| Nucleic Acids Research | Pages |
TRIP: a novel double stranded RNA binding protein which interacts with the leucine rich repeat of Flightless I
Introduction
Materials And Methods
DNA/RNA manipulations
cDNA library screening
Transfections and fluorescence microscopy
Protein analysis
RNA analysis
Electrophoretic mobility shift assays (EMSA)
Results
Molecular cloning of trip
Expression and mitogen induction of trip
Purification and RNA binding specificity of TRIP
There are two TRIP binding sites on the TAR stem
Identification of the TRIP RNA binding domain
TRIP binds the LRR of FLI
TRIP is localised in the cytoplasm
Discussion
Acknowledgements
References
TRIP: a novel double stranded RNA binding protein which interacts with the leucine rich repeat of Flightless I
DDBJ/EMBL/GenBank accession nos AJ223075 and AJ223076
ABSTRACT
INTRODUCTION
Flightless I (FliI) was originally identified as a mutation in Drosophila melanogaster which leads to flightlessness due to disorganisation of the indirect flight muscle myofibrils (1). Drosophila embryos with mutations in fliI show incomplete cellularisation and this is associated with an abnormal cortical cytoskeleton (2). FliI and the human homologue FLI have two clear domains, an N-terminal leucine-rich repeat (LRR) and a C-terminal gelsolin-like domain which binds actin (3,4). The LRR is a protein-protein interaction domain found in many proteins with diverse functions (5). The crystal structure of the LRR from ribonuclease inhibitor indicates that this motif forms a non-globular horseshoe with RNAse binding to the inner concave face (6). Since FLI contains an actin binding domain and LRR, it has the potential to directly link other proteins to the cytoskeleton. The LRR of FLI has homology with a group of LRRs which interact with RAS-like ligands (5,7) but failed to interact with these proteins in the yeast two-hybrid assay and in vitro. A search for proteins which did interact with the FLI LRR identified a partial human cDNA and a full-length murine cDNA for FLAP. FLAP has an N-terminal coiled coil domain which probably mediates the interaction with the FLI LRR (4). The interaction of a LRR with a coiled coil has been observed previously in the interaction between decorin and collagen in which a triple helical collagen molecule fits into the central cavity produced by the decorin LRR (8). FLAP shows no sequence homology with other proteins and its biological role is unclear at present.
The Tat protein of HIV-1 is a potent activator of transcription from the viral promoter within the LTR. Tat binds to the TAR RNA element present at the 5[prime] end of all viral transcripts. TAR RNA extends from nucleotides +1 to + 57 and folds into a stem-loop structure with a tri-pyrimidine bulge which forms part of the base triple between U23 and A27-U38 in the upper stem, recognised by Tat (9). The lower TAR stem, below the UCU bulge, consists of a 19 bp stem with two mismatched bases. The HIV-1 LTR is responsive to a number of environmental influences such as UV light, and such stresses can lead to activation of the LTR in the absence of the viral transactivator Tat (10,11). This suggests that there may be stress-inducible cellular factors capable of influencing expression from the LTR. A number of cellular TAR binding proteins have been identified previously (12-17), including a series of UV-inducible RNA binding proteins which show a preference for GC-rich double stranded RNA molecules (18). These factors may be involved in the UV activation of the LTR and normally influence RNA metabolism in response to environmental stress.
In order to identify and characterise the constitutive and stress inducible cellular factors which recognise double stranded RNA molecules, we screened UV-induced cDNA expression libraries with radiolabelled TAR. We report here the isolation and characterisation of the human and hamster cDNAs for a novel double stranded TAR RNA interacting protein, TRIP. The N-terminus of TRIP shows extensive homology with the coiled coil domain of the recently identified FLI-binding protein FLAP, and interacts with the FLI LRR.
MATERIALS AND METHODS
DNA/RNA manipulations
DNA subcloning procedures were as described previously (19). 5[prime] and 3[prime] deletions of trip were generated using the polymerase chain reaction (PCR) and subcloned into the glutathione S-transferase (GST) expression vector pGEX4T2. The human FLI gene LRR was cloned and N-terminally epitope tagged with the myc peptide sequence EQKLISEEDL, by PCR amplification from a [lambda]gt11 human skeletal muscle cDNA library (Clontech) with the following primers: 5[prime]-ggcgggatccccaccatggagcagaaactgatctctgaagaagacctggaggccaccggggtgctgccg and 5[prime]-ccccggatcctctagattaggccagggccttgcagaa. The PCR product which corresponds to amino acids 1-400 of FliI was subcloned on a BamHI fragment into pGEM3Zf+ in both orientations to generate pFLIsense and pFLIantisense. In vitro RNA synthesis and purification was carried out using linearised template plasmids and either SP6 or T7 RNA polymerase (Promega) as described previously (19). The templates used for the wild type and mutant TAR RNA syntheses were generated by annealing complementary oligonucleotides for the TAR sequences and subcloned into the EcoRI and HindIII sites of pGEM3Zf+. DNA sequencing was carried out using cycle sequencing with dye-labelled terminators using thermosequenase (Amersham). Samples were analysed using a Perkin Elmer ABI 377 Prism automated sequencer, using synthetic oligonucleotides to sequence both strands of the cDNAs. Prediction of coiled coil regions in protein sequences was done with the Pepcoil program based on the algorithm of Lupas et al. (20). DNA fragments for hybridisations were radiolabelled using [32P]dCTP and a Ready To Go DNA labelling kit (Pharmacia). Radioactive gels and blots were dried and exposed overnight using PhosphorImager screens and scanned using a Molecular Dynamics STORM imager which was also used for quantitation of bands.
cDNA library screening
[lambda]ZAP cDNA expression libraries were constructed using mRNA isolated from the HeLa and CHO-K1 cell lines, which had been irradiated with 30 J/m2 UV light and harvested 4 h later using mRNA purification and cDNA library construction kits from Stratagene. Expression screening was carried out as described previously (12) using full-length (+1 to +80) radiolabelled TAR RNA generated from plasmid pPE38 (21). Positive plaques coincident on duplicate filters were re-screened twice until single, well-isolated plaques were identified. In vivo excision was used to convert phage into pBKCMV plasmids containing the cDNA insert according to the manufacturer's instructions (Stratagene). The full length human trip cDNA was isolated by conventional hybridisation screening using an expressed sequence tag (Genome Systems Inc.). Plasmid pSW4 consists of the in vivo excised pBKCMV derivative containing the hamster trip cDNA, and pSW5 contains the cDNA for the full length human trip.
Transfections and fluorescence microscopy
HeLa, 293T and COS-7 cells were grown in DMEM containing 10% FCS and non-essential amino acids. CHOK1 cells were grown in RPMI media containing 10% FCS. Media was removed prior to UV irradiation which was carried out using a Stratalinker. Transient transfections of 293T and COS-7 cells were carried out using calcium phosphate precipitates and cells were harvested 36 h post-transfection. COS-7 cells were fixed using 3% paraforma-dehyde prior to examination and photography using an Olympus fluorescence microscope. The following plasmids were used in transfections: pCMVHAhTRIP was generated by PCRamplification of trip from pSW5. The 5[prime] PCR oligonucleotide contained the DNA sequence coding for the HA epitope preceded by a Kozak sequence (22) and initiator methionine and this peptide was in frame with the N-terminal methionine of TRIP in the final construct. The PCR product was subcloned into pCINEO on an XbaI fragment. The TRIP GFP construct was generated by subcloning the trip gene into pEGFP-N1 (Clontech) on a BamHI fragment generated by PCR.
Protein analysis
GST fusion proteins were expressed and purified from Escherichia coli using glutathione agarose according to the manufacturer's instructions (Pharmacia). Protein concentrations were determined using the Bradford assay (23). Expression of the GST-TRIP deletion series fusions was verified by SDS-PAGE and in cases where significant amounts of truncated fusions were produced, the amount of the intact fusion protein to use in EMSA was determined by densitometric scanning of Coomassie stained gels. In vitro transcription/translations of trip and fliI were carried out using pCMVHahTRIP, pFLIsense and pFLIantisense in the TNT coupled rabbit reticulocyte lysate system (Promega) and [35S]methionine according to the manufacturer's instructions. Western blots were prepared and probed with the anti-HA monoclonal antibody 12CA5 (Boehringer), an anti-murine horseradish peroxidase secondary antibody and detected using ECL according to the manufacturer's instructions (Amersham). For GST pull down experiments, 5 µg of GST or GST-hTRIP were bound to glutathione agarose and incubated with 15 µl of in vitro transcription-translated FLI for 1 h at 4°C in a total volume of 500 µl RIPA buffer [50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS]. Precipitated material was washed five times in RIPA buffer and bound material was eluted with elution buffer [20 mM Tris-HCl (pH 8.0), 20 mM glutathione] and analysed by SDS-PAGE and PhosphorImaging.
RNA analysis
Total RNA was isolated from HeLa cells using RNAeasy columns (Qiagen) and quantitated spectrophotometrically. Phorbol ester induction of HeLa cells was carried out using 100 nM PMA (Sigma) dissolved in dimethyl sulfoxide. The human RNA master blot (Clontech) and multiple tissue northern were probed with a trip cDNA probe according to the manufacturer's instructions. The trip probe corresponded to a 360 bp PstI-XhoI cDNA fragment from the 5[prime] end of the human trip cDNA.
Electrophoretic mobility shift assays (EMSA)
Reactions were performed at 0°C for 20 min in reaction buffer [10 mM Tris-HCl (pH 7.9), 2 mM MgCl2, 0.1mM EDTA, 4% glycerol, 5 ng/µl total yeast RNA and 50 mM KCl] using ~0.2 ng [32P]UTP (Amersham) labelled RNA probe (40 000 c.p.m.) and various concentrations of purified TRIP as indicated in the figure legends, in a total volume of 20 µl. Competitor RNAs or DNAs were added to the reaction before the probe and reactions were analysed by electrophoresis on 3.5% non-denaturing polyacrylamide gels run at 10 V/cm at 4°C unless otherwise indicated.
RESULTS
Molecular cloning of trip
A UV-induced CHO-K1 [lambda]cDNA expression library was screened using radiolabelled TAR RNA (+1 to +80). Of the 106 plaques screened initially, two consistently bound TAR in three rounds of plaque purification. One of these clones corresponded to La autoantigen which has previously been shown to bind TAR RNA (13). The second clone which appeared to bind TAR equally well in a northwestern assay (Fig.
Figure 1. Northwestern analysis of E.coli cell-free lysates. Extracts from isopropyl [beta]-d-thiogalactopyranoside (1 mM)-induced E.coli containing no plasmid (-VE) or the in vivo excised pBKCMV derivatives of the isolated [lambda] ZAP cDNA clones for La (LA) or cTRIP (TRIP) were electrophoresed on a 10% SDS-PAGE, transferred to nitrocellulose and subjected to northwestern analysis using radiolabelled TAR. Figure 2. Sequence analysis of human and hamster TRIP. Alignment of the predicted amino acid sequences of the human (hTRIP) and hamster (cTRIP) TRIP with murine FLAP. The predicted coiled coil domains are underlined. Identical amino acids in two or more sequences are shown in upper case. The RNA binding domain defined in Figure 6 is shown in bold. Database searches indicated that the N-terminal 272 amino acids of hTRIP had 96% sequence identity with the murine FLI associated protein FLAP (4), except murine FLAP has sequence insertions at amino acid positions 51, 83 and 136 of hTRIP (Fig. A 292 bp (1535-1827) region in the htrip cDNA sequence was found to be 100% identical to the sequence encoding the DNA binding domain of the transcriptional repressor GCF (bp 1-292, DDBJ/EMBL/GenBank accession no M29204) (24). This highly conserved region of DNA is translated in alternative reading frames in the two genes. The origin of this DNA is unclear though it is unlikely to have arisen from a cloning artefact since we identified a number of independent htrip clones containing this sequence together with ctrip which has similar sequences in this region. hTRIP has a predicted coiled coil region between residues 127 and 207 (Fig. 
Expression and mitogen induction of trip
Northern blot studies using a DNA probe from the 5[prime] end of the gcf gene which encompassed the 292 bp region homologous to htrip identified a 3.0 kb gcf transcript and two transcripts of unknown origin with sizes of 1.2 and 4.5 kb which were all induced by phorbol esters (25). Northern analysis with a probe to the 5[prime] end of the htrip gene identified a single transcript of 4.5 kb (Fig.
Figure 3. Analysis of trip gene expression. (A) Northern blot analysis using a fragment from the 5[prime] end of the htrip gene with poly(A)+ RNA isolated from a variety of cancer cell lines. A single transcript of ~4.5 kb is observed. The lower panel shows the signal obtained when the blot was re-hybridised with an actin probe. (B) Expression of htrip in a variety of human tissues. An RNA dot blot with normalised levels of poly(A)+ RNA (Clontech) was hybridised with an htrip probe and the signal quantitated using a PhosphorImager. Expression level is shown as a percentage of the signal seen in foetal heart. (C) Phorbol ester induction of htrip. HeLa cells were treated with 100 nM PMA, total RNA was isolated at the indicated times and 10 µg was used in northern analysis with an htrip probe. The expression of htrip was quantitated using a PhosphorImager and normalised with respect to the actin signal.
Purification and RNA binding specificity of TRIP
To investigate the RNA binding specificity of TRIP, we expressed hTRIP and cTRIP in E.coli as GST fusion proteins. Purification of hTRIP produced a significant amount of truncated protein; consequently cTRIP was used in EMSA. The purified recombinant cTRIP protein migrated anomalously on SDS-PAGE with an RMM of 174 kDa, compared to the actual RMM of 113 kDa, and contained a low level of degradation products (Fig.
Figure 4. Purification and nucleic acid binding specificity of TRIP. (A) A Coomassie-stained 10% SDS-PAGE of the purified GST-cTRIP fusion protein. The faint band seen below the major band represents a minor degradation product of the fusion protein. (B) Western blot analysis of 293T cell extracts prepared from mock-transfected and pCMVHAhTRIP-transfected cells, probed with the anti-HA monoclonal antibody 12CA5. (C) EMSA were carried out with with TAR RNA (+1 to +57), recombinant purified GST-cTRIP (100 nM) and various ribonucleic acid competitors (100 ng). (D) Graphical representation of EMSA competition assays using the indicated competitors at varying concentrations and 100 nM cTRIP protein. The percentage bound was quantitated using a STORM imager and represents the amount of protein-RNA complex formed, relative to the amount of protein-RNA complex formed in the absence of competitor, in each experiment. Experiments were carried out on at least three separate occasions and a representative dataset is shown. The overall RNA binding specificity of cTRIP was investigated by EMSA using single and double stranded RNA and DNA as competitors for TAR (+1 to +57) binding (Fig. 
There are two TRIP binding sites on the TAR stem
To identify the cTRIP binding site on TAR, a number of mutant TAR RNAs were synthesised and the relative affinities of cTRIP for these RNAs were determined by EMSA. Experiments with wild type TAR showed the formation of two discrete protein-RNA complexes (Fig.
Figure 5. TRIP binds to the TAR stem. (A) EMSA were carried out with TAR (+1 to +57) and mutant RNA molecules with varying concentrations of recombinant cTRIP as indicated. Protein-RNA complexes are indicated by arrows. A representative selection of mutant TAR EMSA are shown. (B) Sequence of TAR and mutant TAR RNA molecules used in EMSA and cTRIP binding affinities. Sequences shown in bold represent mutations from wild type TAR. The apparent equilibrium Kds for binding the mutant RNAs were taken as the concentration of cTRIP at which 50% of the input RNA was bound, where the percentage bound = [bound/(bound + free)] × 100. The values shown represent the averages of two independent determinations. To define the RNA binding domain of TRIP, a series of N- and C-terminal deletions of cTRIP were expressed and purified from E.coli (Fig. Figure 6. The TRIP RNA binding domain contains a lysine rich motif. (A) The extent of 5[prime] and 3[prime] end deletions in the trip genes used to define the RNA binding domain. The numbering refers to the amino acids incorporated into each fusion. (B) EMSA using the purified cTRIP proteins described in (A). An aliquot of 100 nM of the intact purified fusion protein was used in each reaction. (C) EMSA using 200 nM of the hTRIP1 and cTRIP7 proteins resolved on a 5% polyacrylamide gel. (D) EMSA using 200 nM of the cTRIP8-11 proteins described in (A) resolved on a 5% polyacrylamide gel. A basic region rich in lysines was identified within the RNA binding domain (Fig. The almost complete sequence identity between TRIP and the FLI interacting domain of murine and human FLAP suggested that TRIP might also bind the LRR of FLI. To test this, we generated radiolabelled FLI LRR and tested its ability to bind hTRIP in vitro (Fig. Figure 7. TRIP binds the LRR of FLI. FLI was generated by in vitro transcription/translation with reticulocyte lysate (RT) and [35S]methionine and tested for an interaction with GST-hTRIP. Lane 1 (AS FLI), 2 µl RT programmed with pFLIantisense; lane 2 (FLI), 2 µl RT programmed with a sense FLI cDNA; lane 3, proteins from 15 µl RT programmed with pFLIsense bound to glutathione agarose; lane 4, the same as lane 3 except the glutathione agarose was charged with 5 µg GST; lane 5, the same as lane 3 except the glutathione agarose was charged with 5 µg GST-hTRIP. Protein samples were examined on a 10% SDS-PAGE followed by PhosphorImaging. To determine the intracellular localisation of TRIP, the human cDNA was fused to the green fluorescent protein (GFP) to generate a TRIP-GFP fusion mammalian expression vector and this was transfected into COS-7 cells (Fig. Figure 8. Fluorescence microscopy of COS-7 cells transiently transfected with GFP fusions. (A) Cells transfected with pEGFPN1 which expresses a human codon optimised GFP protein. The protein is localised throughout the cell. (B Cells transfected with a derivative of pEGFPN1 which expresses a hTRIP-GFP fusion protein which is exclusively localised in the cytoplasm. In this study we have identified a novel mammalian RNA binding protein, TRIP, which is localised in the cytoplasm. TRIP binds to double stranded RNAs with high affinity and shows little binding to single stranded RNA or DNA. Double stranded DNA only acts as a competitor at high concentrations, suggesting that TRIP preferentially recognises an A form RNA helix rather than a B form DNA helix. There is no obvious sequence specificity to the TRIP RNA interaction, and this is a property shared with a number of other double stranded RNA binding proteins. This probably reflects the geometry of an A form helix in which the accessible minor groove provides few opportunities for sequence specific recognition (27,28). Whether TRIP binds to a specific subset of RNAs such as HIV-1 TAR in vivo remains to be determined. The RNA binding domain of TRIP does not conform to the well-characterised double stranded RNA binding motif seen in proteins such as TRBP (26), though this motif does have lysine rich elements (29). Instead, the highly basic domain is more reminiscent of those seen in viral proteins such as Tat (30,31), which interact with bulges within regions of double stranded RNA, and cellular proteins such as bicoid whose homeodomain contains a lysine/arginine-rich helix which binds DNA and RNA and regulates translation in Drosophila (32). The DNA sequence of htrip has a region with complete sequence identity to the transcriptional repressor gcf and previous studies identified two gcf related transcripts (25). It seems likely that htrip corresponds to one of those transcripts identified previously though the relationship between trip and gcf remains unclear. It is unlikely that the two transcripts arise by differential splicing since there are no other regions of homology within the genes. It is interesting to note that despite being translated in alternative reading frames, this region of DNA encodes basic amino acids in both proteins, and in each protein this region is responsible for nucleic acid binding. Both gcf and htrip are induced by phorbol esters, suggesting that htrip may play some role in a cell proliferation or growth response. The N-terminus of TRIP shows almost complete sequence identity with the coiled coil domain of the FLI binding protein, FLAP. Human FLAP was isolated on the basis of its interaction with the FLI LRR by a yeast two-hybrid screen, though its biological function is unclear at present. Northern analysis with human FLAP indicates there are multiple splice variants which are expressed in a tissue-specific manner, and human and murine FLAP show a different splicing pattern, but both proteins interact with the FLI LRR as demonstrated by co-immunoprecipitation (4). Whether hTRIP corresponds to a splice variant of FLAP or arises from a separate gene is not clear at present. We have confirmed that hTRIP interacts with the FLI LRR in vitro; therefore the FLI LRR probably has multiple binding partners in vivo. Coiled coil domains frequently homo- and hetero-dimerise (33) and TRIP and FLAP or combinations with other coiled coil proteins might dimerise and bind the FLI LRR in vivo. As a cytoplasmic RNA binding protein, TRIP may play a role in a number of different processes including translation, regulation of RNA stability or RNA localisation. Two other TAR stem binding factors identified previously, La and TRBP, have both been implicated in translational regulation. TRBP forms heterodimers with the double stranded RNA activated protein kinase, PKR, preventing its autophosphorylation, and this blocks PKR mediated inhibition of viral protein synthesis (34). In the cytoplasm, La is proposed to render translation cap-dependent in conjunction with other general RNA binding proteins, by binding mRNA and preventing spurious initiations at internal methionines (35). However, since FLI binds actin it is possible that TRIP and FLAP are associated with the actin cytoskeleton in vivo and TRIP may play a role in the localisation of RNA to the cytoskeleton. The actin binding domain of FLI shows homology with gelsolin and therefore might be expected to have actin filament severing and capping functions and be involved in reorganisation of the actin cytoskeleton; this is consistent with the observations that FLI mutations in Drosophila have a disorganised actin cytoskeleton (2). Therefore TRIP may be involved in the recruitment of RNA to sites of cytoskeletal reorganisation through its interaction with FLI. The TRIP-GFP fusion which would be expected to colocalise with FLI, and therefore actin, does not show a strikingly filamentous distribution; this is consistent with the intracellular distribution seen for a number of actin cytoskeleton modifying proteins such as gelsolin and CapG which show either a diffuse or punctate cytoplasmic distribution (36,37). For some time it has been known that poly(A)+ RNA co-localises with actin filaments (38) and a number of recent studies have implicated the cytoskeleton in the movement of RNA to specific cellular subcompartments (39). In particular, ashI mRNA in Saccharomyces cerevisiae is specifically localised to the presumptive daughter cell nucleus, and this process requires the actin cytoskeleton (40,41). In mammalian cells, the binding of extracellular matrix components to integrin receptors stimulates the formation of focal adhesion complexes (FACs). Recently it has been demonstrated that mRNA and ribosomes rapidly localise to FACs formed following integrin binding (42). This process depends on the ability of integrins to mechanically couple the extracellular matrix to the cytoskeleton, and is associated with tension-dependent restructuring of the actin lattice. Disruption of the actin lattice with cytocholasin D blocks the RNA and ribosome recruitment process, whereas microtubule modifying drugs have only small effects, thus illustrating the importance of the actin cytoskeleton in RNA localisation. It will be interesting to determine whether FLI has gelsolin-like actin filament severing and capping properties and whether an actin-FLI-TRIP interaction causes localisation of RNA to sites of cytoskeleton reorganisation, perhaps in response to mitogenic signals which induce TRIP expression. We thank Nicholas Edwards for technical assistance in this project, and colleagues in the retrovirus molecular biology group for useful discussions. This work was supported by grants from the Wellcome Trust and Medical Research Council. The nucleotide sequences reported in this paper have been submitted to the EMBL Databank. The accession numbers for human and hamster TRIP are AJ223075 and AJ223076, respectively.
Identification of the TRIP RNA binding domain
TRIP binds the LRR of FLI
TRIP is localised in the cytoplasm
DISCUSSION
ACKNOWLEDGEMENTS
REFERENCES
This article has been cited by other articles:
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 20 Jul 1998
Copyright©Oxford University Press, 1998.
CiteULike 
Connotea 
Del.icio.us What's this?
G. M. Hautbergue, M.-L. Hung, A. P. Golovanov, L.-Y. Lian, and S. A. Wilson
Mutually exclusive interactions drive handover of mRNA from export adaptors to TAP
PNAS,
April 1, 2008;
105(13):
5154 - 5159.
[Abstract]
[Full Text]
[PDF]
J. A. Stead, J. L. Costello, M. J. Livingstone, and P. Mitchell
The PMC2NT domain of the catalytic exosome subunit Rrp6p provides the interface for binding with its cofactor Rrp47p, a nucleic acid-binding protein
Nucleic Acids Res.,
August 23, 2007;
(2007)
gkm614v2.
[Abstract]
[Full Text]
[PDF]
Y.-H. Lee and M. R. Stallcup
Interplay of Fli-I and FLAP1 for regulation of {beta}-catenin dependent transcription
Nucleic Acids Res.,
October 6, 2006;
(2006)
gkl652v3.
[Abstract]
[Full Text]
[PDF]
L. R. SAUNDERS and G. N. BARBER
The dsRNA binding protein family: critical roles, diverse cellular functions
FASEB J,
June 1, 2003;
17(9):
961 - 983.
[Abstract]
[Full Text]
[PDF]
T. Sklyarova, V. De Corte, K. Meerschaert, L. Devriendt, B. Vanloo, J. Bailey, L. J. Cook, M. Goethals, J. Van Damme, M. Puype, et al.
Fragmin60 Encodes an Actin-binding Protein with a C2 Domain and Controls Actin Thr-203 Phosphorylation in Physarum Plasmodia and Sclerotia
J. Biol. Chem.,
October 11, 2002;
277(42):
39840 - 39849.
[Abstract]
[Full Text]
[PDF]
H. D. Campbell, S. Fountain, I. S. McLennan, L. A. Berven, M. F. Crouch, D. A. Davy, J. A. Hooper, K. Waterford, K.-S. Chen, J. R. Lupski, et al.
Fliih, a Gelsolin-Related Cytoskeletal Regulator Essential for Early Mammalian Embryonic Development
Mol. Cell. Biol.,
May 15, 2002;
22(10):
3518 - 3526.
[Abstract]
[Full Text]
[PDF]
D. Davy, H. Campbell, S Fountain, D de Jong, and M. Crouch
The flightless I protein colocalizes with actin- and microtubule-based structures in motile Swiss 3T3 fibroblasts: evidence for the involvement of PI 3-kinase and Ras-related small GTPases
J. Cell Sci.,
January 2, 2001;
114(3):
549 - 562.
[Abstract]
[PDF]
V. N. Uebele, A. Lagrutta, T. Wade, D. J. Figueroa, Y. Liu, E. McKenna, C. P. Austin, P. B. Bennett, and R. Swanson
Cloning and Functional Expression of Two Families of beta -Subunits of the Large Conductance Calcium-activated K+ Channel
J. Biol. Chem.,
July 21, 2000;
275(30):
23211 - 23218.
[Abstract]
[Full Text]
[PDF]
This Article 
Abstract
Print PDF (390K)
Alert me when this article is cited
Alert me if a correction is posted
Services
Email this article to a friend
Similar articles in this journal
Similar articles in ISI Web of Science
Similar articles in PubMed
Alert me to new issues of the journal
Add to My Personal Archive
Download to citation manager
Search for citing articles in:
ISI Web of Science (19)
Request Permissions
Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Articles by Wilson, S. A.
Articles by Kingsman, S. M.
Search for Related Content
PubMed
PubMed Citation
Articles by Wilson, S. A.
Articles by Kingsman, S. M.
Social Bookmarking
What's this?