| Nucleic Acids Research | Pages |
Biophysical and antisense properties of oligodeoxynucleotides containing 7-propynyl-, 7-iodo- and 7-cyano-7-deaza-2-amino-2[prime]-deoxyadenosines
Introduction
Nucleoside synthesis
Materials And Methods
General procedures
Nucleoside synthesis
Sodium-salt glycosylation
Transient protection and benzoylation
Synthesis, purification and Tm analysis of oligodeoxynucleotides
Oligonucleotide treatment in cell culture
Northern blot analysis
Antisense assays
Results And Discussion
Acknowledgements
References
Biophysical and antisense properties of oligodeoxynucleotides containing 7-propynyl-, 7-iodo- and 7-cyano-7-deaza-2-amino-2[prime]-deoxyadenosines
ABSTRACT
INTRODUCTION
Recently, several reports have detailed the synthesis of 7-deaza-7-substituted 2[prime]-deoxypurine nucleosides and their incorporation into oligodeoxynucleotides (ODNs) (1-3). The results of these findings indicate that methyl, propynyl or halogen substituents at the C-7 position in 7-deaza-2[prime]-deoxypurines (purine numbering of the nucleosides is used throughout the general section) improve the ODN binding characteristics to DNA and RNA target sequences relative to control sequences with unmodified purines (4-8). Enhanced duplex stability observed with these modifications has been attributed to the increased hydrophobicity and the extended [pi]-electron area of the nucleobases. These properties result in favorable vertical stacking interactions in the context of the heteroduplex formed between the ODN and a complementary mRNA sequence (1,2). This stability has most often been quantified by spectroscopic melting experiments, Tm. The general finding has been that an increase in Tm translates into improved antisense activity over unmodified sequences (9-13).
We set out to synthesize various 7-deaza-2-amino-2[prime]-deoxyadenosines bearing substituents at C-7 with the potential to enhance hydrophobic properties and dipole-dipole stacking interactions beneficial to duplex stability (14). It is known that 2-amino adenosine shows enhanced binding to uridine compared with adenosine (15). We therefore reasoned that the combination of three hydrogen bonds and an extended [pi]-electron area would provide optimal binding of antisense sequences containing 7-substituted-7-deaza-2-amino-2[prime]-deoxyadenosines to their RNA targets. We now report on the synthesis of the 7-propynyl-, 7-cyano- and 7-iodo-7-deaza-2-amino-2[prime]-deoxyadenosines.
Nucleoside synthesis
The synthesis of the 7-propynyl- and 7-iodo-7-deaza-2-amino-adenosines relied on the intermediacy of the 2-amino-6-chloro-7-iodo-7-deaza-2[prime]-deoxypurine (3). Thus, we chose to begin the synthesis with the acylation of the 2-amino-4-chloro-pyrrolo-[2,3-d]pyrimidine (16) using pivaloyl chloride in pyridine (Scheme 1). A regiospecific iodination (17,18) of the acylated product using N-iodosuccinimide in DMF yielded the 4-chloro-5-iodo-2-pivaloylamino-pyrrolo[2,3-d]pyrimidine (2) in 89% yield for the two steps. Subsequent sodium-salt glycosylation of 2 using the 1-chloro-2-deoxy-3,5-di-O-p-toluoyl-[alpha]-d-erythro-pento-furanose afforded the [beta]-nucleoside 3 as the only observed product (19,20). Removal of the toluoyl protecting groups and displacement of the 4-chloro group of 3 was effected with methanolic ammonia, in a sealed stainless steel vessel at 100°C.
Although harsh, this procedure provided the 7-iodo-7-deaza-2-amino-2[prime]-deoxyadenosine (4) in moderate yields upon chromatography. The next task was to identify protecting groups for the nucleobase amino groups that could survive automated oligonucleotide synthesis and remain labile to concentrated ammonium hydroxide treatment following synthesis. The initial choice of dimethylamino formamidine groups provided materials which lost protecting groups during automated synthesis. This undoubtedly was responsible for the multiple oligonucleotide products observed by gel electrophoresis.
Scheme 1. (a) Piv-Cl/Py; (b) N-iodosuccinimide/DMF; (c) NaH/CH3CN/r.t.; (d) NH3/MeOH, 95-100°C, 18 h; (e) (i) TMS-Cl/Py/0°C, (ii) BzCl/r.t., (iii) NH4OH/H2O/r.t.; (f) DMT-Cl/Py; (g) N,N,N[prime],N[prime]-tetraisopropyl-2-cyanoethyl diphosphoramidite/CH3CN. We chose benzoyl protecting groups despite the observation of Seela and Thomas (2) that this group was difficult to remove from 7-deaza-2[prime]-deoxyadenosines. We reasoned that a modified protocol involving sequential treatment of oligonucleotides with concentrated ammonium hydroxide followed by aqueous methylamine could be used to deprotect all nucleobase amine groups. This procedure has been used to deprotect ODNs with unusually stable groups. Treatment with con NH4OH removes benzoyl and isobutyryl groups on dC, dA and dG while 40 % aqueous methylamine removes the benzoyl groups on 7-deaza bases. We have detected 4-methylamino cytidine substitutions in ODNs treated first with aqueous methyl-amine. Some experimentation was required in order to determine the conditions for a transient silylation of the sugar hydroxyls followed by protection of each amino group with a single benzoyl group (21). With this method in hand, the 2,6-di-benzoylamino-7-iodo-7-deaza-2-amino-2[prime]-deoxy-adenosine (5) was prepared as a crystalline product. It was found that removal of the benzoyl groups from this nucleoside could be effected using 40% dimethylamine at 55°C in a 2 h incubation. This material was subsequently converted to the phosphoramidite monomer 7. A regiospecific Pd-catalyzed coupling of 3 with propyne (22) was effected using a procedure described by Hobbs and Coccuza (23,24) to obtain the coupled product 8 in 85% yield (Scheme 2). The resulting material 8 was treated with methanolic ammonia at 100°C to yield the 7-propynyl-7-deaza-2[prime]-deoxy-2-aminoadenosine (9) in moderate yield. Using the benzoylation procedure developed for 4, compound 9 was protected with benzoyl groups and then converted to the phosphoramidite monomer 12.
Scheme 2. (a) (Ph3P)4Pd-CuI, Et3N, propyne (1); (b) NH3 (1), 100°C, 18 h; (c) (i) TMS-Cl/Py/r.t., (ii) BzCl/r.t., (iii) NH4OH/H2O/0°C; (d) DMT-Cl/Py; (e) N,N,N[prime],N[prime]-tetraisopropyl-2-cyanoethyl diphosphoramidite/CH3CN. We expended considerable energies investigating a Pd-catalyzed coupling of 3 with trimethylsilyl cyanide (25,26) without success. This coupling would have yielded a convenient route to the 7-deaza-7-cyano-2-amino-2[prime]-deoxyadenosine (19; 2-amino-2[prime]-deoxy-toyocamycin). Consequently, we sought an independent route which employed the dicyanopyrrole 13, (27) the product of the annulation of tetracyanoethylene in HBr and acetic acid (Scheme 3). This material could not be adequately characterized at this stage but was more readily purified upon hydrogenolysis of the bromo group using Pd-BaCO3 yielding 14. Ring-closure of 14 was effected at 170°C using chloroformamidine hydrochloride, according to a procedure which yields a highly insoluble material (28). The compound 15 was transformed into a compound more soluble in organic solvents, compound 16, by acylation with pivaloyl chloride. It should be noted that protection of the diamine 15 with benzoyl groups yielded a compound which was insoluble under the conditions of sodium-salt glycosylation (13) in aceto-nitrile, which was the intended next step. Using the 5-cyano-2,4-di-pivaloylamino-pyrrolo[2,3-d]pyrimidine (16) and the 1-chloro-2-deoxy-3,5-di-O-p-toluoyl-[alpha]-d-erythro-pentofuranose, this procedure gave the protected 7-cyano-7-deaza-2,6-di-pivaloylamino-2[prime]-deoxyadenosine (17) in 65% yield (13,14). A selective removal of the toluoyl protecting groups was effected using aqueous sodium hydroxide-methanol-pyridine to give 18, leaving the pivaloyl protecting groups intact. This selective deprotection procedure has been successfully used in our laboratory for the synthesis of a 2,6-dibenzoyl-2-amino-2[prime]-deoxyadenosine. The pivaloyl groups of 18 could be removed using aqueous 40% dimethylamine at 55°C to provide 19.
Scheme 3. (a) 30% HBr/HOAc/acetone/EtOAc; (b) H2-Pd(BaCO3)/DMF/MeOH; (c) chloroformamidine-HCl/Dowtherm A/170°C; (d) pivaloyl chloride/Py; (e) NaH/CH3CN; (f) aqueous NaOH/Py/MeOH; (g) 40% aqueous methylamine, 55°C, 18 h; (h) DMT-Cl/Py; (i) N,N,N[prime],N[prime]-tetraisopropyl-2-cyanoethyl diphosphoramidite/CH3CN. The 7-cyano nucleoside 18 was routinely dimethoxytritylated and then phosphitylated to yield the phosphoramidite 21. The nucleoside phosphoramidites 7, 12 and 21 were individually coupled with >90% efficiency to standard d(C, A, G) or T derived resins, as measured by trityl cation yields at 496 nm.
MATERIALS AND METHODS
General procedures
All reagents and solvents were purchased from Aldrich Chemical Co. Flash chromatography was performed on silica gel (Baker 40 µm) according to the procedure of Still et al. (29). Thin-layer chromatography was performed on Kieselgel 60 F-254 glass plates from E. Merck, and compounds were visualized with UV light and sulfuric acid-methanol spray followed by charring. Solvent systems used for thin-layer and flash chromatography were: (i) ethyl acetate-hexanes, 3:2; (ii) ethyl acetate-methanol, 4:1; (iii) chloroform-methanol, 9:1. Elemental analyses were performed by Quantitative Technologies, Bound Brook, NJ. All reactions were performed under an argon atmosphere unless otherwise noted. 1H and 31P spectra were recorded using a Gemini 200 Varian spectrometer. Electrospray mass spectrometry was performed on a Hewlett-Packard 5989A spectrometer and a 59987A electrospray instrument. Molecular simulations were performed on an Indigo2 SGI machine using a SPARTAN (Wavefunction, Inc., Irvine, CA) or Molecular Simulations (San Diego, CA) software package.
Nucleoside synthesis
Systematic numbering is used in this section, as for compound 4 in Figure
Sodium-salt glycosylation
4-Chloro-5-iodo-2-pivaloylamino-7-(2-deoxy-3,5-di-O-p-toluoyl-[beta]-d-erythro-pentofuranosyl)-7H-pyrrolo[2,3-d]pyrimidine (3). To a solution of 2 (25 g, 66 mmol) in acetonitrile (450 ml) was added NaH (3.96 g, 165 mmol). The mixture was heated to 50°C briefly, cooled to ambient temperature and treated with 1-chloro-2-deoxy-3,5-di-O-p-toluoyl-[alpha]-d-erythro-pentofuranose (25 g, 64 mmol). The reaction mixture was stirred at ambient temperature for 16 h and the precipitate which formed was filtered and washed with acetonitrile (20 ml). The filter cake was dissolved in dichloro-methane (450 ml), washed with cold aqueous NaHCO3, water and brine, and then dried over MgSO4, filtered and evaporated to a solid. Trituration of this solid with methanol yielded a product which was dried in vacuo to give 28 g (58%) of 3. 1H-NMR (CDCl3): [delta] , 8.15 [bs, 1, N (2)-H]; 7.43 (s, 1, H-6); 8.0 and 7.3 (2m, 8, toluoyl); 6.73 (t, 1, H-1[prime]); 5.77 (m, 1, H-3[prime]); 4.7 (m, 3, H-4[prime],5[prime],5[prime][prime]); 2.85 (m, 2, H-2[prime],2[prime][prime]); 2.42 (2s, 6, toluoyl methyl); 1.33 (m, 9, pivaloyl methyl). A noesy NMR spectrum was consistent with the [beta] configuration: observed off-diagonal resonances from H-8 to H-1[prime], H-2[prime] and H-3[prime]; H-1[prime] to H-4[prime]. TLC (solvent A) Rf = 0.65. Mp = 215-217°C.Figure 1.Purine and systematic numbering for 2-amino-2[prime]-deoxyadenosine and 7-deaza-2-amino-2[prime]-deoxyadenosines, respectively.
2,4-Diamino-5-iodo-7-(2-deoxy-[beta]-d-erythro-pentofuranosyl)-7H-pyrrolo[2,3-d]pyrimidine (4). A suspensionof 3 (9.0 g, 12.3 mmol) in 120 ml methanolic ammonia (saturated at 0°C) was stirred at 100°C in a sealed stainless steel vessel for 18 h. The turbid solution was filtered and the filtrate evaporated to dark brown solid which was stirred in 20 ml methanol until a light brown precipitate appeared. This was filtered, washed with cold methanol and dried to yield 3 g (62%)of 4. 1H-NMR (DMSO-d6): [delta], 7.23 (s, 1, H-6); 6.35 (t, 1, H-1[prime]); 6.2 (bs, 2, NH2); 5.8 (bs, 2, NH2); 5.2 (d, 1, 3[prime]-OH, exch. w/D2O); 5.0 (t, 1, 5[prime]-OH, exch. w/D2O). Mp = 213-217°C. TLC (solvent B) Rf = 0.56. UV (methanol): [lambda]max ([epsis]): 286 (7999); 270 (8617); 260 (7373). Analysis: calculated for (C11H14N5O3): C, 33.80; H, 3.58; N, 17.90. Found: C, 34.22; H, 3.56; N, 17.42.
Transient protection and benzoylation
2,4-Dibenzoylamino-5-iodo-7-(2-deoxy-[beta]-d-erythro-pentofurano-syl)-7H-pyrrolo[2,3-d]pyrimidine (5). A suspension of 4 (2.2 g, 8.5 mmol) in pyridine (50 ml) was cooled in an ice bath and treated dropwise with TMS-Cl (5.4 ml, 42.5 mmol). The solution was stirred at ambient temperature for 2 h, again cooled in an ice bath and treated with benzoyl chloride (4.9 ml, 42.5 mmol) then stirred for an additional 2 h. Cold water was added (10 ml), the resulting solution stirred for 3 h, and concentrated NH4OH (10 ml) was added dropwise. The stirring was continued for an additional 2.5 h. The mixture was evaporated to a solid which was triturated with 50 ml cold water, filtered, washed with cold water and dried to yield 4.0 g (80%) of 5. 1H-NMR (DMSO-d6): [delta], 11.05 (bs, 2, amide N-H); 8.5-7.5 (m, 11, benzoyl); 6.62 (t, 1, H-1[prime]); 5.3 (d, 1, 3[prime]-OH, exch. w/D2O); 5.0 (t, 1, 5[prime]-OH, exch. w/D2O); 4.38 (m, 1, H-3[prime]); 3.85 (m, 1, H-4[prime]); 3.58 (m, 2, H-5[prime],5[prime][prime]); 2.6 and 2.2 (2m, 2, H-2[prime]2[prime][prime]). TLC (solvent B), Rf = 0.62. Mass spec, m/z, M - H+ = 598 for C25H22N5O5I.2,4-Dibenzoylamino-5-iodo-7-(2-deoxy-5-O-dimethoxytrityl-[beta]-d-erythro-pentofuranosyl)-7H-pyrrolo[2,3-d]pyrimidine (6). A solution of 5 (1.0 g, 1.7 mmol), DMT-Cl (0.75 g, 2.2 mmol) and DMAP (63 mg, 0.51 mmol) was stirred in 15 ml anhydrous pyridine for 18 h at ambient temperature. The reaction was partitioned between water and dichloromethane, and the organic layer separated and washed with brine. The solution was then dried over MgSO4, filtered and the filtrate evaporated to a solid yellow foam. Flash chromatography using solvent C containing 0.5% triethylamine yielded 1.1 g (73%) of 6. 1H-NMR (DMSO-d6): [delta], 11.1 (br m, 2, amide N-H); 8.7-6.8 (m, 24, aromatic and H-6,); 6.62 (t, 1, H-1[prime]); 5.4 (d, 1, 3[prime]-OH, exch. w/D2O); 4.40 (s, 1, 3[prime]-H); 4.00 (m, 1, H-4[prime]); 3.73 (s, 6, methoxy); 3.3 (m, 2, H-5[prime],5[prime][prime]); 2.7 and 2.3 (2 m, 2, H-2[prime]2[prime][prime]). TLC (solvent C) Rf = 0.86.2,4-Dibenzoylamino-5-iodo-7-(2-deoxy-5-O-dimethoxytrityl-[beta]-d-erythro-pentofuranosyl-3-O-cyanoethyl-N,N[prime]-diisopropylphosphoramidite)-7H-pyrrolo[2,3-d]pyrimidine (7). A solution of 6 (1.05 g, 1.16 mmol), N,N,N[prime],N[prime]-tetraisopropyl-2-cyanoethyl-diphosphoramidite (0.45 ml, 1.4 mmol) and diisopropyl-ammonium tetrazolide (0.14 g, 0.812 mmol) in 10 ml acetonitrile was stirred at ambient temperature for 18 h. Ethyl acetate (10 ml) was added and the mixture concentrated to a minimal volume. The residue was dissolved in 35 ml ethyl acetate, washed three times with brine, dried over MgSO4, filtered and evaporated to a yellow oil. Flash chromatography using solvent C containing 0.5% triethylamine yielded 0.90 g (75%) of 7. 1H-NMR (CD3CN): [delta], 9.0 (bs, 2, NH); 8.0-6.8 (m, 14, aromatic and H-6); 6.49 (t, 1, H-1[prime]); 4.75 (m, 1, H-3[prime]); 4.15 (m, 1, H-4[prime]); 3.28 (m, 2, H-5[prime]5[prime][prime]). 31P-NMR (CD3CN): 149.2, 149.5.4-Chloro-2-pivaloylamino-5-propynyl-7-(2-deoxy-3,5-di-O-p-toluoyl-[beta]-d-erythro-pentofuranosyl)-7H-pyrrolo[2,3-d] pyrimidine (8). A flask containing 3 (10.0 g, 13.7 mmol) and bis-(triphenylphosphine) palladium (II)chloride (0.96 g, 1.37 mmol) and copper(I)iodide (0.52 g, 2.44 mmol) was thoroughly purged with argon gas. DMF (135 ml) was added and the solution was purged with argon gas for 10 min. Triethylamine (5.7 ml, 41.1 mmol) was added followed by condensed propyne gas (6 ml). The solution was sealed and stirred at ambient temperature for 18 h, then evaporated to an oil. Upon trituration with methanol, the product precipitated and was collected by filtration, washed with cold methanol and dried in vacuo to yield 7.5 g (85%) of 8. 1H-NMR (CDCl3): [delta], 8.25 (bs, 1, amide N-H); 7.4 (s, 1, H-6); 6.73 (t, 1, H-1[prime]); 2.09 (s, 3, methyl); 1.33 (m, 9, pivaloyl methyl). Mp = 215-217°C. TLC (solvent A) Rf = 0.63.2,4-Diamino-5-propynyl-7-(2-deoxy-[beta]-d-erythro-pentofuranosyl)-7H-pyrrolo[2,3-d]pyrimidine (9). Compound 9 was prepared as per the ammonolysis procedure for the synthesis of 4. Yield of 9 is 1.1 g (50%), isolated as an oil. 1H-NMR (DMSO-d6): [delta], 7.2 (s, 1, H-6); 6.30 (t, 1, H-1[prime]); 6.20 (br s, 2, NH2); 5.8 (br s, 2, NH2); 5.25 (d, 1, 3[prime]-OH, exch. w/D2O); 5.10 (t, 1, 5[prime]-OH, exch. w/D2O); 1.78 (s, 3, methyl). TLC (solvent B) Rf = 0.58. UV (methanol), [lambda]max ([epsis]): 294 (7414); 272 (7259); 260 (7552).2,4-Dibenzoylamino-5-propynyl-7-(2-deoxy-[beta]-d-erythro-pento-furanosyl)-7H-pyrrolo[2,3-d]pyrimidine (10). Compound 10 was prepared as per the benzoylation procedure used for synthesis of 5. Yield of 10 is 1.2 g (65%). 1H-NMR (DMSO-d6): [delta] ,11.0 (s, 2, N-H); 8.5-7.5 (m, 11, aromatic and H-6); 6.64 (t, 1, H-1[prime]); 5.4 (d, 1, 3[prime]-OH, exch. w/D2O); 5.0 (t, 1, 5[prime]-OH, exch. w/D2O); 4.40 (m, 1, H-3[prime]); 3.88 (m, 1, H-4[prime]); 3.63 (m, 2, H-5[prime],5[prime][prime]); 2.6 and 2.3 (2 m, 2, H-2[prime],2[prime][prime]); 1.50 (s, 3, methyl). TLC (solvent B) Rf = 0.84. Mass spec, m/z, M + H+ = 512 for C28H25N5O5.2,4-Dibenzoylamino-5-propynyl-7-(2-deoxy-5-O-dimethoxytrityl-[beta]-d-erythro-pentofuranosyl)-7H-pyrrolo[2,3-d]pyrimidine (11). Compound 10 was tritylated as per the procedure used in the synthesis of 6. Yield is 1.8 g (72%). 1H-NMR (DMSO-d6): [delta], 11.2 (bs, 2, N-H); 8.3-6.8 (m, 24 H, aromatic and H-6); 6.65 (t, 1, H-1[prime]); 5.4 (d, 1, 3[prime]-OH, exch. w/D2O); 4.40 (m, 1, H-3[prime]); 4.00 (m, 1, H-4[prime]); 3.77 (s, 6, methoxy); 3.32 (m, 2, H-5[prime],5[prime][prime]); 2.6 and 2.3 (2 m, 2, H-2[prime],2[prime][prime]); 1.50 (s, 3, methyl). TLC (solvent C) Rf = 0.85.2,4-Dibenzoylamino-5-propynyl-7-(2-deoxy-5-O-dimethoxytrityl-.[beta]-d-erythro-pentofuranosyl-3-O-cyanoethyl-N,N[prime]-diisopropylphosphoramidite)-7H-pyrrolo[2,3-d]pyrimidine (12). Compound 12 was prepared as per the phosphitylation procedure used in the synthesis of 7. Yield of 12 is 1.4 g (70%). 1H-NMR (CD3CN): [delta], 8.5 (br s, 2, N-H); 8.0-6.8 (m, 14, aromatic and H-6); 6.45 (t, 1, H-1[prime]); 4.80 (m, 1, H-3[prime]); 4.15 (m, 1, H-4[prime]); 3.35 (m, 2, H-5[prime],5[prime][prime]). 31P-NMR (CD3CN): 149.32, 149.59.2-amino-5-bromo-2,3-dicyanopyrrole (13). A solution of tetracyanoethylene (14.5 g, 113 mmol) in acetone (81 ml) and ethyl acetate (171 ml) was treated with a solution of 33% HBr in acetic acid (81 ml) while maintaining the internal temperature at 0-5°C. The reaction mixture was stirred for an additional 30 min and the resulting yellow solid was filtered, washed with cold water and air dried. The solid was suspended in 150 ml water. The pH of the suspension was adjusted to 11 with 50% NaOH to achieve solution, stirred for 15 min and then treated with glacial acetic acid to pH 5 to yield a precipitate, which was filtered and dried in vacuo over KOH to yield 18.6 g (78%) of 13. 1H-NMR (DMSO-d6): [delta], 12.3 (br s, 1, N-H); 6.46 (br s, 2, NH2). Mp > 210°C.2-Amino-3,4-dicyanopyrrole (14). A suspension of 13 (4.0 g) and 5% Pd on BaCO3 (4.0 g) in DMF (15 ml) and methanol (25 ml) was maintained under 50 psi H2 for 3 h. The mixture was filtered through Celite and the filtrate evaporated to 10 ml. Cold water (200 ml) was added and the brown solid that resulted was filtered to yield 1.40 g (60%) of 14. 1H-NMR (DMSO-d6): [delta], 11.1 (br s, 1, N-H); 7.11 (s, 1, H-5); 6.3 (br s, 2, NH2). Mp > 220°C.5-Cyano-2,4-diamino-pyrrolo[2,3-d]pyrimidine (15) (27). A mechanically stirred mixture of 14 (5.26 g, 32.8 mmol) and chloroformamidine hydrochloride (5.0 g, 43 mmol) in Dowtherm-A (100 ml) was heated at 170°C for 48 h until no 14 could be detected by TLC (solvent B). The mixture was cooled to ambient temperature and 100 ml ether was added. The resulting greenish solid was filtered and washed with ether to give 6.1 g (80%) of 15. This material was further purified by trituration with methanol. 1H-NMR (DMSO-d6): [delta], 7.6 (br s, 2, NH2); 8.2 (br s, 2, NH2); 8.02 (s, 1, H-6); 12.9 (br s,1, N-H). TLC (solvent B)Rf = 0.58. Mp > 300°C.5-Cyano-2,4-dipivaloylamino-pyrrolo[2,3-d]pyrimidine (16). A mixture of 15 (5.8 g, 33 mmol) and trimethyl acetylchloride (16.0 g, 133 mmol) in anhydrous pyridine (100 ml) was stirred at ambient temperature for 18 h. The solution was partitioned between 30 ml saturated aqueous NaHCO3 and 150 ml ethyl acetate. The organic phase was separated, washed with water and brine, dried over MgSO4 and evaporated to a dark oil. The oil was triturated with hexane-ethyl acetate (1:20) to give a light brown precipitate which was filtered and dried. Yield is 8.25 g (72%) of 16. 1H-NMR (DMSO-d6): [delta], 10.0 (s, 1, NH2); 10.4 (s, 1, NH2); 8.3 (s, 1, H-6); 12.9 (br s, 1, N-H). TLC (solvent A) Rf = 0.17. Mp > 220°C. Mass spec, m/z, M - H+ = 341 for C17H22N6O2.5-Cyano-2,4-dipivaloylamino-7-(2-deoxy-3,5-di-O-p-toluoyl-[beta]-d-erythro-pentofuranosyl)-7H-pyrrolo[2,3-d]pyrimidine (17). Compound 17 was prepared using the sodium-salt glycosylation procedure for the synthesis of 3. Yield of 17 was 70%. A small aliquot of this material was purified by flash chromatography using solvent B to provide an analytical sample. 1H-NMR (DMSO-d6): [delta], 10.5 [s, 1, N (4)H]; 10.1 [s, 1, N (2)H]; 8.6 (s, 1, H-6); 8.0-7.3 (2m, 8, toluoyl); 6.6 (t, 1, H-1[prime]); 2.4 (2s, 6, toluoyl methyl); 1.3 (m, 18, pivaloyl methyl). Mp > 230°C. TLC (solvent B) Rf = 0.53. Analysis: calculated for C38H42N6O7: C, 65.70; H, 6.05; N, 12.10. Found: C, 65.78; H, 6.06; N, 12.42.5-Cyano-2,4-dipivaloylamino-7-(2-deoxy-[beta]-d-erythro-pentofuranosyl)-7H-pyrrolo[2,3-d]pyrimidine (18). A solution of 17 (2.70 g, 3.89 mmol) in pyridine-methanol-water (65:30:5) was cooled in an ice bath and treated dropwise with 4 N NaOH (12.2 ml). After 30 min at ice bath temperature, the pH was adjusted to 6 with glacial acetic acid and the mixture evaporated in vacuo to a light brown oil. This oil was partitioned between 100 ml ethyl acetate and 30 ml water. The organic phase was washed with water then brine, dried over MgSO4, filtered and evaporated in vacuo to yield a dark yellow oil. The oil was purified by flash chromatography using solvent system A to yield 1.75 g (96%) of 18. 1H-NMR (DMSO-d6): [delta], 10.5 (s, 1, NH2); 10.1 (s, 1, NH2); 8.6 (s, 1, H-6); 6.6 (t, 1, H-1[prime]); 5.4 (d, 1, 3[prime]-OH, exch. w/D2O); 5.03 (t, 1, 3[prime]-OH, exch. w/D2O).5-Cyano-2,4-diamino-7-(2-deoxy-[beta]-d-erythro-pentofuranosyl)-7H-pyrrolo[2,3-d]pyrimidine (19). A 100 mg sample of 18 was suspended in 40% aqueous methylamine (10 ml) and heated in a sealed vessel for 18 h at 55°C. The darkened solution was evaporated in vacuo and the residue that resulted was precipitated from methanol to yield 65 mg of 19. 1H-NMR (DMSO-d6): [delta], 8.00 (s, 1, H-6); 6.35 (m, 3, H-1[prime] and NH2); 6.08 (bs, 2, NH2); 4.34 (m, 1, H-3[prime]); 3.83 (m, 1, H-4[prime]); 3.58 (m, 2, H-5[prime],5[prime][prime]) and 2.5-2.1 (m, 2, H-2[prime],2[prime][prime]). IR (film), [nu] = 2221/cm.5-Cyano-2,4-dipivaloylamino-7-(2-deoxy-5-O-dimethoxytrityl-[beta]-d-erythro-pentofuranosyl)-7H-pyrrolo[2,3-d]pyrimidine (20). Compound 20 was prepared as per the tritylation procedure used in the synthesis of 6. Yield of 20 is 2.5 g (63%). 1H-NMR (DMSO-d6): [delta], 10.5 (bs, 1, amide N-H); 10.1 (bs, 1, amide N-H); 8.71-6.72 (m, 14, aromatic); 6.62 (t, 1, H-1[prime]); 5.44 (d, 1, 3[prime]-OH); 4.44(m, 1, H-3[prime]); 4.00 (m, 1, H-4[prime]); 3.75 (s, 6, methoxy); 3.40 (br s, 2, H-5[prime]5[prime][prime]); 3.2 (m, 2, methine); 2.7 and 2.4 (2 m, 2, H-2[prime],2[prime][prime]); 1.30 (m, 18, methyl). TLC (solvent C) Rf = 0.82.5-Cyano-2,4-dipivaloylamino-7-(2-deoxy-5-O-dimethoxytrityl-[beta]-d-erythro-pentofuranosyl-3-O-cyanoethyl-N,N[prime]-diisopropylphosphoramidite)-7H-pyrrolo[2,3-d]pyrimidine (21). Compound 21 was prepared as per the phosphitylation procedure used in the synthesis of 7. Yield of 21 is 50%. 1H-NMR (CD3CN): [delta], 8.7 (bs, 1, NH); 8.4 (br s, 1, NH); 8.00 (s, 1, H-6); 7.5-6.6 (m, 13, aromatic); 6.63 (t, 1, H-1[prime]); 4.85 (m, 1, H-3[prime]); 4.15 (m, 1, H-4[prime]); 3.30 (m, 2, H-5[prime],5[prime][prime]). 31P-NMR (CD3CN): 149.88, 149.55.Synthesis, purification and Tm analysis of oligodeoxynucleotides
All ODNs were synthesized on an ABI 380B using the phosphoramidite method. Sequences for Tm analysis were phosphodiester sequences; sequences for antisense assays were converted to internucleotide phosphorothioate linkages via oxidation withBeaucage reagent (30). The ODNs were purified by HPLC over a C-18 reverse phase column, detritylated using dichloroacetic acid and precipitated from ethanol/water. Electrospray mass spectrometry confirmed the integrity of all ODNs. Spectroscopic melting experiments were performed under the conditions of 100 mM sodium chloride, 10 mM phosphate buffer (pH 7.1) and 0.1 mM EDTA. The identity of oligonucleotides 22-28 as project compounds is indicated with Isis numbers in parentheses.
Oligonucleotide treatment in cell culture
Mouse bEND cells growing at a density of 60-80% confluency were used for oligonucleotide treatments and mRNA analysis. Cells were washed with warm phosphate-buffered saline (37°C) and then treated with the designated ODN in Opti-MEM (Gibco BRL) containing cationic lipid (Lipofectin Reagent, Gibco BRL) at a concentration of 3 µg/ml per 100 nM concentration of ODN used. Following a 4 h incubation, the treatment media was replaced with pre-warmed Dulbecco's Modified Eagle's Medium (DMEM; Gibco BRL) containing 10% fetal bovine serum and the cells were incubated for an additional 20 h at 37°C.
Northern blot analysis
Total RNA was prepared from the cells using the guanidinium isothiocyanate procedure (31). RNA mixtures were separated by electrophoresis through 1.2% agarose-formaldehyde gels and transferred to Zeta-Probe hybridization membranes (Bio-Rad) by overnight capillary diffusion. The RNA was cross-linked to the membrane by exposure to UV light (Stratalinker, Stratagene) and then hybridized with random-primed 32P-labeled full-length cDNA probes corresponding to mouse C-raf. The levels of mouse C-raf mRNA were quantified by PhosphorImager analysis (Molecular Dynamics) as described previously (32).
Antisense assays
We incorporated the phosphoramidites 7 and 12 into a sequence targeted to murine C-raf RNA, previously shown to act through a sequence-specific antisense mechanism of action (33), in order to determine their effects on target gene expression. Thus, compounds 7 and 12 were incorporated once, thrice or four times in a sequence complementary to a portion of the 3-UTR of the mouse C-raf mRNA (Table 2).
In this assay, mouse bEND cells were incubated with ODNs over a serial range of concentrations and C-raf mRNA levels were examined. Percentage of control was calculated by a comparison with C-raf mRNA levels in cells that did not receive oligonucleotide and IC50 values were subsequently determined for all ODNs (Table 2).
Table 1.
| CTC GTA CCA TTC CGGTCC | GGA CCG GAA GGT ACG AG | ACCGAGGATCATGTCGTACGC | |
| 7-Iodo (7) | +3.05 | +1.30 | +0.57 |
| (0.84) | (0.03) | (-0.15) | |
| 7-Propynyl (12) | +3.86 | +1.54 | +0.85 |
| (1.65) | (0.19) | (0.12) | |
| 7-Cyano (21) | +2.78 | +0.37 | +0.28 |
| (0.54) | (-0.98) | (0.16) |
Table 2.
| Modification | C-raf sequences | [Delta]Tm per modfication (°C) | IC50 (nm) |
| None | (22) ATG CAT TCT GCC CCC AAG GA | 220 | |
| 7-deaza-7-propyne-2-amino-2[prime]-deoxy A (12) | (23) ATG CAT TCT GCC CCC AAG GA | 2.5 | 250 |
| (24) ATG CAT TCT GCC CCC AAG GA | 2.4 | 125 | |
| (25) ATG CAT TCT GCC CCC AAG GA | 1.8 | 100 | |
| 7-deaza-7-iodo-2-amino-2[prime]-deoxy A (7) | (26) ATG CAT TCT GCC CCC AAG GA | 1.1 | 250 |
| (27) ATG CAT TCT GCC CCC AAG GA | 0.6 | 250 | |
| (28) ATG CAT TCT GCC CCC AAG GA | 0.7 | 175 |
RESULTS AND DISCUSSION
Standard ODN sequences for Tm analysis containing a single incorporation of the 7-deaza-2-amino-2[prime]-deoxyadenosines exhibited a 3-4°C increase in melting temperatures over identical sequences containing 2[prime]-deoxyadenosine (Table 1). Five incorporations in a 17 or 21mer improved binding by 0.28-1.54°C/modification, indicating that the effect was not additive for multiple incorporations of the nucleotides 7, 12 or 21. The isolated effects of the iodo, propynyl or cyano moieties (Table 1, values in parentheses) were small and positive for a single incorporation. However, the effects were small and negative for multiple incorporations, as compared with 2-amino-2[prime]-deoxyadenosine. A notable exception to this trend was the effect of the propynyl group, which raised the melting temperature relative to dA for all sequences examined. This modification likewise did not show an additive effect on Tm with multiple incorporations.
A number of theoretical and computational studies have been carried out to date to estimate the strength of hydrogen bonds present among the base pairs in wild-type duplexes (34). We have used a SPARTAN software package (Wavefunction, Inc., Irvine, CA) to calculate the partial atomic charges for 9. These calculations have been repeated with 9 in a 9:uridine base-pair. Due to the substantial changes in the electronic nature of 9 compared with A, our results do not indicate an increase in hydrogen bond strength. However, the computations performed on a stacked 9:uridine dimer in the context of a duplex indicate a large favorable increase in [pi]-stacking energy for 9. Furthermore, advanced molecular modeling studies (Molecular Simulations software) on a model A-form DNA-RNA duplex, with 9 as a point modification at an A:U site, indicate that the general features of the A-form duplex are maintained.
One, three and four incorporations of the 7-iodo compound in sequences 26-28 (ISIS 14752, 14751 and 14750) exhibited antisense activities similar to the unmodified compound 22 (ISIS 11061) as measured by the reduction of C-raf mRNA levels (Table 2). Although there is an increase in potency with increasing substitutions, the overall effect is small. The best antisense agents proved to be the 7-propyne analogs, compounds 24 (ISIS 14757) and 25 (ISIS 14756). These compounds, with three and four incorporations respectively, exhibited 2-3-fold better potency than 22 (Fig.
An increased antisense potency for compounds 23 (ISIS 14758), 24 and 25 correlates well with the superior binding demonstrated for the 7-propynyl nucleobase. The increase in melting temperature per substitution (Table 2, [Delta]Tm/modification) for compounds 23-25 holds steady around 2°C/substitution, a value less than that for standard melt sequences in Table 1. It should be noted that the effect of phosphorothioate linkages is to depress the Tm by ~0.5°C/linkage. This decreased value in 22-24 is due in part to the location of substitutions at the oligonucleotide flanks, where fraying effects would lessen the stacking contributions from each base (14). In contrast, compounds 26-28 show a decline in [Delta]Tm/modification with multiple substitutions, just as in similarly substituted melt sequences in Table 1. We speculate that multiple incorporations of this nucleobase cause distortions in the A-form heteroduplex that are not offset by stacking effects and were not predicted by molecular models.
Figure 2. Reduction in C-raf kinase mRNA levels in murine bEND cells after treatment with oligo 22 (ISIS 11061) and 7-propynyl-7-deaza-2-amino-2[prime]-deoxyadenosine substituted analogs. bEND cells grown in culture were treated as described with the indicated antisense oligonucleotides (Table 2) at increasing concentrations (50-400 nM). (A) Northern blot analysis of C-raf mRNA levels. Oligonucleotide treatments are indicated. Concentrations used are: lanes 1, 50 nM; lanes 2, 100 nM; lanes 3, 200 nM; lanes 4, 400 nM. (B) Quantitation of C-raf mRNA levels shown in (A) after normalisation to G3PDH levels. Further investigations employing sequences active against other targets are needed to determine whether substitution of the 7-propyne nucleobase consistently improves the potency of antisense compounds in a substitution-dependent manner. These investigations are now ongoing in our laboratories and the results will be reported elsewhere. We would like to thank Robert Springer for the preparation of certain chemical starting materials, John Brugger for oligonucleotide synthesis, Stuart Dimock for helpful discussions and Anna Alessi for manuscript preparation.
ACKNOWLEDGEMENTS
REFERENCES
This article has been cited by other articles:
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 2 Jul 1998
Copyright©Oxford University Press, 1998.
CiteULike 
Connotea 
Del.icio.us What's this?
X. Peng, H. Li, and F. Seela
pH-Dependent mismatch discrimination of oligonucleotide duplexes containing 2'-deoxytubercidin and 2- or 7-substituted derivatives: protonated base pairs formed between 7-deazapurines and cytosine
Nucleic Acids Res.,
November 6, 2006;
34(20):
5987 - 6000.
[Abstract]
[Full Text]
[PDF]
F. Seela and R. Kroschel
The base pairing properties of 8-aza-7-deaza-2'-deoxyisoguanosine and 7-halogenated derivatives in oligonucleotide duplexes with parallel and antiparallel chain orientation
Nucleic Acids Res.,
December 15, 2003;
31(24):
7150 - 7158.
[Abstract]
[Full Text]
[PDF]
F. Seela and G. Becher
Pyrazolo[3,4-d]pyrimidine nucleic acids: adjustment of dA-dT to dG-dC base pair stability
Nucleic Acids Res.,
May 15, 2001;
29(10):
2069 - 2078.
[Abstract]
[Full Text]
[PDF]
J.-W. Oh, T. Ito, and M. M. C. Lai
A Recombinant Hepatitis C Virus RNA-Dependent RNA Polymerase Capable of Copying the Full-Length Viral RNA
J. Virol.,
September 1, 1999;
73(9):
7694 - 7702.
[Abstract]
[Full Text]
This Article 
Abstract
Print PDF (133K)
Alert me when this article is cited
Alert me if a correction is posted
Services
Email this article to a friend
Similar articles in this journal
Similar articles in ISI Web of Science
Similar articles in PubMed
Alert me to new issues of the journal
Add to My Personal Archive
Download to citation manager
Search for citing articles in:
ISI Web of Science (28)
Request Permissions
Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Articles by Balow, G.
Articles by Acevedo, O. L.
Search for Related Content
PubMed
PubMed Citation
Articles by Balow, G.
Articles by Acevedo, O. L.
Social Bookmarking
What's this?