Nucleic Acids Research

General methods

Genomic DNA and total RNA was isolated from T.thermophila as previously described (15). Specific ³²P-radiolabeled DNA probes were generated by a PCR strategy as previously described (16). Uniformly ³²P-radiolabeled DNA probes were synthesized by primer extension of T.thermophila total DNA with random hexamer primers (Boehringer-Mannheim) and [[alpha]-³²P]dATP (sp. act. 3000 Ci/mmol) as described (17). Conventional PCR protocols (18) and molecular techniques (17) were used for various cloning procedures. DNA sequencing was performed with either Sequenase[trade] (US Biochemical, Cleveland, OH) or the CircumVent Thermal cycle DNA sequencing kit (New England Biolabs, Beverly, MA). Oligonucleotides for primer extensions and DNA sequencing were radiolabeled at the 5[prime]-end with T4 polynucleotide kinase and [[gamma]-³²P]ATP (7000 Ci/mmol; ICN) as described (17). SDS-PAGE was according to the procedure of Laemmli (19).

Tetrahymena thermophila strains and growth conditions

Tetrahymena thermophila strain CU427 (Peter Bruns, Cornell University, Ithaca, NY) was used throughout this study. Cells were grown in 2% PPYS [2% proteose peptone, 0.2% yeast extract, 0.1% sequestrene NAFE (Ciba-Geigy)], supplemented with 250 µg/ml penicillin and streptomycin sulfate, 1.25 µg/ml amphotericin B (Fungizone-Gibco) at 30°C on a platform shaker.

Oligonucleotides

Utilization of the following oligonucleotides (Microchemical Facility, University of Minnesota, Minneapolis, MN) is included in the text. PCR primers (P) and primer extension oligos (A) are as indicated. Single base mismatches are underlined. Orientation (+/-) and degeneracy (d) are indicated for PCR primers. R = A or G, Y = T or C and N = A, C, G or T. All oligonucleotides are written 5[prime]->3[prime]: P1(+)d, TGYCAYACYYTNGCYGTYACYTGYYA; P2(-)d, ACCRTCRACTTRRGCRACRACTTRRTT; P3(+), CTCGAGATGGCTGAGTACGCTGA; P4(-), CTCGAGTCACTCGTTGAAGTCTT; P5(+), GACGAATTCGGTATTGC; A1, CTTCAGCGTACTCAGCC; A2, CTTCAAATATCAAAAGC.

Genomic and cDNA cloning of the T.thermophilaRAD51 gene

Total DNA from T.thermophila CU427 (4 µg) was amplified in a 100 µl reaction with 200 pmol degenerate primers P1d(+) and P2d(-), 0.25 mM dNTPs, 2.5 mM MgCl₂, 1× Taq polymerase buffer A (Promega) and 2.5 U Taq polymerase (Promega). The initial three PCR cycles were 94°C for 1 min, 37°C for 2 min, an increase from 37 to 72°C at a rate of 1°C/10 s and 72°C for an additional 2 min. The reaction was then cycled 30 times through 94°C for 2 min, 43°C for 2 min and 72°C for 2 min. Finally, the reactions were incubated at 72°C for 10 min and stored at 4°C. The major PCR product (0.42 kb) was gel purified from a 0.8% agarose gel and cloned into vector pCRII by the TA cloning method (Invitrogen).

A BglII size-selected T.thermophila genomic library was constructed at the BamHI site of cloning vector pUC118 as previously described (20). Competent Escherichia coli (strain DH01B) were transformed with the ligation products by electroporation and transformants selected for ampicillin resistance. Bacterial colonies transferred to Nytran filters (Schleicher & Schuell) were probed with the cloned 0.42 kb PCR product described above, radiolabeled with [[alpha]-³²P]dCTP (sp. act. 3000 Ci/mmol) and primers P1(+)d and P2(-)d by a PCR method described previously (21). Six positive clones were identified and restriction mapped and two of the six (with the 4.6 kb BglII insert cloned in opposite orientations) were sequenced.

Complementary DNA (cDNA) was synthesized with 2 µg T.thermophila total RNA as template, 1 µg random hexamer primers (Boehringer-Mannheim) and 7.5 U AMV reverse transcriptase (Promega). The 20 µl reaction (which included 1 mM dNTPs, 50 mM Tris-HCl, 5 mM MgCl₂, 30 mM KCl, 1 mM DTT, pH 8.5) was incubated at 42°C for 15 min, 99°C for 5 min and 4°C for 5 min. The resultant cDNA product (2 µl) was used as template in a standard PCR amplification. PCR primers P3(+) and P4(-) correspond to the putative 5[prime]- and 3[prime]-termini of the Rad51 protein coding sequence, with XhoI restriction sites included at the 5[prime]-ends for ease in subsequent cloning steps. The resultant 1 kb PCR product was initially cloned into pCRII by the TA cloning method (Invitrogen) and then directionally cloned into the polylinker of pUC118 (designated pTtRd51).

Site-directed mutagenesis

Oligonucleotide site-directed mutagenesis of the T.thermophila Rad51 protein coding sequence in pTtRd51 was by the method of Kunkel (22). Mutagenic oligonucleotides were used to convert seven UAA ochre stop codons in the coding sequence to CAA glutamine codons, which were subsequently confirmed by single-strand DNA sequencing. The mutagenized plasmid was designated pTtRd51(7Q).

Expression and purification of recombinant T.thermophila Rad51 protein

The 1 kb XhoI fragment from pTtRd51(7Q) was subcloned into the XhoI site of the bacterial expression vector pET15b (Novagen). This plasmid construct (pET::TtRd51) was introduced into E.coli strain HMS174 harboring the plasmid pGP1-2, which includes the T7 RNA polymerase gene behind the bacteriophage [lambda] P_L promoter (23). Overexpression of T.thermophila Rad51 protein from pET::TtRd51 in logarithmically growing cultures (A_{600 nm} = 0.2-0.4) was induced by a 15 min temperature shift to 42°C from the growth temperature of 30°C. This temperature shift permits expression of T7 RNA polymerase from pGP1-2, which transcribes the recombinant protein mRNA from the T7 promoter on pET::TtRd51 (24). The cultures were subsequently maintained at 37°C for 2 h to allow for accumulation of the translated product. The recombinant T.thermophila Rad51 protein includes an N-terminal (histidine)₆ peptide tag to facilitate purification (Novagen). Whole cell lysate preparation and nickel column chromatography were performed following the manufacturer's recommendation (Qiagen).

Recombinant T.thermophila Rad51 protein activity assays

DNA-dependent ATPase activity was assayed as follows. Purified T.thermophila Rad51 protein (25 µg) was incubated at 37°C in the presence of 50 mM triethanolamine-HCl (pH 7.5), 1 mM MgCl₂, 40 mM KCl, 0.2 mM [[gamma]-³²P]ATP (sp. act. 500 µCi/mmol), 1 mM DTT and 100 mg/ml bovine serum albumin, in the presence or absence of 8 µg single- or double-stranded [phis]X174 DNA. Aliquots (100 µl) were removed from the 1000 µl reaction at various times and added to 1 ml 100 mM phosphoric acid containing 25 mg/ml Norit A (Sigma). This mixture was centrifuged at 2000 g for 10 min to remove charcoal-bound ATP. Counts per minute remaining in the supernatant were measured in a liquid scintillation counter and, following subtraction of background counts present in no-protein controls, used to calculate nmol phosphate released. The data presented represent the average values obtained from two separate experiments.

The effect of Rad51 protein on DNA electrophoretic mobility was determined by incubating 0, 3, 7.5 or 14 µg T.thermophila Rad51 protein with DNA (0.25 µg single-stranded [phis]X174 DNA or 0.2 µg BamHI-linearized pUC118 double-stranded plasmid DNA) in a buffer containing 50 mM triethanolamine (pH 7.5), 15 mM MgCl₂, 40 mM KCl, 2 mM ATP, 1 mM DTT, 100 µg/ml bovine serum albumin, 20 mM creatine phosphate and 2 U/ml creatine kinase (10 min at 37°C). The reaction was resolved by electrophoresis in a 0.8% agarose gel [1× Tris-borate-EDTA (TBE) buffer, 4 V/cm]. The gel was stained with ethidium bromide (1 µg/ml) and DNA visualized by short wavelength UV illumination. The image was scanned using the BioRad Molecular Analyst program.

Ligation assays included 0.1 µg PstI-linearized [phis]X174 DNA and 1× reaction buffer (50 mM triethanolamine-HCl, pH 7.5, 15 mM MgCl₂, 40 mM KCl, 2 mM ATP, 1 mM DTT, 100 mg/ml bovine serum albumin, 8 mM creatine phosphate and 2 U/ml creatine phosphokinase). Following a 5 min preincubation with 0, 5 or 10 µg T.thermophila Rad51 protein at 37°C, 0.6 Weiss units T4 DNA ligase were added and the 20 µl reaction incubated further at 16°C overnight. The reaction mixtures were de-proteinized by addition of 5 µl buffer containing 100 mM Tris-HCl (pH 7.5), 200 mM EDTA, 2.5% SDS and 10 mg/ml proteinase K, followed by a 20 min incubation at 37°C. Reaction products were resolved in a 0.8% agarose gel in 1× TBE buffer electrophoresed at ~2 V/cm for 8 h. The gel was stained with ethidium bromide (1 µg/ml) and DNA visualized by short wavelength UV illumination. The image was scanned as above.

UV irradiation

Tetrahymena thermophila cultures growing logarithmically at 30°C (1-2 × 10⁵ cells/ml) were quickly cooled on dry ice/ethanol and transferred from flasks to plastic dishes in a shallow layer (~1.5 mm). The temperature was maintained at 4°C throughout the irradiation procedure. The surface of the cultures were positioned 9 cm from 30 W germicidal lamps and irradiated for 1-4 min. Cultures were transferred to flasks for continued growth at 30°C and harvested at various times after irradiation by centrifugation in 100 ml oil centrifuge tubes (1100 g, 4 min). The pelleted cells were resuspended in 10 ml 10 mM Tris-HCl (pH 7.5), recentrifuged and extracts prepared for northern and western blot analysis.

Northern blot and primer extension analyses

Aliquots (10 ml) of T.thermophila cells cultures were lysed in guanidinium isothiocyanate and poly(A)⁺ RNA was prepared with the MicroPoly(A)Pure[trade] Kit (Ambion). RNA concentrations were determined by absorbance at 260 nm and equivalent amounts for each sample of poly(A)⁺ RNA (0.7 µg) were electrophoresed in 2.2 M formaldehyde-1% agarose gels and transferred to Nytran filters by capillary action (17). Northern blots were equilibrated in hybridization buffer containing 30% (v/v) formamide, 10% dextran sulfate (500 000 mol. wt), 5% SDS, 4× SSC (0.6 M NaCl, 60 mM sodium citrate), 1× Denhardt's solution (17), 25 mM sodium phosphate (pH 6.5), 10 mM EDTA and 0.25 mg/ml high molecular weight RNA at 40°C. Duplicate northern blots were hybridized at 40°C overnight with either an [alpha]-³²P-labeled probe specific for the C-terminal coding region of T.thermophila Rad51 mRNA or with a ³²P-labeled random-primed probe of T.thermophila total DNA digested with BglII. Blots were washed at 40°C for 5 min in2× SSC, 0.1% SDS twice, followed by a final wash with 1× SSC, 0.1% SDS at 40°C for 60 min. The degree of hybridization was quantitated with a Molecular Dynamics PhosphorImager.

Primer extension reactions were as previously described (15). Two oligonucleotides corresponding to positions +3 to +19 (A1) and -132 to -116 (A2), relative to the ATG initiator codon, were annealed to T.thermophila poly(A)⁺ RNA and extended with AMV reverse transcriptase.

Production of antibodies against T.thermophila Rad51

Recombinant T.thermophila Rad51 protein was purified by SDS-PAGE and used as antigen to immunize chickens (25). IgY was purified from eggs (25), beginning 2 weeks following immunization, and tested for reactivity against T.thermophila Rad51 protein by western blot hybridization as described below.

Tetrahymena thermophila S100 cell extracts and whole cell lysates

Tetrahymena thermophila cell pellets (0.2-0.4 ml) from 100 ml cultures were resuspended in 3 vol non-ionic detergent lysis buffer (26) and incubated at 4°C with gentle stirring for 40 min. This material was centrifuged at 100 000 g for 60 min (Beckman TLS 55 rotor). The protein concentration of the supernatant fraction (S100 extract) was determined by the BioRad method and 50 µg for each sample separated by SDS-PAGE. To determine Rad51 protein levels present in T.thermophila cells treated with methyl methane sulfonate (MMS), 10 ml cultures were pelleted at 1100 g for 4 min and washed once in an equal volume of 10 mM Tris (pH 7.5). The cell pellets (~80 µl) were solubilized by boiling for 4 min with 20 µl 5× sample buffer (19), producing a whole cell lysate that was separated by SDS-PAGE.

Western blot analysis

Electrophoretically separated proteins were transferred to nitrocellulose membranes (BioRad) and immediately treated with a blocking solution of Tris-buffered saline containing 5% bovine serum albumin. The membrane was then incubated for 60 min intervals at room temperature with anti-T.thermophila Rad51 chicken IgY (prepared as described above, 1:500 dilution), goat anti-chicken IgG (1:20 000; Pierce Chemical Co.) and rabbit anti-goat IgG conjugated with alkaline phosphatase (1:20 000; Pierce Chemical Co.) respectively. Between incubations with the different antibodies, the membrane was washed three times for 5 min each with Tris-buffered saline, 0.1% bovine serum albumin. Following the final wash, the membrane was washed with Tris-buffered saline and buffer containing alkaline phosphatase substrate was added (Sigma Fast, BCIP/NBT; Sigma Chemical Co.). Reactions were quenched by rinsing with distilled water and the blots scanned and quantified with the BioRad Molecular Analyst program.

Immunocytochemistry

Tetrahymena thermophila cells were fixed in paraformaldehyde (Sigma) and mounted on microscope coverslips coated with polylysine (Sigma) as described (27). Following the primary reaction with the antibody raised against T.thermophila Rad51 protein (dilution 1:30), the fixed cells were reacted with rabbit anti-chicken IgG-FITC secondary antibody (diluted 1:30; Pierce Chemical Co.). Nuclear antibody staining was confirmed by counterstaining DNA with DAPI (data not shown). Immunofluorescence was monitored with an Olympus BH-2 inverted microscope and images captured with a Spot 1.0.0 digital camera and associated software (Diagnostic Instruments Inc., Ann Arbor, MI). Grayscale images were processed using Photoshop 4.0 (Adobe, San Jose, CA).

Nucleotide sequence accession numbers

The genomic sequence of the T.thermophila RAD51 gene will appear in the EMBL, GenBank and DDBJ databases under accession no. AF064516.

Cloning of the T.thermophilaRAD51 gene

Sequence comparisons of archaebacterial, eubacterial and eukaryotic recA/RAD51 homologs have revealed a number of well-conserved motifs (28). The design of degenerate PCR oligonucleotide primers [P1(+)d and P2(-)d] based on two such motifs (corresponding to amino acids 195-203 and 325-333 of the S.cerevisiae Rad51 protein; 1) were synthesized with a codon bias specific for Tetrahymena spp. (29). PCR amplification with these primers and T.thermophila total DNA as template resulted in a 0.42 kb major product, the predicted size of the putative recA/RAD51 gene fragment (data not shown). Sequence analysis of the PCR product indicated a high degree of similarity at the amino acid level to that of previously cloned RAD51 homologs from a number of diverse eukaryotes (28).

Tetrahymena thermophila genomic DNA Southern blots probed under low stringency conditions with the cloned PCR product indicated that the putative T.thermophila Rad51 is a single copy gene (data not shown). Cross-hybridization of this probe to other possible recA-like homologs, such as DMC1, was not evident. A BglII size-selected (4.6 ± 0.2 kb) T.thermophila macronuclear library was constructed and positive clones isolated and restriction mapped. Single-strand sequencing of the entire 4.6 kB BglII fragment cloned in opposite orientations revealed an open reading frame interrupted by two putative introns (Fig. 1A).

Figure 1. (A) Restriction map of the T.thermophila RAD51 gene. The Rad51 protein coding sequence (white bar) is interrupted by two introns (black bars). The Rad51 mRNA 5[prime]-terminus is indicated by the arrow. B, BglII; C, BclI; E, EcoRI; H, HindIII. (B) Amino acid sequence of the T.thermophila Rad51 protein. The numbers at the margins refer to the first and last amino acid for each row. Amino acids in bold share identity with Rad51 proteins from Homo sapiens, Drosophila melanogaster, S.pombe and S.cerevisiae. Underlined amino acids share identity with three eukaryotic Dmc1 and three archaebacterial RadA proteins. Lower case amino acids at the N-terminus (1-23) were not included in an alignment with Rad51 homologs from these other species (30). Black bars at F118 and E316 are exon-exon junctions 1 and 2 respectively. The position and polarity of degenerate primers P1d(+) and P2d(-) are designated by the open arrows. Similarly, solid arrows indicate the annealing positions of PCR oligonucleotides P5(+) and P4(-). Solid circles identify glutamine (Q) residues encoded by ochre nonsense codons.

PCR primers corresponding to the putative N- and C-termini of the Rad51 homolog [P3(+) and P4(-)] were used to amplify the full-length coding sequence from a random primed cDNA library. The nucleotide sequence of the 1 kb PCR product confirmed that two introns are absent from the mature mRNA. Primer extension analysis of T.thermophila poly(A)⁺ RNA with oligos A1 and A2 (Materials and Methods) revealed a single strong putative transcriptional start site at position -105 relative to the translation initiator codon, with a much weaker start at position -99 (data not shown).

Primary sequence of Tetrahymena Rad51 protein

The deduced amino acid sequence of the cloned T.thermophila Rad51 cDNA is shown in Figure 1B. There is a considerable degree of sequence conservation with other eukaryotic RAD51 homologs, as well as the related DMC1 and archaebacterial radA genes (28). The G+C content for the spliced open reading frame is 37.9%, which is typical for T.thermophila protein coding sequences (30). The predicted molecular weight for the T.thermophila Rad51 protein is 36.3 kDa.

Recombinant Tetrahymena Rad51 protein

Ciliates use a non-standard genetic code in which the stop codons UAG and UAA code for glutamine (31). Seven of the 15 glutamine residues in the putative T.thermophila Rad51 protein are encoded by ochre (UAA) stop codons (Fig. 1). It was necessary to mutate the seven ochre stop codons to CAA by oligonucleotide site-directed mutagenesis (22) prior to its overexpression in a heterologous system.

The putative T.thermophila Rad51 protein coding sequence was cloned in-frame in the bacterial vector pET15b (Novagen), suitable for inducible expression by T7 RNA polymerase (23). The protein product includes six consecutive histidine residues at the N-terminus to facilitate isolation of overproduced protein by nickel affinity chromatography. Cell pellets recovered from induced cultures were lysed under non-denaturing conditions and the recombinant protein isolated at >95% purity (data not shown).

Biochemical activity of purified recombinant Tetrahymena Rad51 protein

As a first step towards establishing that the putative T.thermophila RAD51 gene encodes a functional RecA/Rad51 homolog, the ability of the purified recombinant protein to hydrolyze ATP was examined. The T.thermophila Rad51 protein is a DNA-dependent ATPase that is stimulated to a much greater extent by single-stranded than by double-stranded DNA (Fig. 2). Under the conditions employed, ATPase activity is nearly undetectable when no DNA is present. The degree to which the T.thermophila ATPase activity is dependent on DNA is shared by the S.cerevisiae and human Rad51 proteins (32,33). Similar to the yeast and human homologs, the level of ATPase activity in the presence of single-stranded DNA is substantially lower than that reported for RecA (34).

Figure 2. DNA-dependent ATPase activity of the T.thermophila Rad51 protein. Hydrolysis of 0.2 mM [[gamma]-³²P]ATP by purified Rad51 protein (25 µg/ml) in the presence of 8 µg/ml ssDNA ([utrif]), dsDNA ([squf]) or no DNA ([bull]).

Based on the DNA-dependent ATPase activity, it seems likely that the T.thermophila Rad51 protein is a single- and/or double-stranded DNA binding protein. It has been well documented that bacterial, yeast and human RecA/Rad51 homologs form helical filaments around a DNA core (35,36). Pre-incubation of recombinant T.thermophila Rad51 protein with either single- or double-stranded DNA results in retardation of the DNA electrophoretic mobility, an effect that is enhanced at higher protein concentrations (Fig. 3).

Figure 3. Altered electrophoretic mobility of DNA in the presence of purified Rad51 protein. Single-stranded [phis]X174 DNA (0.25 µg) or double-stranded pUC119 (0.20 µg) was incubated in 20 µl at 37°C for 10 min with purified Rad51 protein as described in Materials and Methods. The reactions were resolved by electrophoresis in 0.8% agarose gels and stained with ethidium bromide. Lane M, [lambda]/HindIII marker. Lanes 1-8, purified T.thermophila Rad51 protein: lanes 1 and 5, 0 µg; lanes 2 and 6, 3 µg; lanes 3 and 7, 7.5 µg; lanes 4 and 8, 14 µg.

It has been shown recently that purified human Rad51 protein stimulates formation of intermolecular ligation events catalyzed by T4 DNA ligase, whereas intramolecular ligation products predominate in the absence of Rad51 protein (33). An earlier report indicated a similar activity associated with the RecA protein (37). This activity is apparently conserved in the T.thermophila homolog. Plasmid DNA, linearized with PstI and incubated with T4 ligase, results in almost exclusive intramolecular ligation of the substrate (Fig. 4). In contrast, a short pre-incubation of the linearized plasmid with purified T.thermophila Rad51 protein prior to addition of T4 ligase results in a substantial increase in formation of intermolecular ligation products. The formation of multimers is also concentration dependent, as pre-incubation with increasing amounts of Rad51 protein results in an increasingly dramatic shift from intramolecular to intermolecular ligation events. Ligation products containing two or three plasmid monomers (2mers and 3mers respectively) are indicated; lesser amounts of products containing four or more monomers were also detected (data not shown). The linearized plasmid DNA in Figure 4 included 4 bp 3[prime] DNA overhanging ends. Additional experiments with plasmids linearized by restriction enzymes that generate either 5[prime] overhanging or blunt ends demonstrate a similar effect on intermolecular ligation of substrate molecules (data not shown).

Figure 4. Intermolecular ligation in the presence of purified Rad51 protein. Linearized [phis]X174 DNA was preincubated with 0, 5 or 10 µg Rad51 protein for 5 min at 37°C. T4 DNA ligase was added and the 20 µl reaction incubated at 16°C overnight as described in Materials and Methods. Reaction products were deproteinated and resolved by electrophoresis in a 0.8% agarose gel, which was stained with ethidium bromide. The migration of multimers (1mer, relaxed circles, 2mer and 3mer) are indicated.

DNA damaging agents induce Rad51 expression

It has been shown that exposure to X-rays, UV irradiation and chemicals such as MMS can lead to induction of RAD51 gene expression in a variety of eukaryotic cells (1,38-40).

The T.thermophila RAD51 gene is expressed to some degree under normal growth conditions, given that the Rad51 cDNA was isolated from a library made with RNA derived from normal cells in the logarithmic phase of growth (Materials and Methods). We wanted to determine if T.thermophila RAD51 is differentially expressed when growing cells are exposed to UV radiation. Northern blot analysis of poly(A)⁺ RNA from cells 2 h after irradiation with UVC revealed a dramatic induction of Rad51 mRNA (Fig. 5A). In contrast, mock-irradiated cells exhibited the same low level of Rad51 mRNA throughout the 2 h time course. Quantitation of the northern blot hybridization in Figure 5A indicates that Rad51 mRNA levels increase ~100-fold over the 2 h following UV irradiation (data not shown).

Figure 5. DNA damage induction of RAD51 expression. (A) Northern blot analysis of poly(A)⁺ RNA from cells with (+) and without (-) UV irradiation as described in the text. Samples were prepared at 0, 0.5, 1 and 2 h after irradiation. Duplicate northern blots were hybridized with both RAD51-specific and non-specific radiolabeled probes, as described in Materials and Methods. (B) Western blot analysis of extracts from cells with (+) and without (-) UV irradiation. Samples were prepared from cells at 0 and 4 h after treatment as described in the text. The polyclonal antibody used was raised against recombinant T.thermophila Rad51 protein. (C). Quantitation of Rad51 protein levels from cells treated with MMS. The relative amounts of Rad51 protein present in whole cell lysates from cultures (1-2 × 10⁵ cells/ml) treated with 0, 1.4 and 4.2 mM MMS for 4 h were quantitated by scanning densitometry of a western blot as described in Materials and Methods.

UV induction of RAD51 expression is also manifest at the level of protein synthesis. It is evident in western blot analysis of S100 cell extracts prepared 4 h after UV irradiation that Rad51 protein levels increase dramatically relative to that from unirradiated cell extracts (Fig. 5B). Similarly, western analysis of whole cell lysates from T.thermophila cultures exposed to MMS for 4 h reveals a dramatic increase in Rad51 protein levels, compared with lysates from mock-treated cultures (Fig. 5C).

Coincident with the increased levels of Rad51 protein induced by exposure to DNA damaging agents is its pronounced localization in the macronucleus, as revealed by immunocytochemistry (Fig. 6). Interestingly, immunostaining of the macronucleus was equally pronounced in cells exposed to 1.4 and 4.2 mM MMS for 4 h, whereas western blot analysis of lysates revealed increased Rad51 protein only at the higher concentration (Fig. 5C). Similar localization was also evident in cells exposed to UV irradiation (data not shown).

Figure 6. Macronuclear-specific localization of Rad51 protein in cells treated with the alkylating agent MMS for 4 h. Only cytoplasmic background fluorescence was observed in untreated cells. Immunofluorescence is excluded from micronuclei (4.2 mM MMS). Bar, 50 µm.

DISCUSSION

We have cloned and characterized the RAD51 homolog from the ciliate T.thermophila, the first recA-like gene isolated from a member of the Kingdom Protista. Given the position of the protists in the eukaryote phylogeny (41), it is not surprising that the T.thermophila Rad51 protein shares more or less the same similarity with homologous proteins from divergent eukaryotic lineages. Following the sequence alignment of Brendel et al. (28), a pairwise comparison of the T.thermophila Rad51 protein reveals sequence identities of 72.1, 63.6, 66.6 and 63.3% with homologs from Homo sapiens, Drosophila melanogaster, S.cerevisiae and S.pombe respectively. Approximately 48% amino acid identity is shared amongst all five homologous proteins.

The biochemical activities of the Tetrahymena Rad51 protein resemble those of homologous proteins isolated from other eukaryotes. Analysis of the purified recombinant protein indicate that, like the yeast and human homologs, the T.thermophila Rad51 protein is a single- and double-stranded DNA-dependent ATPase. The T.thermophila homolog shares with the human Rad51 protein the ability to dramatically shift the substrate specificity of DNA ligase (33). Rad51 protein from these two species both substantially enhance the formation of intermolecular ligation products when incubated with linearized plasmid DNA and T4 DNA ligase. This shift to intermolecular ligation products is at the expense of intramolecular products when compared with control reactions in which the ligase alone is present. The significance of this observation is unclear. A previous report suggested that this property of human Rad51 protein (33), which is known to be expressed at elevated levels in vertebrate lymphoid cells (42-44), could relate to a possible role in V(D)J or class switch recombination. While this remains a possibility, both the T.thermophila Rad51 (Fig. 4) and bacterial RecA (37) proteins are also able to stimulate intermolecular ligation events. These observations suggest that this property may represent a general feature of strand transfer proteins. The recent demonstration that the human Dmc1 protein possesses in vitro DNA strand exchange activity (45) may now permit this question to be addressed.

We observed that T.thermophila Rad51 mRNA and protein levels are elevated significantly following treatment with UV radiation. Inducible expression appears to be a general feature of both RecA and Rad51 homologs. Tetrahymena thermophila appears to be somewhat unique, however, in the extreme extent to which induction occurs. In contrast to other organisms, in which 2- 10-fold induction of steady-state mRNA is observed following treatment with a variety of DNA damaging agents, we observed a >100-fold induction of T.thermophila Rad51 mRNA following treatment with short wavelength UV radiation. We observed elevated steady-state levels of Rad51 mRNA within 30 min following irradiation (the earliest time point thus far examined), with levels steadily rising over a 2 h interval. We also performed a number of experiments in which RT-PCR was used to amplify Rad51 mRNA. Based upon these studies, we observed essentially equivalent increases in Rad51 mRNA steady-state levels over a UV dose range of 1400-5200 J/m² (data not shown). Rad51 protein levels also increased substantially following exposure to the alkylating agent MMS. Similar observations have been made in a variety of eukaryotic cells treated with this agent (1,38,39). Coincident with RAD51 induction was Rad51 protein localization in the macronucleus. Similarly, the human Rad51 homolog has been shown to form nuclear foci following DNA damage (38). Interestingly, we did not detect Rad51 protein in the micronuclei of vegetatively dividing cells treated with 4.2 mM MMS for 4 h (Fig. 6). The level of Rad51 protein in micronuclei may be below the threshold for detection by immunofluorescence in response to MMS. Alternatively, there may not be a RAD51-dependent DNA repair mechanism in the micronucleus.

All of the experiments described above measured steady-state Rad51 mRNA levels. Therefore, it is unclear at this time whether the increased levels of Rad51 mRNA and protein result predominantly through induced transcriptional activation, as appears to be the case in yeast. While the majority of reported cases of induced expression in T.thermophila appear to occur through this mechanism (46,47), there is precedent for elevated expression as a consequence of altered mRNA stability (48). Finally, it is plausible that altered protein turnover might also play a role in this phenomenon. We are in the process of creating reporter constructs containing the DNA sequences upstream of the ATG initiator codon of the T.thermophila RAD51 gene. These constructs will permit us to examine the mechanism of UV induction of Rad51 in T.thermophila. Irrespective of the mechanism by which Rad51 protein levels are elevated, its increased expression following treatment with DNA damaging agents strongly implicates this protein in T.thermophila DNA repair.

It is possible that the T.thermophila Rad51 protein may play a role in a variety of genome rearrangements that occur within this organism. It will be of interest to examine the possible involvement of this protein in programed genome deletions associated with macronuclear development (49). Maturation and amplification of rDNA palindromes may also be mediated in part by the Rad51 protein. Yao and colleagues have demonstrated that introduction of linearized DNA substrates can lead to the formation of large DNA palindromes in yeast (50). Interestingly, palindrome formation from the DNA substrate is dependent on the presence of a short 42 bp inverted repeat critical to rDNA palindrome formation in T.thermophila (51). In addition, this process does not occur efficiently in a yeast rad52 mutant, strongly implicating homologous recombination in this process. We have recently constructed T.thermophila strains in which the macronuclear RAD51 gene has been insertionally inactivated. While there appears to be a slight decrease in growth rate, the knockout strains are otherwise viable (manuscript in preparation). We are currently examining the possible role of the Rad51 protein and/or associated proteins on rDNA palindrome formation in Tetrahymena.

ACKNOWLEDGEMENTS

We acknowledge the assistance of Michael Rafferty with antibody production, western blot hybridization and immunocytochemistry. We also thank Dr Uma Lakshmipathy for assistance with image analysis and Dr T.Walseth, O.Madison and F.Unger for helpful comments. This work was supported by grants from the NIH (CA61906 to C.C.; GM50861 to D.P.R.), the American Heart Association (96010390 to C.C.), the American Cancer Society (DHP-171 to C.C.) and the Minnesota Medical Foundation (CRF-185-98 to D.P.R.).

REFERENCES

1. Basile,G., Aker,M. and Mortimer,R.K. (1992) Mol. Cell. Biol., 12, 3235-3246. MEDLINE Abstract

2. Camerini-Otero,R.D. and Hsieh,P. (1995) Annu. Rev. Genet., 29, 509-552. MEDLINE Abstract

3. Sandler,S.J., Satin,L.H., Samra,H.S. and Clark,A.J. (1996) Nucleic Acids Res., 24, 2125-2132. MEDLINE Abstract

4. Cox,M.M. (1993) BioEssays, 15, 617-623. MEDLINE Abstract

5. Petes,T.D., Malone,R.E. and Symington,L.S. (1991) In Broach,J.R., Pringle,J.R. and Jones,E.W. (eds), The Molecular and Cellular Biology of the Yeast Saccharomyces. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 407-521.

6. Woods,W.G. and Dyall,S.M. (1997) Mol. Microbiol., 23, 791-797. MEDLINE Abstract

7. Lim,D.S. and Hasty,P. (1996) Mol. Cell. Biol., 16, 7133-7143. MEDLINE Abstract

8. Tsuzuki,T., Fujii,Y., Sakumi,K., Tominaga,Y., Nakao,K., Sekiguchi,M., Matsushiro,A., Yoshimura,Y. and Morita,T. (1996) Proc. Natl. Acad. Sci. USA, 93, 6236-6240. MEDLINE Abstract

9. Xia,S.J., Shammas,M.A. and Smookler Reis,R.J. (1997) Mol. Cell. Biol., 17, 7151-7158. MEDLINE Abstract

10. Taki,T., Ohnishi,T., Yamamoto,A., Hiraga,S., Arita,N., Izumoto,S., Hayakawa,T. and Morita,T. (1996) Biochem. Biophys. Res. Commun., 223, 434-438. MEDLINE Abstract

11. Sturzbecher,H.W., Donzelmann,B., Henning,W., Knippschild,U. and Buchhop,S. (1996) EMBO J., 15, 1992-2002. MEDLINE Abstract

12. Buchhop,S., Gibson,M.K., Wang,X.W., Wagner,P., Sturzbecher,H.W. and Harris,C.C. (1997) Nucleic Acids Res., 25, 3868-3874. MEDLINE Abstract

13. Coyne,R.S. and Yao,M.C. (1996) Genetics, 144, 1479-1487. MEDLINE Abstract

14. Kapler,G.M. (1993) Curr. Opin. Genet. Dev., 3, 730-735. MEDLINE Abstract

15. Romero,D.P. and Blackburn,E.H. (1991) Cell, 67, 343-353. MEDLINE Abstract

16. McCormick-Graham,M. and Romero,D.P. (1996) Mol. Cell. Biol., 16, 1871-1879.

17. Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

18. Saiki,R.K., Gelfand,D.H., Stoffel,S., Scharf,S.J., Higuchi,R., Horn,G.T., Mullis,K.B. and Erlich,H.A. (1988) Science, 239, 487-491. MEDLINE Abstract

19. Laemmli,U.D. (1970) Nature, 227, 680-685. MEDLINE Abstract

20. McCormick-Graham,M. and Romero,D.P. (1995) Nucleic Acids Res., 23, 1091-1097. MEDLINE Abstract

21. McCormick-Graham,M., Haynes,W.J. and Romero,D.P. (1997) EMBO J., 16, 3233-3242. MEDLINE Abstract

22. Kunkel,T.A., Roberts,J.D. and Zakour,R.A. (1987) Methods Enzymol., 155, 166-178.

23. Tabor,S. and Richardson,C.C. (1985) Proc. Natl. Acad. Sci. USA, 82, 1074-1078. MEDLINE Abstract

24. Romero,D.P., Arredondo,J.A. and Traut,R.R. (1990) J. Biol. Chem., 265, 18185-18191. MEDLINE Abstract

25. Gassmann,M., Thommes,P., Weiser,T. and Hubscher,U. (1990) FASEB J., 4, 2528-2532. MEDLINE Abstract

26. Collins,K. and Greider,C.W. (1995) EMBO J., 14, 5422-5432. MEDLINE Abstract

27. Harlow,E. and Lane,D. (1988) Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

28. Brendel,V., Brocchieri,L., Sandler,S.J., Clark,A.J. and Karlin,S. (1997) J. Mol. Evol., 44, 528-541. MEDLINE Abstract

29. Martindale,D.W. (1989) J. Protozool., 36, 29-34. MEDLINE Abstract

30. Stargell,L.A. and Gorovsky,M.A. (1994) Mol. Cell. Biol., 14, 723-734. MEDLINE Abstract

31. Horowitz,S. and Gorovsky,M.A. (1985) Proc. Natl. Acad. Sci. USA, 82, 2452-2455. MEDLINE Abstract

32. Sung,P. (1994) Science, 265, 1241-1243. MEDLINE Abstract

33. Baumann,P., Benson,F.E. and West,S.C. (1996) Cell, 87, 757-766. MEDLINE Abstract

34. Roca,A.I. and Cox,M.M. (1990) Crit. Rev. Biochem. Mol. Biol., 25, 415-456. MEDLINE Abstract

35. Ogawa,T., Yu,X., Shinohara,A. and Egelman,E.H. (1993) Science, 259, 1896-1899. MEDLINE Abstract

36. Benson,F.E., Stasiak,A. and West,S.C. (1994) EMBO J., 13, 5764-5771. MEDLINE Abstract

37. Rusche,J.R., Konigsberg,W. and Howard Flanders,P. (1985) J. Biol. Chem., 260, 949-955. MEDLINE Abstract

38. Haaf,T., Golub,E.I., Reddy,G., Radding,C.M. and Ward,D.C. (1995) Proc. Natl. Acad. Sci. USA, 92, 2298-2302. MEDLINE Abstract

39. Jang,Y.K., Jin,Y.H., Kim,E.M., Fabre,F., Hong,S.H. and Park,S.D. (1994) Gene, 142, 207-11. MEDLINE Abstract

40. Stassen,N.Y., Logsdon,J.J., Vora,G.J., Offenberg,H.H., Palmer,J.D. and Zolan,M.E. (1997) Curr. Genet., 31, 144-157. MEDLINE Abstract

41. Sogin,M.L., Morrison,H.G., Hinkle,G. and Silberman,J.D. (1996) Microbiologia, 12, 17-28. MEDLINE Abstract

42. Bezzubova,O., Shinohara,A., Mueller,R.G., Ogawa,H. and Buerstedde,J.M. (1993) Nucleic Acids Res., 21, 1577-1580. MEDLINE Abstract

43. Shinohara,A., Ogawa,H., Matsuda,Y., Ushio,N., Ikeo,K. and Ogawa,T. (1993) Nature Genet., 4, 239-243. MEDLINE Abstract

44. Li,M.J., Peakman,M.C., Golub,E.I., Reddy,G., Ward,D.C., Radding,C.M. and Maizels,N. (1996) Proc. Natl. Acad. Sci. USA, 93, 10222-10227. MEDLINE Abstract

45. Li,Z.F., Golub,E.I., Gupta,R. and Radding,C.M. (1997) Proc. Natl. Acad. Sci. USA, 94, 11221-11226.

46. Stargell,L.A., Karrer,K.M. and Gorovsky,M.A. (1990) Nucleic Acids Res., 18, 6637-6639. MEDLINE Abstract

47. Haddad,A. and Turkewitz,A.P. (1997) Proc. Natl. Acad. Sci. USA, 94, 10675-10680. MEDLINE Abstract

48. Love,H.D.J., Allen-Nash,A., Zhao,Q. and Bannon,G.A. (1988)Mol. Cell. Biol., 8, 427-432.

49. Coyne,R.S., Chalker,D.L. and Yao,M.C. (1996) Annu. Rev. Genet., 30, 557-578. MEDLINE Abstract

50. Butler,D.K., Yasuda,L.E. and Yao,M.C. (1996) Cell, 87, 1115-1122. MEDLINE Abstract

51. Yasuda,L.F. and Yao,M.-C. (1991) Cell, 67, 505-516. MEDLINE Abstract

---

*To whom correspondence should be addressed. Tel: +1 612 624 8997; Fax: +1 612 625 8408; Email: romero@lenti.med.umn.edu

---

This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 16 Jun 1998
Copyright©Oxford University Press, 1998.
CiteULike    Connotea    Del.icio.us    What's this?

This article has been cited by other articles:

				A. S. Wilkins and R. Holliday The Evolution of Meiosis From Mitosis Genetics, January 1, 2009; 181(1): 3 - 12. [Full Text] [PDF]

				K. Mochizuki, M. Novatchkova, and J. Loidl DNA double-strand breaks, but not crossovers, are required for the reorganization of meiotic nuclei in Tetrahymena J. Cell Sci., July 1, 2008; 121(13): 2148 - 2158. [Abstract] [Full Text] [PDF]

				J. S. Yakisich, P. Y. Sandoval, T. L. Morrison, and G. M. Kapler TIF1 Activates the Intra-S-Phase Checkpoint Response in the Diploid Micronucleus and Amitotic Polyploid Macronucleus of Tetrahymena Mol. Biol. Cell, December 1, 2006; 17(12): 5185 - 5197. [Abstract] [Full Text] [PDF]

				J. J. Smith, E. S. Cole, and D. P. Romero Transcriptional control of RAD51 expression in the ciliate Tetrahymena thermophila Nucleic Acids Res., August 10, 2004; 32(14): 4313 - 4321. [Abstract] [Full Text] [PDF]

				U. Markmann-Mulisch, M. Z. Hadi, K. Koepchen, J. C. Alonso, V. E. A. Russo, J. Schell, and B. Reiss The organization of Physcomitrella patensRAD51 genes is unique among eukaryotic organisms PNAS, March 5, 2002; 99(5): 2959 - 2964. [Abstract] [Full Text] [PDF]

				T. C. Marsh, E. S. Cole, and D. P. Romero The Transition From Conjugal Development to the First Vegetative Cell Division Is Dependent on RAD51 Expression in the Ciliate Tetrahymena thermophila Genetics, April 1, 2001; 157(4): 1591 - 1598. [Abstract] [Full Text]

				T. C. Marsh, E. S. Cole, K. R. Stuart, C. Campbell, and D. P. Romero RAD51 Is Required for Propagation of the Germinal Nucleus in Tetrahymena thermophila Genetics, April 1, 2000; 154(4): 1587 - 1596. [Abstract] [Full Text]

This Article Abstract Print PDF (228K) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Search for citing articles in: ISI Web of Science (10) Request Permissions Commercial Re-use Guidelines for Open Access NAR Content Google Scholar Articles by Campbell, C. Articles by Romero, D. P. Search for Related Content PubMed PubMed Citation Articles by Campbell, C. Articles by Romero, D. P. Social Bookmarking          What's this?