| Nucleic Acids Research | Pages |
Down regulation of extramacrochaetae mRNA by a Drosophila neural RNA binding protein Rbp9 which is homologous to human Hu proteins
Introduction
Materials And Methods
Purification of a His-tagged Rbp9 protein expressed in Escherichia coli
Oligonucleotide column binding assay
Selex
UV crosslinking assay
Northern analysis of RNA from rbp9 mutant flies
Results
Recombinant Rbp9 binds strongly to ribohomouridylate
Determination of the Rbp9 target RNA sequence
Binding of Rbp9 to a synthetic Hel-N1 binding site
Cloning of a target gene encoding Rbp9 binding RNA
Discussion
References
Down regulation of extramacrochaetae mRNA by a Drosophila neural RNA binding protein Rbp9 which is homologous to human Hu proteins
ABSTRACT
INTRODUCTION
Regulation at the level of RNA processing is a general mechanism used to control expression of genes involved in many biological processes (1-3). Several RNA binding proteins that display specific developmental expression patterns have been implicated in this mode of regulation. However, the precise mechanism by which RNA binding proteins regulate expression of target gene is known only in a few cases (1,4). Of the known tissue-specific RNA binding proteins, Elav (5) and Rbp9 (6) of Drosophila melanogaster are particularly interesting, as they belong to a nervous system-specific family of RNA binding proteins that includes neural proteins from Xenopus (elrA, B, C and D) (7,8) and humans (HuC, HuD, HuR, Hel-N1 and Hel-N2) (9-11). The presence of multiple homologues in a single species and their common neural-specific expression likely reflect functional importance.
Although Rbp9 homologues are believed to function as post-transcriptional regulators of gene expression in the nervous system (6), the mechanism by which these proteins accomplish their biological function is not yet known. Genetic analysis of elav showed that it is essential for neuronal cell development and maintenance (12), but lack of information on an Elav-interacting protein(s) hampers the precise elucidation of elav function. Biochemical studies on human homologues of Rbp9 demonstrated that they bind to U-rich elements in untranslated regions (UTRs) of mRNAs that encode cell growth regulators (10,11,13-15). Because the U-rich elements have been implicated in the regulation of mRNA stability, it was suggested that the human Rbp9 homologues destabilize specific mRNAs and thus prevent cell proliferation. Whether these lines of evidence reflect the physiological function of this gene family remains to be tested in vivo.
In order to decipher the function of Rbp9, we determined the Rbp9 consensus binding sequence using a Selex system (16). We then identified the consensus sequences in the mRNA of extramacrochaetae (emc), a Drosophila gene involved in pro-neuronal cell differentiation (17), and detected a physical interaction between emc mRNA and Rbp9 protein. We also demonstrated that this interaction is essential for the down regulation of emc mRNA by analyzing rbp9 mutant flies. These results suggest that Rbp9 regulates nervous system development by controlling the stability of mRNAs that encode regulators of cell proliferation and differentiation.
MATERIALS AND METHODS
Purification of a His-tagged Rbp9 protein expressed in Escherichia coli
The Rbp9 coding sequence with an altered initiation codon (to incorporate SpeI site) was amplified with PCR (polymerase chain reaction), fused in frame with six histidine residues of pEHB1 to make pEHrbp9, and transformed into a BL21 strain. Expression of the recombinant protein was induced with IPTG (0.05 mM) at a cell density of 0.7 (OD600). After a 3-h induction at 37°C, cells were washed with HNE buffer (50 mM HEPES-KOH pH 7.6, 0.25 M NaCl, 5 mM EDTA), then lysed with freezing and thawing in the presence of lysozyme (0.2 mg/ml) and Triton X-100 (0.1%). The lysate was then sonicated to complete the cell lysis and to reduce the viscosity by breaking down the nucleic acids. After centrifugation to remove cell debris, the soluble fraction was treated with PEI (polyethyleneimmine; 0.1% final concentration), and lipid and nucleic acids were removed by centrifugation at 15 000 g for 30 min. The supernatant was loaded onto a Ni+-NTA column (Qiagen, Santa Clara, CA) which was washed with HNE buffer containing 10 mM immidazole, and bound protein was eluted with HNE buffer containing 200 mM immidazole. This procedure yielded a protein fraction that contained 95% recombinant Rbp9 protein, as confirmed by western (immunoblot) analysis with Rbp9-specific polyclonal antibodies (Ab). This recombinant Rbp9 protein was used for further studies.
Oligonucleotide column binding assay
Oligo rU-agarose, oligo rC-agarose and single-stranded DNA (ssDNA)-cellulose (Sigma, St Louis, MD) were equilibrated with RSB buffer [20 mM HEPES-KOH pH 7.6, 5% glycerol, 42 mM (NH4)2SO4, 2 mM MgCl2 and 1 mM [beta]-mercaptoethanol]. After equilibration, each resin (100 µl) was incubated with 5 µg of recombinant Rbp9 protein at various NaCl concentrations ranging from 0.1 to 2 M. After 30 min of incubation at 4°C, the resin was washed five times with sodium phosphate buffer (50 mM NaPO4, pH 7.6) containing the heparin (1 mg/ml) and the equivalent amount of NaCl used in the binding reaction. Aliquots (10 µl) of the column fractions were resuspended in protein sample loading buffer and analyzed by SDS-polyacrylamide (10%) gel electrophoresis (PAGE).
Selex
In order to synthesize templates for random RNA oligonucleotides, three DNA oligonucleotides were prepared as described in Tsai et al. (16) and used for PCR amplification. The oligonucleotide N25 (sequence 5[prime]-TGG GCA CTA TTT ATA TCA ACN25 AAT GTC GTT GGT GGC CC-3[prime]), which was used as a template in the PCR had a random sequence of 25 nucleotides (nt) in the middle. At the ends of the oligonucleotide were sequences complementary to the primers (Rev primer and T7 primer) used for PCR amplification. T7 primer (5[prime]-CGC GGA TCC TAA TAC GAC TCA CTA TAG GGG CCA CCA ACG ACA TT-3[prime]) contained the T7 promoter in addition to the complementary sequence that directed synthesis of RNA from the amplified PCR products in vitro. Both T7 and Rev primer (5[prime]-CCC GAC ACC CGC GGA TCC ATG GGC ACT ATT TAT ATC AAC-3[prime]) contained a restriction site at the 5[prime] end to facilitate cloning. In vitro transcription of the PCR products was carried out with the T7 RNA polymerase system (Ribomax, Promega, Madison, WI) as suggested by the manufacturer. After RNase-free DNase (Promega, Madison, WI) treatment (10 U for 90 min at 37°C), free nucleotides were removed from the synthesized RNAs with the use of Microcon 3 column (Amicon, Beverly, MA) filtration. In order to estimate the amount of RNA synthesized, a trace amount of [[alpha]-32P]UTP (100 c.p.m./pmol) was added to the PCR reaction, and the amount of labeled nucleotides incorporated into RNA was determined using a scintillation counter (Wallac).
For affinity purification, recombinant Rbp9 protein (10 µg) was bound to Ni+-NTA resin (20 µl), and random RNA oligonucleotides (10-40 µg) were added to the resin in 0.1 ml of RSB buffer containing bovine serum albumin (BSA) (50 ng/µl) and 0.3 M NaCl. After 30 min of incubation at room temperature, the resin was washed extensively with 0.3 M NaCl-RSB buffer. In order to elute the bound RNA, the resin was incubated with proteinase K (40 µg; Promega) for 20 min at 37°C, and RNAs were recovered from the supernatant. The eluted RNA was annealed to Rev primer and converted to complementary DNA (cDNA) with AMV reverse transcriptase (Promega, Madison, WI) according to the manufacturer's instructions. The cDNAs were converted to double-stranded DNA and amplified by PCR with T7 and Rev primers. The amplified products were used as templates for in vitro RNA synthesis and affinity purification on a column containing immobilized Rbp9 protein. This whole process was repeated up to seven times. As a means of monitoring the enrichment of specifically bound RNAs after affinity purification, RNA loaded onto the affinity columns was labeled with a trace amount of 32P, and the percentage of RNA bound to Rbp9 protein resin was calculated for each purification step.
Nitrocellulose filters (Schleicher & Schuell, Keene, NH) were pretreated with 0.5 M KOH for 8 min at room temperature and neutralized in 0.1 M Tris-HCl (pH 8.0) for 20 min. 32P-labeled RNA (0.5 µg) was mixed with recombinant Rbp9 protein (2 µg) in RSB buffer containing 0.3 M NaCl and BSA (200 µg/ml), and the mixture was incubated for 30 min at room temperature. The RNA-Rbp9 mixture was bound to a KOH-treated nitrocellulose filter on a Hoeffer (San Francisco, CA) slot blot system, and the filter was extensively washed with the binding buffer. Radioactivity retained on the nitrocellulose filters was analyzed either with a Phosphorimager (Molecular Dynamics) or scintillation counting.
The 3[prime] UTR of emc mRNA (1156 bp between the termination codon and the polyadenylation signal) was prepared by PCR amplification of wild-type Drosophila cDNA with primers emcUTR5 (5[prime]-TTT CTA GAG CGT GGA AAC ACC CAG-3[prime]) and emcUTR3 (5[prime]-TTT CTA GAA AGA GCT AGT GTT TGT TTT-3[prime]). The amplified fragment digested with XbaI was cloned into the XbaI site of pBluescript SK+ (Stratagene) to make pSKemc and sequenced to confirm the absence of a mutation. RNA probe encoding the first 849 nt of the emc 3[prime] UTR (contains two putative Rbp9 binding sites between the nucleotide positions 434 and 463) was transcribed by T7 RNA polymerase from the pSKemc template linearized with StyI.
UV crosslinking assay
UV crosslinking assays were performed as described (18). Recombinant Rbp9 protein (60 ng) was preincubated for 10 min with 10 µg of yeast tRNA in a 10 µl reaction mixture that contained 1 µl of 10X reaction buffer A (32 mM MgCl2, 20 mM ATP, 1 mg/ml BSA, 60 mM HEPES-KOHpH 7.9). 32P-labeled RNA probe (100 fmol) was added to the mixture, and the sample was incubated for an additional 10 min at room temperature. The sample was placed on ice and irradiated with UV light (105 erg/mm2) with use of a Stratagene (La Jolla, CA) UV crosslinker. The RNA was digested with RNaseA (30 µg) for 15 min at 37°C and mixed with protein loading buffer. Samples were boiled for 90 s and subjected to SDS-PAGE and autoradiography. For UV crosslinking competition assays, a 20-400-fold excess of competitor RNA oligonucleotides were added to the reaction mixtures together with the 32P-labeled RNA probes. The RNA oligonucleotides used for this assay are shown in Table 2.
Northern analysis of RNA from rbp9 mutant flies
A nucleic acid probe for emc was prepared by PCR amplification of Drosophila genomic DNA with primers emc5 (5[prime]-GAGAATGCCGAGATGAAG-3[prime]) and emc3 (5[prime]-GAAAACGATCCAAGGGAC-3[prime]). Poly(A)+ RNA preparation from mutant flies and northern hybridization were carried out as described in Sambrook et al. (19).
RESULTS
Recombinant Rbp9 binds strongly to ribohomouridylate
To define the RNA binding specificity of Rbp9 protein, we have used ribohomopolymer and ssDNA affinity chromatography (Fig. Figure 1. Rbp9 binding to poly rC, poly rU and ssDNA resins. (A) Oligo rU-agarose, oligo rC-agarose and ssDNA-cellulose were each incubated with 5 µg of recombinant Rbp9. The concentration of NaCl in the binding buffer is indicated. Both the flow-through (F) and eluted proteins (E) were analyzed by 10% SDS-PAGE and visualized by silver staining. The molecular size marker (SM) and one-fourth of the loaded protein (L) are shown in lanes 1 and 2. (B) The radiolabeled oligoribonucleotides (0.5 µg, each) are indicated above the lanes, and were filtered through KOH-treated nitrocellulose in the presence (+) or absence (-) of recombinant Rbp9 (2 µg). The high-affinity of Rbp9 for U-rich sequence was confirmed with a filter-binding assay (Fig. 
Determination of the Rbp9 target RNA sequence
To determine the target RNA binding sequence of Rbp9 protein, we used Selex as described in Materials and Methods. Random RNA oligonucleotides synthesized in vitro were incubated with histidine-tagged Rbp9 protein immobilized on Ni2+-NTA resin. The amount of RNA recovered from the Rbp9 containing beads was <0.1% of the RNA used in the binding reaction, and most of the recovered RNA appeared to be bound non-specifically to Rbp9, as a similar portion of the starting RNA was also recovered when BSA was used instead of Rbp9. To further enrich for RNAs that were specifically bound, RNA oligonucleotides recovered from the Rbp9 resin were amplified as cDNA by RT-PCR, converted into RNA, and used for additional rounds of purification, and this whole process was repeated up to seven times. As shown in Figure Figure 2. Enrichment of Rbp9-binding RNAs by the Selex system. (A) A pool of Rbp9-binding RNAs was enriched from a collection of random oligonucleotides by seven cycles of Selex. The percentage of bound RNA was calculated based on the ratio between the amount of radioactive RNA eluted and the total radioactive RNA used in the binding reaction. (B) RNAs recovered from the first and seventh cycles of Selex were assayed by filter-binding in the presence (+) and absence (-) of Rbp9 protein as described in Figure 1B. (C) 50 fmol of 32P-labeled #26 RNA was UV cross-linked with 125 ng of Rbp9 with and without the competitor RNA. The competitor RNA used is indicated. Lane 1, no competitor; lane 2, poly rU (U, 2 µg); lane 3, poly rA (A, 2 µg); lane 4, poly rC (C, 2 µg). In order to determine the nucleotide sequence of the Rbp9-binding RNAs, we sequenced 30 independent PCR fragments amplified from RNAs enriched in the final round of selection. Among these were 15 clones that contained a stretch of at least of eight U residues (Table 1). In order to characterize the binding of Rbp9 to the selected RNAs, 32P-labeled RNA prepared from #26 clone was analyzed by UV crosslinking in the presence of Rbp9. The selected RNA was crosslinked specifically to Rbp9 protein, as these interactions were inhibited by the addition of unlabeled poly U RNA, but not poly rC or poly rA RNAs (Fig. 
Binding of Rbp9 to a synthetic Hel-N1 binding site
Although we determined the Rbp9 RNA binding sequence to be a simple U-stretch, a similar Selex study with Hel-N1, one of human Rbp9 homologues (20), identified RWUUUAUUUWR (R = A or G; W = A or U) as a consensus binding sequence. These results suggest either that the two proteins have different binding specificities or that the minimum requirement for Rbp9 binding is shared by the two consensus sequences. Therefore, we tested the affinity of Hel-N1 RNA oligonucleotides with various modifications of sequences using UV crosslinking as well as filter-binding assays. When we examined the binding affinity of Rbp9, an RNA oligonucleotide composed of two direct repeats of the Hel-N1 consensus sequence (Table 2; BS1) bound as efficiently as poly U RNA (Fig. Figure 3. The binding specificity of Rbp9 protein. Rbp9 protein (125 ng) (lanes 2, 4, 6 and 8) was UV-crosslinked with 32P-labeled ribooligonucleotides (6 ng) containing two repeats of the Hel-N1 binding RNA consensus sequence (BS1) or its mutant versions (CS1, CS2 and CS3). As a control for non-specific interaction, results obtained with a binding reaction that contained BSA (100 ng) instead of Rbp9 is shown (lanes 1, 3, 5 and 7).
Table 1. . Deduced RNA sequences from the cDNA clones isolated by Selexa
| #1 | GGGCCACCAACGACAUUUCGUCUUUUUUUUUUUUUUGAUAGGUUGAUGUUGAUAUAAAUAGUGACCAUGGAUC |
| #2 | GGGCCACCAACGACAUUUCGUCUUUUUUUUUUUUUUGAUAGGUUGAUGUUGAUAUAAAUAGUGACCAUGGAUC |
| #4 | GGGGCCACCAACGACAUUUUUUUUUUUUUUUUGCGCUUCUACCUCUCCCGCGUUGAUAUAAAUAGUGACCAUGGAUC |
| #7 | GGGGCCACCAACGACAUUCCACCUUUUUUUUUUUUGAGAUGGCUUUGUUGAUAAAAUAGUGCCCAUGGAUC |
| #8 | GGGGCCACCAACGACAUUUUUUUUUUUUUUUUUUUUAGGAACUCCGAGACNNNGUUGUUGAUAUAAAUAGUGCCCAUGGAUC |
| #12 | GGGGCCACGAACGACAUUCUGUUUUUUUUUUUUUUUAGCCGCGCUAUUGUGUUGAUAUAAAUAGUGCCCAUGGAUC |
| #17 | GGGGCCACCAACGACAUUUACCGUUGAUCAUUUUUUUUUUUUUUUUUUUUUGCUUAGUUAAUAUAAAUAGUGCCCAUGGAUC |
| #18 | GGGGCCACCAACGACAUUUUUUUUUCCGUUUCUCAUUACUAUUGGUUGAUAUAAAUAGUGCCCAUGGAUC |
| #19 | GGGGCCACCAACGUCAUUGUUUUUUUUUUUUUUUUUUUGGGGUUUGUUCCUUCCGUUGAUAUAAAUAGUGCCCAUGGAUC |
| #21 | GGGGCCACAAACGACAUUUUUUUUUUUUUUCUUAUGACGGUCCCUGUUGUUGAUAUAAAUAGUGCCCAUGAUCGCGACAUCCCGCACAGCGGAUC |
| #22 | GGGGCCACCAACGACAUUUUUUUUUUUUUUUUAGUUCUAUUCCGAAUGUGGUUGAUAUAAAUAGUGCCCAUGGAUC |
| #23 | GGGGCCACCAACGACAUUACGUUUUUUUUUUUUGUUAGUAAGGGUUGAUAUAAAUAGUGCCCAUGGAUC |
| #24 | GGGGCCACCAACGACAUUUUUUUUUUUUAGUACCCGAGCCCGAGAAGUUGAUAUAAAUAGUGCCCAUGGAUC |
| #25 | GGGGCCACCAACGACAUUUUUUUUUUUUUUCUUAUGACGGUCCCUGUUCGUUGAUAUAAAUAGUGCCCAUGGAUC |
| #26 | GGGGCCACCAACGACAUUUUUCUUUUUUUUUUUUUUUUUUUCUAGUAGUGUUAAGGUAAGGUUGAUAUAAAUAGUGCCCAUGGAUC |
| CS3 | UUGAUCUAUCUUGAUCUUAUCUAGUUd |
Table 2.
| Consensus sequencea | RWUUUAUUUWRRWUUUAUUUWRb |
| BS1 | UUGAUUUAUUUUGAUUUUAUUUAGUUc |
| CS1 | UUGAAAAAAAAAGAAAAAAAAAAGUUd |
| CS2 | UUCCUUUCUUUUCCUUUUCUUUGCUUd |
Cloning of a target gene encoding Rbp9 binding RNA
The interaction in vitro between Id1 and Hel-N1 (11), the human counterparts of emc and Rbp9, respectively, as well as the involvement of emc in Drosophila nervous system development, suggested emc mRNA as a strong candidate for an Rbp9-binding RNA. But, the Hel-N1 binding sequence (RWUUUAUUUWR), which would indicate their interaction, was not present in the emc mRNA. However, examination of the emc mRNA for the presence of the newly identified Rbp9 consensus binding sequence (UUUXUUUU) identified two UUUGUUUU sequences within the 3[prime] UTR located ~450 base pairs (bp) downstream of the stop codon. This finding prompted us to test whether these repeats in the emc mRNA are authentic Rbp9 binding sites. The affinity of Rbp9 to emc 3[prime] UTR was examined with UV crosslinking. As shown in Figure
Figure 4. Binding of Rbp9 protein to the U-rich element of emc mRNA. UV crosslinking of Rbp9 protein to emc mRNA. Recombinant Rbp9 protein (60 ng) was UV-crosslinked to the 3[prime] UTR of emc mRNA. Rbp9 BS1 (lanes 3-5) and Rbp9 CS1 (lanes 6-8) were used in 40-, 120- and 400-fold excess as sense and antisense competitor RNAs, respectively. Identification of the physical interaction between Rbp9 and emc mRNA prompted us to examine whether emc mRNA stability is regulated by the presence of Rbp9. To study the effect of an rbp9 null mutation on emc expression, we prepared poly(A+) mRNAs from wild-type and rbp9P[2567] mutant flies (22) and analyzed the level of emc mRNA by northern blot hybridization. As shown in Figure Figure 5. Northern analysis of rbp9 mutant. The amount of emc, cyclin E and Sxl mRNAs in wildtype (wt) and rbp9P[2567] mutant (rbp9-) flies were shown by northern hybridization. The 4.1, 3.1 and 1.9 kb adult female Sxl transcripts were shown in the Sxl blot. Poly(A)+ RNA (2 µg) was loaded in each lane, and the amount of rp49 transcript is shown as a loading control. In order to examine the specificity of the Rbp9-mediated down regulation of emc mRNA, the effect of the rbp9 mutation on the expression of other RNAs containing the putative Rbp9 binding consensus sequences was analyzed. We first examined the level of cyclin E mRNA (GenBank accession no. X75026), because it contains three Rbp9 binding sequences in the 3[prime] UTR (UUUUUGUU, AUUUUUUU and UUUUAUUU at the nucleotide positions 2643, 3374 and 3702, respectively) and expressed in ovaries where Rbp9 is required for a proper germ cell differentiation (22). However, in contrast to the emc mRNA, the level of cycE mRNA did not increase in the rbp9P[2567] mutant (Fig. We also examined the effect of rbp9 mutation on the levels of Sxl transcripts. Sxl expresses four adult female specific transcripts; the 4.1 kb large transcript, two 3.1 kb transcripts and 1.9 kb small germ-line dependent transcript. These transcripts differ at their 3[prime] ends. The large transcript contains 14 putative Rbp9 binding consensus sequences, and the intermediate-sized transcripts have eight binding sequences, but the small transcript has only one binding sequence. Despite the presence of a number of the binding sequences, the northern analysis revealed that the 3.1 and 1.9 kb transcripts were expressed normally in the rbp9 mutant (only 1.2-fold decrease in the mutant). Therefore, Rbp9 did not act on the putative Rbp9 binding sequences in these Sxl and cycE mRNAs. The effect of rbp9 mutation on the 4.1 kb Sxl transcript is complex. Contrary to our expectation, the 4.1 kb transcript was decreased 3-fold in the rbp9 mutant. However, this negative effect on the Sxl large transcript could be indirect. Because Emc protein represses Sxl by inhibiting the formation of Daughterless/Sisterless-b heterodimers (23), the elevated level of Emc may cause the down regulation of the Sxl large transcript in the rbp9 mutant. These results suggest that not all Rbp9 binding consensus sequences interact with Rbp9 and that the specific interaction between Rbp9 and emc mRNA may require additional elements.
DISCUSSION
Rbp9 belongs to a large neural RNA binding protein family that contains Drosophila Elav (12) and human Hu proteins (9,10,21). Although these homologues share similarities in their predominant nuclear expression in nerve cells, genetic and biochemical studies reveal that a neuro-specific pre-mRNA processing may not be the only function of the Rbp9 protein family. Especially, biochemical studies on human Hu proteins proposed a regulation of mRNA stability as one of their functions (10,11,13-15). However, whether the regulated degradation of target mRNAs is the genuine function of the Hu proteins in vivo has not been proved yet. Therefore, the 10-fold increase of emc mRNA in the rbp9 null mutant provides strong evidence in support of the hypothesis that Rbp9 protein family functions as regulators of mRNA stability.
The role of rbp9 in the regulation of mRNA stability suggests that Rbp9 protein would be localized in the cytoplasm, which is contrary to the previous observations showing nuclear-specific localization of Rbp9 and Elav proteins in nerve cells (6,12). However, our recent studies on rbp9 mutants found that, in germ cells, Rbp9 is localized in the cytoplasm to regulate cell proliferation and differentiation (22). Besides, a small amount of human Hu protein is also localized in the cytoplasm (9,24).
The fact that Rbp9 is present both in the nucleus and the cytoplasm is particularly interesting, because a highly homologous Sxl protein has two different functions as a regulator of alternative splicing in the nuclei and a regulator of mRNA translation in the cytoplasm (25-28). Rbp9 and Sxl may utilize a similar mechanism in the regulation of RNA processing even though they are involved in different developmental processes. Therefore, in the down regulation of emc mRNA, Rbp9 may reduce the amount of emc mRNA by affecting its stability directly. But it is equally possible that degradation of emc mRNA is caused indirectly by an Rbp9-mediated translational inhibition as msl-2 translation was repressed by Sxl protein (26,28).
Finally, our analysis of the Rbp9 binding consensus sequence using the Selex system, as well as our mutational analysis of the Hel-N1 binding sequence suggests that Rbp9 binds to a rather simple U-stretch. What appears to be more important for Rbp9 binding is the length of the U-stretch rather than the context that surrounds it. This rather simple binding specificity appears to be shared with other Rbp9 homologues and Sxl. The RNA recognition motifs (RRMs) of Sxl protein are very similar to those of Rbp9 protein (33% identical), and binds to AU7 or AU8 in vitro (29,30). This raises a question about their binding specificity: how do they bind to their specific target RNAs? Although Rbp9 and Sxl are expressed together in some developmental stages, each of them is involved in a distinct developmental process, thus they may have different target RNAs. As shown in this study, Rbp9 and Sxl do not regulate all the RNAs that contain the Rbp9 binding consensus sequences. Therefore, additional cis-elements may be required for the specific binding of these proteins to their target RNAs in vivo. In addition, the distinct domains of each protein may interact with specific co-factors (29). Therefore, the identification of these additional cis- and trans-acting factors is needed to understand the precise mechanism by which Rbp9 regulates the target RNAs.
REFERENCES
This article has been cited by other articles:
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 4 Jun 1998
Copyright©Oxford University Press, 1998.
CiteULike 
Connotea 
Del.icio.us What's this?
Y. Wei, Q. Xiao, T. Zhang, Z. Mou, J. You, and W.-J. Ma
Differential regulation of mRNA stability controls the transient expression of genes encoding Drosophila antimicrobial peptide with distinct immune response characteristics
Nucleic Acids Res.,
October 1, 2009;
37(19):
6550 - 6561.
[Abstract]
[Full Text]
[PDF]
C. D. Borgeson and M.-L. Samson
Shared RNA-binding sites for interacting members of the Drosophila ELAV family of neuronal proteins
Nucleic Acids Res.,
November 10, 2005;
33(19):
6372 - 6383.
[Abstract]
[Full Text]
[PDF]
G. Toba, J. Qui, S. P. Koushika, and K. White
Ectopic expression of Drosophila ELAV and human HuD in Drosophila wing disc cells reveals functional distinctions and similarities
J. Cell Sci.,
January 6, 2002;
115(11):
2413 - 2421.
[Abstract]
[Full Text]
[PDF]
M. J. Lisbin, J. Qiu, and K. White
The neuron-specific RNA-binding protein ELAV regulates neuroglian alternative splicing in neurons and binds directly to its pre-mRNA
Genes & Dev.,
October 1, 2001;
15(19):
2546 - 2561.
[Abstract]
[Full Text]
[PDF]
J. Kim-Ha, J. Kim, and Y.-J. Kim
Requirement of RBP9, a Drosophila Hu Homolog, for Regulation of Cystocyte Differentiation and Oocyte Determination during Oogenesis
Mol. Cell. Biol.,
April 1, 1999;
19(4):
2505 - 2514.
[Abstract]
[Full Text]
[PDF]
Y. Yannoni and K White
Domain necessary for Drosophila ELAV nuclear localization: function requires nuclear ELAV
J. Cell Sci.,
January 12, 1999;
112(24):
4501 - 4512.
[Abstract]
[PDF]
This Article 
Abstract
Print PDF (136K)
Alert me when this article is cited
Alert me if a correction is posted
Services
Email this article to a friend
Similar articles in this journal
Similar articles in ISI Web of Science
Similar articles in PubMed
Alert me to new issues of the journal
Add to My Personal Archive
Download to citation manager
Search for citing articles in:
ISI Web of Science (9)
Request Permissions
Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Articles by Park, S. J.
Articles by Kim, Y. J.
Search for Related Content
PubMed
PubMed Citation
Articles by Park, S. J.
Articles by Kim, Y. J.
Social Bookmarking
What's this?