Abstract

9. Basile, G., Aker, M. and Mortimer, R. K. (1992) Mol. Cell. Biol., 12, 3235-3246. MEDLINE Abstract

10. Shinohara, A., Ogawa, H. and Ogawa, T. (1992) Cell, 69, 457-470. MEDLINE Abstract

11. Sung, P. and Robberson, D. L. (1995) Cell, 82, 453-461. MEDLINE Abstract

12. Namsaraev, E. and Berg, P. (1997) Mol. Cell. Biol., 17, 5359-5368. MEDLINE Abstract

13. New, J. H., Sugiyama, T., Zaitseva, E. and Kawalczykowski, S. C. (1998) Nature, 391, 407-410. MEDLINE Abstract

14. Shinohara, A. and Ogawa, T. (1998) Nature, 391, 404-407. MEDLINE Abstract

15. Sung, P. (1997) Genes Dev., 11, 1111-1121. MEDLINE Abstract

16. Sugiyama, T., Zaitseva, E. M. and Kowalczykowski, S. C. (1997)J. Biol. Chem., 272, 7940-7945. MEDLINE Abstract

17. Resnick, M. A. (1987) In Moens, P. B. (ed.), The Meiosis. Academic Press, New York, pp. 157-210.

18. Petes, T. D., Malone, R. E. and Symington, L. S. (1991) In Broach, J. R., Pringle, J. and Jones, E. (eds), The Molecular Biology and Cellular Biology of the Yeast Saccharomyces: Genome Dynamics, Protein Synthesis and Energetics. Cold Spring Harbor Laboratory, NY, pp. 407-521.

19. Yoshimura, Y., Morita, T., Yamamoto, A. and Matsushiro, A. (1993) Nucleic Acids Res., 21, 1665. MEDLINE Abstract

20. Shinohara, A., Ogawa, H., Matsuda, Y., Ushio, N., Ikeo, K. and Ogawa, T. (1993) Nat. Genet., 4, 239-243. MEDLINE Abstract

21. Bezzubova, O., Shinohara, A., Mueller, R. G., Ogawa, H. andBuerstedde, J. M. (1993) Nucleic Acids Res., 21, 1577-1580. MEDLINE Abstract

22. Ogawa, T., Yu, X., Shinohara, A. and Egelman, E. H. (1993) Science, 259, 1896-1899. MEDLINE Abstract

23. Benson, F. E., Stasiak, A. and West, S. C. (1994) EMBO J., 13, 5764-5771. MEDLINE Abstract

24. Baumann, P., Benson, F. E. and West, S. C. (1996) Cell, 87, 757-766. MEDLINE Abstract

25. Baumann, P. and West, S. C. (1997) EMBO J., 16, 5198-5206. MEDLINE Abstract

26. Gupta, R. C., Bazemore, L. R., Golub, E. I. and Radding, C. M. (1997) Proc. Natl. Acad. Sci. USA, 94, 463-468. MEDLINE Abstract

27. Benson, F. E., Baumann, P. and West, S. C. (1998) Nature, 391, 401-404. MEDLINE Abstract

28. Haaf, T., Golub, E. I., Reddy, G., Radding, C. M. and Ward, D. C. (1995) Proc. Natl. Acad. Sci. USA, 92, 2298-2302. MEDLINE Abstract

29. Barlow, A. L., Benson, F., West, S. C. and Hultén, M. A. (1997) EMBO J., 16, 5207-5215. MEDLINE Abstract

30. Lim, D. S. and Hasty, P. (1996) Mol. Cell. Biol., 16, 7133-7143. MEDLINE Abstract

31. Tsuzuki, T., Fujii, Y., Sakumi, K., Tominaga, Y., Nakao, K., Sekiguchi, M., Matsushiro, A., Yoshimura, Y. and Morita, T. (1996) Proc. Natl. Acad. Sci. USA, 93, 6236-6240. MEDLINE Abstract

32. Sonoda, E., Sasaki, M. S., Buerstedde, J. M., Bezzubova, O., Shinohara, A., Ogawa, H., Takata, M., Yamaguchi-Iwai, Y. and Takeda, S. (1998) EMBO J., 17, 598-608. MEDLINE Abstract

33. Vindelov, L., Christensen, I. and Nissen, N. (1983) Cytometry, 3, 323-327. MEDLINE Abstract

34. Kingston, R. E. (1997) In Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. and Struhl, K. (eds), Current Protocols in Molecular Biology. John Wiley and Sons, Inc., Vol. 1, pp. 4.2.1-4.2.2.

35. Chen, H., Pomeroy-Cloney, L., Bjerknes, M., Tam, J. and Jay, E. (1994) J. Mol. Biol., 240, 20-27. MEDLINE Abstract

36. Herzing, L. and Meyn, M. (1993) Gene, 137, 163-169. MEDLINE Abstract

37. Meyn, S. M. (1993) Science, 260, 1327-1330. MEDLINE Abstract

38. Kawai, S. and Nishizawa, M. (1984) Mol. Cell. Biol., 4, 1172-1174. MEDLINE Abstract

39. Capizzi, R. and Jameson, J. (1973) Mutat. Res., 17, 147-148. MEDLINE Abstract

40. Moore, D. (1997) In Ausubel, F. M., Brent, R., Kingston, R. E.,Moore, D. D., Seidman, J. G., Smith, J. A. and Struhl, K. (eds), Current Protocols in Molecular Biology. John Wiley and Sons, Inc., Vol. 1, pp. 2.2.1-2.2.3.

41. Bertrand, P., Rouillard, D., Boulet, A., Levalois, C., Soussi, T. and Lopez, B. S. (1997) Oncogene, 14, 1117-1122. MEDLINE Abstract

42. Park, M. S. (1995) J. Biol. Chem., 270, 15467-15470. MEDLINE Abstract

43. Hellgren, D., Luthman, H. and Lambert, B. (1989) Mutat Res., 210, 197-206. MEDLINE Abstract

44. Jeggo, P. A. (1997) Mutat. Res., 384, 1-14. MEDLINE Abstract

45. Xia, S. J., Shammas, M. A. and Shmookler Reis, R. J. (1997)Mol. Cell. Biol., 17, 7151-7158. MEDLINE Abstract

46. Lee, S. E., Mitchell, R. A., Cheng, A. and Hendrickson, E. A. (1997)Mol. Cell. Biol., 17, 1425-1433. MEDLINE Abstract

47. Kadyk, L. C. (1992) Genetics, 132, 387-402. MEDLINE Abstract

48. Osman, F. and Subramani, S. (1998) Prog. Nucleic Acid Res. Mol. Biol., 58, 263-299. MEDLINE Abstract

*To whom correspondence should be addressed. Tel: +33 5 61 17 59 71; Fax : +33 5 61 17 59 94; Email:defais{at}ipbs.fr

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 4 Jun 1998
Copyright©Oxford University Press, 1998.
Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Nucleic Acids ResHome page
D. Schild and C. Wiese
Overexpression of RAD51 suppresses recombination defects: a possible mechanism to reverse genomic instability
Nucleic Acids Res., November 26, 2009; (2009) gkp1063v1.
[Abstract] [Full Text] [PDF]

Home page
 Clin. Cancer Res.Home page
T. Yan, Y. Seo, and T. J. Kinsella
Differential Cellular Responses to Prolonged LDR-IR in MLH1-Proficient and MLH1-Deficient Colorectal Cancer HCT116 Cells
Clin. Cancer Res., November 15, 2009; 15(22): 6912 - 6920.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
X. Liu, E. K. Han, M. Anderson, Y. Shi, D. Semizarov, G. Wang, T. McGonigal, L. Roberts, L. Lasko, J. Palma, et al.
Acquired Resistance to Combination Treatment with Temozolomide and ABT-888 Is Mediated by Both Base Excision Repair and Homologous Recombination DNA Repair Pathways
Mol. Cancer Res., October 1, 2009; 7(10): 1686 - 1692.
[Abstract] [Full Text] [PDF]

Home page
 Mol Cancer ResHome page
J.-C. Ko, S.-C. Ciou, J.-Y. Jhan, C.-M. Cheng, Y.-J. Su, S.-M. Chuang, S.-T. Lin, C.-C. Chang, and Y.-W. Lin
Roles of MKK1/2-ERK1/2 and Phosphoinositide 3-Kinase-AKT Signaling Pathways in Erlotinib-Induced Rad51 Suppression and Cytotoxicity in Human Non-Small Cell Lung Cancer Cells
Mol. Cancer Res., August 1, 2009; 7(8): 1378 - 1389.
[Abstract] [Full Text] [PDF]

Home page
 Molecular Cancer TherapeuticsHome page
J.-C. Ko, J.-H. Hong, L.-H. Wang, C.-M. Cheng, S.-C. Ciou, S.-T. Lin, M.-Y. Jheng, and Y.-W. Lin
Role of repair protein Rad51 in regulating the response to gefitinib in human non-small cell lung cancer cells
Mol. Cancer Ther., November 1, 2008; 7(11): 3632 - 3641.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
J.-C. Ko, S.-C. Ciou, C.-M. Cheng, L.-H. Wang, J.-H. Hong, M.-Y. Jheng, S.-T. Ling, and Y.-W. Lin
Involvement of Rad51 in cytotoxicity induced by epidermal growth factor receptor inhibitor (gefitinib, IressaR) and chemotherapeutic agents in human lung cancer cells
Carcinogenesis, July 1, 2008; 29(7): 1448 - 1458.
[Abstract] [Full Text] [PDF]

Home page
 GENES CELLSHome page
J. Nomme, Y. Takizawa, S. F. Martinez, A. Renodon-Corniere, F. Fleury, P. Weigel, K.-i. Yamamoto, H. Kurumizaka, and M. Takahashi
Inhibition of filament formation of human Rad51 protein by a small peptide derived from the BRC-motif of the BRCA2 protein.
Genes Cells, May 1, 2008; 13(5): 471 - 481.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
V. Tripathi, S. Kaur, and S. Sengupta
Phosphorylation-dependent interactions of BLM and 53BP1 are required for their anti-recombinogenic roles during homologous recombination
Carcinogenesis, January 1, 2008; 29(1): 52 - 61.
[Abstract] [Full Text] [PDF]

Home page
 Neuro Oncol DukeHome page
S. C. Short, C. Martindale, S. Bourne, G. Brand, M. Woodcock, and P. Johnston
DNA repair after irradiation in glioma cells and normal human astrocytes
Neuro-oncol, October 1, 2007; 9(4): 404 - 411.
[Abstract] [Full Text] [PDF]

Home page
 Ann OncolHome page
M. Voso, E Fabiani, F D'Alo', F Guidi, A Di Ruscio, S Sica, L Pagano, M Greco, S Hohaus, and G Leone
Increased risk of acute myeloid leukaemia due to polymorphisms in detoxification and DNA repair enzymes
Ann. Onc., September 1, 2007; 18(9): 1523 - 1528.
[Abstract] [Full Text] [PDF]

Home page
 Molecular Cancer TherapeuticsHome page
J. A.F. Hannay, J. Liu, Q.-S. Zhu, S. V. Bolshakov, L. Li, P. W.T. Pisters, A. J.F. Lazar, D. Yu, R. E. Pollock, and D. Lev
Rad51 overexpression contributes to chemoresistance in human soft tissue sarcoma cells: a role for p53/activator protein 2 transcriptional regulation
Mol. Cancer Ther., May 1, 2007; 6(5): 1650 - 1660.
[Abstract] [Full Text] [PDF]

Home page
 GENES CELLSHome page
S. So, Y. Nomura, N. Adachi, Y. Kobayashi, T. Hori, Y. Kurihara, and H. Koyama
Enhanced gene targeting efficiency by siRNA that silences the expression of the Bloom syndrome gene in human cells
Genes Cells, April 1, 2006; 11(4): 363 - 371.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
G. J. Duigou and C. S. H. Young
Replication-Competent Adenovirus Formation in 293 Cells: the Recombination-Based Rate Is Influenced by Structure and Location of the Transgene Cassette and Not Increased by Overproduction of HsRad51, Rad51-Interacting, or E2F Family Proteins
J. Virol., May 1, 2005; 79(9): 5437 - 5444.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
R. Fan, T. S. Kumaravel, F. Jalali, P. Marrano, J. A. Squire, and R. G. Bristow
Defective DNA Strand Break Repair after DNA Damage in Prostate Cancer Cells: Implications for Genetic Instability and Prostate Cancer Progression
Cancer Res., December 1, 2004; 64(23): 8526 - 8533.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
N. Saleh-Gohari and T. Helleday
Conservative homologous recombination preferentially repairs DNA double-strand breaks in the S phase of the cell cycle in human cells
Nucleic Acids Res., July 13, 2004; 32(12): 3683 - 3688.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
J. S. Russell, K. Brady, W. E. Burgan, M. A. Cerra, K. A. Oswald, K. Camphausen, and P. J. Tofilon
Gleevec-Mediated Inhibition of Rad51 Expression and Enhancement of Tumor Cell Radiosensitivity
Cancer Res., November 1, 2003; 63(21): 7377 - 7383.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
A. Ivanov, M. S. Cragg, J. Erenpreisa, D. Emzinsh, H. Lukman, and T. M. Illidge
Endopolyploid cells produced after severe genotoxic damage have the potential to repair DNA double strand breaks
J. Cell Sci., October 15, 2003; 116(20): 4095 - 4106.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. L. Donahue, R. Lundberg, R. Saplis, and C. Campbell
Deficient Regulation of DNA Double-strand Break Repair in Fanconi Anemia Fibroblasts
J. Biol. Chem., August 8, 2003; 278(32): 29487 - 29495.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. P. Linke, S. Sengupta, N. Khabie, B. A. Jeffries, S. Buchhop, S. Miska, W. Henning, R. Pedeux, X. W. Wang, L. J. Hofseth, et al.
p53 Interacts with hRAD51 and hRAD54, and Directly Modulates Homologous Recombination
Cancer Res., May 15, 2003; 63(10): 2596 - 2605.
[Abstract] [Full Text] [PDF]

Home page
 J BiochemHome page
K.-i. Yoshioka, Y. Yumoto-Yoshioka, F. Fleury, and M. Takahashi
pH- and Salt-Dependent Self-Assembly of Human Rad51 Protein Analyzed as Fluorescence Resonance Energy Transfer between Labeled Proteins
J. Biochem., May 1, 2003; 133(5): 593 - 597.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
R. Aloyz, Z.-Y. Xu, V. Bello, J. Bergeron, F.-Y. Han, Y. Yan, A. Malapetsa, M. A. Alaoui-Jamali, A. M. V. Duncan, and L. Panasci
Regulation of Cisplatin Resistance and Homologous Recombinational Repair by the TFIIH Subunit XPD
Cancer Res., October 1, 2002; 62(19): 5457 - 5462.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
P. M. Kim, K. S. Paffett, J. A. Solinger, W.-D. Heyer, and J. A. Nickoloff
Spontaneous and double-strand break-induced recombination, and gene conversion tract lengths, are differentially affected by overexpression of wild-type or ATPase-defective yeast Rad54
Nucleic Acids Res., July 1, 2002; 30(13): 2727 - 2735.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
A. Slupianek, G. Hoser, I. Majsterek, A. Bronisz, M. Malecki, J. Blasiak, R. Fishel, and T. Skorski
Fusion Tyrosine Kinases Induce Drug Resistance by Stimulation of Homology-Dependent Recombination Repair, Prolongation of G2/M Phase, and Protection from Apoptosis
Mol. Cell. Biol., June 15, 2002; 22(12): 4189 - 4201.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
C. Wiese, A. J. Pierce, S. S. Gauny, M. Jasin, and A. Kronenberg
Gene Conversion Is Strongly Induced in Human Cells by Double-strand Breaks and Is Modulated by the Expression of BCL-xL
Cancer Res., March 1, 2002; 62(5): 1279 - 1283.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
E. Raderschall, K. Stout, S. Freier, V. Suckow, S. Schweiger, and T. Haaf
Elevated Levels of Rad51 Recombination Protein in Tumor Cells
Cancer Res., January 1, 2002; 62(1): 219 - 225.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
E. Raderschall, A. Bazarov, J. Cao, R. Lurz, A. Smith, W. Mann, H.-H. Ropers, J. M. Sedivy, E. I. Golub, E. Fritz, et al.
Formation of higher-order nuclear Rad51 structures is functionally linked to p21 expression and protection from DNA damage-induced apoptosis
J. Cell Sci., January 1, 2002; 115(1): 153 - 164.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
P. M. Kim, C. Allen, B. M. Wagener, Z. Shen, and J. A. Nickoloff
Overexpression of human RAD51 and RAD52 reduces double-strand break-induced homologous recombination in mammalian cells
Nucleic Acids Res., November 1, 2001; 29(21): 4352 - 4360.
[Abstract] [Full Text] [PDF]

Home page
 CarcinogenesisHome page
K. Bishay, K. Ory, M.-F. Olivier, J. Lebeau, C. Levalois, and S. Chevillard
DNA damage-related RNA expression to assess individual sensitivity to ionizing radiation
Carcinogenesis, August 1, 2001; 22(8): 1179 - 1183.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
K. M. Vasquez, K. Marburger, Z. Intody, and J. H. Wilson
Manipulating the mammalian genome by homologous recombination
PNAS, July 17, 2001; 98(15): 8403 - 8410.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
S. J. Collis, A. Tighe, S. D. Scott, S. A. Roberts, J. H. Hendry, and G. P. Margison
Ribozyme minigene-mediated RAD51 down-regulation increases radiosensitivity of human prostate cancer cells
Nucleic Acids Res., April 1, 2001; 29(7): 1534 - 1538.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
C. Arnaudeau, L. Rozier, C. Cazaux, M. Defais, D. Jenssen, and T. Helleday
RAD51 supports spontaneous non-homologous recombination in mammalian cells, but not the corresponding process induced by topoisomerase inhibitors
Nucleic Acids Res., February 1, 2001; 29(3): 662 - 667.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
Y. M. N. Akkari, R. L. Bateman, C. A. Reifsteck, S. B. Olson, and M. Grompe
DNA Replication Is Required To Elicit Cellular Responses to Psoralen-Induced DNA Interstrand Cross-Links
Mol. Cell. Biol., November 1, 2000; 20(21): 8283 - 8289.
[Abstract] [Full Text]

Home page
 GeneticsHome page
D. D. G. Gessler and S. Xu
Meiosis and the Evolution of Recombination at Low Mutation Rates
Genetics, September 1, 2000; 156(1): 449 - 456.
[Abstract] [Full Text]

Home page
 GeneticsHome page
T. C. Marsh, E. S. Cole, K. R. Stuart, C. Campbell, and D. P. Romero
RAD51 Is Required for Propagation of the Germinal Nucleus in Tetrahymena thermophila
Genetics, April 1, 2000; 154(4): 1587 - 1596.
[Abstract] [Full Text]

Home page
 Nucleic Acids ResHome page
W. Li, B. Hesabi, A. Babbo, C. Pacione, J. Liu, D. J. Chen, J. A. Nickoloff, and Z. Shen
Regulation of double-strand break-induced mammalian homologous recombination by UBL1, a RAD51-interacting protein
Nucleic Acids Res., March 1, 2000; 28(5): 1145 - 1153.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
T. Haaf, E. Raderschall, G. Reddy, D. C. Ward, C. M. Radding, and E. I. Golub
Sequestration of Mammalian Rad51-Recombination Protein into Micronuclei
J. Cell Biol., January 11, 1999; 144(1): 11 - 20.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
X.-D. Yao and P. Elias
Recombination during Early Herpes Simplex Virus Type 1 Infection Is Mediated by Cellular Proteins
J. Biol. Chem., January 19, 2001; 276(4): 2905 - 2913.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
B. Reiss, I. Schubert, K. Kopchen, E. Wendeler, J. Schell, and H. Puchta
RecA stimulates sister chromatid exchange and the fidelity of double-strand break repair, but not gene targeting, in plants transformed by Agrobacterium
PNAS, March 28, 2000; 97(7): 3358 - 3363.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
F. Xia, D. G. Taghian, J. S. DeFrank, Z.-C. Zeng, H. Willers, G. Iliakis, and S. N. Powell
Deficiency of human BRCA2 leads to impaired homologous recombination but maintains normal nonhomologous end joining
PNAS, July 17, 2001; 98(15): 8644 - 8649.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (369K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (126)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Vispe, S.
Right arrow Articles by Defais, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vispe, S.
Right arrow Articles by Defais, M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?