Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow Print PDF (341K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (25)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Serva, S.
Right arrow Articles by Klimasauskas, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Serva, S.
Right arrow Articles by Klimasauskas, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nucleic Acids Research Pages 3473-3479  


Chemical display of thymine residues flipped out by DNA methyltransferases
Introduction
Materials And Methods
Results
   Reactivity of thymines in the M.HhaI-DNA complexes
   Effects of cofactor SAM and its analogs
   Reactivity of thymines in the M.TaqI-DNA complexes
Discussion
Acknowledgements
References


Chemical display of thymine residues flipped out by DNA methyltransferases

Chemical display of thymine residues flipped out by DNA methyltransferases

Saulius Serva, Elmar Weinhold1, Richard J. Roberts2, Saulius Klimasauskas*

Institute of Biotechnology, Laboratory of Biological DNA Modification, Graiciuno 8, LT-2028 Vilnius, Lithuania, 1Max-Planck-Institut für Molekulare Physiologie, Abteilung Physikalische Biochemie, Rheinlanddamm 201, D-44139 Dortmund, Germany and 2New England Biolabs, 32 Tozer Road, Beverly, MA 01915, USA

Received May 5, 1998; Revised and Accepted June 19, 1998

ABSTRACT

The DNA cytosine-C5 methyltransferase M.HhaI flips its target base out of the DNA helix during interaction with the substrate sequence GCGC. Binary and ternary complexes between M.HhaI and hemimethylated DNA duplexes were used to examine the suitability of four chemical methods to detect flipped-out bases in protein-DNA complexes. These methods probe the structural peculiarities of pyrimidine bases in DNA. We find that in cases when the target cytosine is replaced with thymine (GTGC), KMnO4 proved an efficient probe for positive display of flipped-out thymines. The generality of this procedure was further verified by examining a DNA adenine-N6 methyltransferase, M.TaqI, in which case an enhanced reactivity of thymine replacing the target adenine (TCGT) in the recognition sequence TCGA was also observed. Our results support the proposed base-flipping mechanism for adenine methyltransferases, and offer a convenient laboratory tool for detection of flipped-out thymines in protein-DNA complexes.

INTRODUCTION

Enzymatic methylation of cytosine residues in DNA which is catalyzed by DNA methyltransferases (MTases) is essential for the development and normal cellular function of a variety of organisms ranging from bacteria to mammals. Besides their important physiological role, the MTases are attractive models for the study of protein-DNA interactions. M.HhaI, a DNA cytosine-C5 methyltransferase from the bacterium Haemophilus haemolyticus, recognizes the sequence 5[prime]-GCGC-3[prime] and transfers a methyl group from the cofactor S-adenosyl-l-methionine (SAM) onto the inner cytosine residue (bold) on each strand of the duplex DNA (7,7). This enzyme has become a paradigm for structural studies after the discovery of an unusual reaction intermediate in which the target residue is flipped out of the DNA helix into a catalytic site in the enzyme (22). The structure of the M.HhaI-DNA reaction complex at atomic resolution provided a structural framework for site-directed mutagenesis (22), biochemical studies (7-7), scanning force microscopy (8), as well as further structural work employing X-ray diffraction (9,10) and NMR spectroscopy (11). Given the high conservation of key sequence motifs, studies of other members of the cytosine-C5 MTase family gave valuable insights into the catalytic mechanism of these enzymes (12-16).

The importance of these studies has been bolstered by recent findings of flipped-out bases in reaction complexes of numerous DNA repair enzymes (for reviews see 17,18). It has been postulated that base flipping occurred early in evolution and that it might be common for many DNA modifying enzymes, including adenine-N6 and cytosine-N4 MTases (19). This hypothesis is supported by the X-ray structures of M.TaqI and M.PvuII, which have been crystallized without their DNA substrates (20,21). Both enzymes consist of two domains which form a cleft wide enough to accommodate double-stranded DNA. Modelling B-DNA into the protein structures showed that the distance between the target base and the methyl group on the cofactor is much too large for direct methyl group transfer, and that a rotation of the base out of the DNA helix, in the manner observed for M.HhaI, would make the methyl group transfer possible (20,21). Structural comparison of M.TaqI and M.HhaI showed that the catalytic domains of both enzymes have a very similar fold, and, moreover, the conserved sequence motifs that contain catalytic residues overlay very well (22).

Most of the evidence on the base flipping mechanism came from X-ray diffraction studies of crystals. Since many more proteins are expected to employ this mechanistic feature in their interactions with DNA, a fast method for initial screening would be very useful. Gel mobility shift analysis of M.HhaI-DNA interactions revealed an increased affinity of the enzyme for mismatches at the target site (5,6) and provided a `thermodynamic-trap' method to identify enzymes that use binding energy to disrupt base pairs in duplex DNA (23). Recently, a fluorescence-based method has been described to study enzyme-DNA complexes that involve targeted unstacking of a nucleotide (24-26). Although this method appears especially suitable for kinetic analysis of the flipping motion (27,28), it requires non-standard equipment and may not always be sufficiently sensitive to serve as a routine laboratory tool.

The aim of the current work was to screen several chemical methods as probes of structural peculiarities in DNA and assess their suitability to detect flipped-out bases in protein-DNA complexes. We chose to examine those reactions that (i) proceed under mild conditions ensuring the integrity of protein-DNA complexes, and (ii) lead to a specific cleavage of the DNA strand and require no further enzymatic manipulations or subcloning. We have checked four chemistries that were reported to attack pyrimidine bases in DNA using binary and ternary complexes between M.HhaI and hemimethylated DNA substrates. Since M.HhaI is tolerant to replacements of the target base in the flipping reaction (5) we have also examined these reagents using DNA substrates containing thymine at the target base position. We find that KMnO4 proved an efficient probe for the positive display of flipped-out thymines, but not cytosines, in M.HhaI-DNA complexes. The generality of this procedure was further verified by examining an adenine-specific MTase, M.TaqI. In accord with the proposed base flipping mechanism (20,26), an enhanced reactivity of thymine replacing the target adenine in the recognition sequence TCGA was also observed.

MATERIALS AND METHODS

M.HhaI was isolated following the procedure of Kumar et al. (29); exhaustive dialysis prior to chromatography yielded SAM-free enzyme. M.TaqI was isolated as described previously (26). Protein concentration was estimated using a Coomassie G-250 (BioRad) assay with bovine serum albumin (Pierce) as the standard. S-Adenosyl-l-methionine p-toluenesulfonate salt and S-adenosyl-l-homocysteine (SAH) were purchased from Sigma. Sinefungin (adenosyl-ornithine) was a gift from Lilly Research Laboratories.

The following oligodeoxyribonucleotides were synthesized at New England BioLabs and MPI für Molekulare Physiologie (shown 5[prime]->3[prime], Cm = 5-methylcytosine, Am = N6-methyladenine; recognition sequences for M.HhaI and M.TaqI are enlarged with the target bases shown in bold, mismatched thymines are underlined):

GACTGGTACAGTATCAGGCGCTGACCCACAACATCCG

GACTGGTACAGTATCAGGTGCTGACCCACAACATCCG

GACTGGTACAGTATCAGGCGTTGACCCACAACATCCG

GACTGGTACAGTATCAGGCGCTGACCCATAACATCCG

TCGGATGTTGTGGGTCAGCmGCCTGATACTGTACCAGT

GCTGTTGAGATCCAGTTCGAAGTAACCCACTCGTGC

GCTGTTGAGATCCAGTTCGTAGTAACCCACTCGTGC

GCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGC

GCTGTTGAGATCCAGTTCGAATTAACCCACTCGTGC

GCACGAGTGGGTTACTTCGAmACTGGATCTCAACAGC

Oligonucleotides were 5[prime]-labeled using an Oligonucleotide 5[prime] labeling kit (MBI Fermentas) and [[gamma]-32P]ATP (Amersham) and were purified by gel electrophoresis under denaturing conditions. DNA duplexes were prepared essentially as earlier described (5) by annealing appropriate oligonucleotides.

Binding reactions contained 1 nM labeled 37mer duplex, 3 nM M.HhaI, 10 µg/ml poly(dA-dT), 0.1 mM cofactor, if any, and 5% glycerol in 20 µl of binding buffer (20 mM Tris-HCl pH 8.0, 2 mM Na2EDTA, 0.2 mg/ml bovine serum albumin). M.TaqI binding was performed as described for M.HhaI except that 5 nM labeled 36mer duplex and 50 nM enzyme were used. In controls, enzyme was omitted or inactivated by heating for 25 min at 100°C (for M.HhaI). Typically, reactions were incubated for 30 min at 25°C, and 5 µl samples were then loaded onto an 8% polyacrylamide gel (37.5:1 crosslink ratio). Electrophoresis was performed in 45 mM Tris-borate (pH 8.3), 1 mM Na2EDTA for 1-3 h at 10 V/cm.

Oxidative modification with KMnO4 was performed with 5 nM-labeled 37mer duplex, 20 nM M.HhaI, 10 µg/ml poly(dA-dT), or 5 nM labeled 36mer duplex, 50 nM M.TaqI, 10 µg/mlpoly(dG-dC), both in 100 µl of binding buffer. Reactions were initiated by adding KMnO4 to a final concentration of 8 mM and incubating for 1 min at room temperature (30). The reactions were then quenched by adding 100 µl of STOP solution (1.5 M Na-acetate pH 7.0, 1 M [beta]-mercaptoethanol and 1 mg/ml tRNA), followed by ethanol precipitation. Guanine-specific tracks were generated by treating labeled duplexes with 16% dimethylsulfate for 2 min (31). For modification-specific strand cleavage, 100 µl of freshly diluted 1 M piperidine was added to the pellet and the samples were heated at 90°C for 30 min. Following ethanol precipitation, the DNA samples were combined with 10 µl of sequencing gel loading mix (Fermentas) and applied to a 15% sequencing gel. Gels were resolved at 60 W constant power for 1.5 h.

Other pyrimidine-specific reactions were performed following the described procedures: in situ generated Br2 (32), hydrogen peroxide (33) or osmium tetroxide (34).


Table 1. Sequences of duplex oligonucleotides and their abbreviationsa
aThe recognition sequences for M.HhaI and M.TaqI are shaded with the target bases shown in bold; positions of mismatched thymines are underlined.Cm = 5-methylcytosine and Am = N6-methyladenine.

RESULTS

Initially, a 37mer duplex DNA containing a hemimethylated target sequence for M.HhaI, GCGC, and 5[prime]-labelled on the upper strand (Table 1) was used for screening. Premethylation of the cytosine on the bottom strand served to ensure docking of the enzyme in a single orientation targeting the upper strand (10). Four methods previously developed for analysis of pyrimidine bases in polynucleotides and their complexes with proteins were examined: in situ generated Br2 (32), hydrogen peroxide (33), osmium tetroxide (34) and potassium permanganate (30). None of the reagents displayed sufficient selectivity toward the target cytosine when applied to the binary M.HhaI-DNA complex. The reactivity of the cytosine remained at background levels also in the presence of the cofactor analogs SAH, sinefungin or the cofactor SAM (not shown; for illustration see Fig. 1, lanes 7-9). The concentration of cofactor or the analogs in the reaction (100 µM) were well above the known values of the binding and steady state constants: KD [ap]10 µM for SAM (S.K. and R.J.R., unpublished data), KM = 15 nM for SAM and Ki = 2 nM for SAH (35). The above combinations of enzyme and cofactor analogs ensure a wide spectrum of binding efficiencies to the substrate DNA with presumably distinct degrees of base flipping (5,11).


Figure 1. Permanganate reactivity of nucleotides in the mismatched duplexes GTGC, GCGT and GCGCN7T (5 nM) upon interaction with M.HhaI (20 nM) and SAH or SAM (0.1 mM). (A) Autoradiograph of degradation products of the 37mer duplexes 5[prime]-labeled on the target (upper) strand after separation by electrophoresis on a 15% sequencing gel. Lane 1, G-marker; lane 2, GTGC; lane 3, GTGC + M.HhaI; lane 4, GCGT; lane 5, GCGT + M.HhaI; lane 6, GCGT + M.HhaI + SAH; lane 7, GCGCN7T; lane 8, GCGCN7T + M.HhaI; lane 9, GCGCN7T + M.HhaI + SAH. (B) Autoradiograph of degradation products of the GTGC duplex 5[prime]-labeled on the methylated (lower) strand. Lane 1, G-marker; lane 2, control with no enzyme; lane 3, M.HhaI; lane 4, M.HhaI + SAM; lane 5, M.HhaI + SAH.

Reactivity of thymines in the M.HhaI-DNA complexes

Since thymines are generally more reactive than cytosines toward oxidation with potassium permanganate or osmium tetroxide, we decided to test whether a 37mer duplex in which the target cytosine is replaced with thymine (GTGC) would be a better substrate in our study. The single base C to T replacement preserved the remaining seven bases of the double-stranded recognition site, but created a G-T mispair at the target site. In the absence of cofactor, this mismatched substrate is bound by the enzyme with an ~15-fold higher affinity than the canonical hemimethylated duplex (5; and Fig. 2B); however, the binding affinities of both become comparable in the presence of SAH. A duplex in which the whole target G:C pair is exchanged for an A:T pair proved unsuitable for the reactivity study since it was incompetent in the binding reaction (5).


Figure 2. Permanganate reactivity and binding of the 37mer duplexes upon interaction with M.HhaI and cofactors. (A) Autoradiograph of permanganate degradation products of GTGC 5[prime]-labeled on the target (upper) strand. Reaction conditions as in Figure 1. Lane 1, control with no M.HhaI; lane 2, M.HhaI; lane 3, M.HhaI + SAM; lane 4, M.HhaI + SAH; lane 5, M.HhaI + sinefungin (Sin). Density profiles for individual lanes are shown on the right: lane 1 (red), lane 2 (green), lane 3 (magenta). (B) Gel mobility shift analysis of the M.HhaI (3 nM) interaction with GCGC and GTGC duplexes (1 nM) in the presence of cofactor analogs (0.1 mM). Lane 1, GCGC + M.HhaI; lane 2, GCGC + M.HhaI + SAH; lane 3, GTGC + M.HhaI; lane 4, GTGC + M.HhaI + SAM; lane 5, GTGC + M.HhaI + SAH; lane 6, GTGC + M.HhaI + sinefungin (Sin).

Examination of the mismatched GTGC duplex with the aforementioned chemical reagents unveiled an enhancedsusceptibility of the thymine residue only in the case of oxidative modification by KMnO4 (Figs 1A and 2A). Addition of M.HhaI leads to a selective and significant enhancement of the reactivity of the target base, whereas control reactions containing no enzyme, or enzyme inactivated by heating at 100°C (not shown), show the background level of reactivity at the mismatched thymine base (Fig. 1A, lanes 2 and 3). The presence of enzyme had no effect on the permanganate reactivity of any paired thymine on either strand (Fig. 1B).

To verify whether the observed effect is specific for the mispaired thymine at the target site, or just for any G-T mispair, we introduced identical lesions in two other positions of the duplex (Table 1). Both control duplexes were verified to form specific complexes with M.HhaI in the presence of SAH (not shown). As can be seen in Figure 1A, no discernible increase in reactivity was observed at the mismatched thymine located outside the recognition site (duplex GCGCN7T), or if a thymine residue replaced the non-target cytosine on the upper strand of the recognition site (GCGT). Our data are thus consistent with the base flipping model according to which the target base is flipped out of the DNA helix and, therefore, shows enhanced reactivity with permanganate, whereas the other bases remain largely unperturbed (3).

Effects of cofactor SAM and its analogs

We chose SAH over SAM or sinefungin for comparing the permanganate reactivity in ternary complexes described above, because (i) SAM is unsuitable in the case of GCGT and GCGCN7T duplexes due to enzymatic turnover, and (ii) SAH is a natural reaction product and a potent inhibitor of cytosine-C5 MTases (35). The influence of these three compounds on the reactivity of the target thymine in the M.HhaI-GTGC complex is shown in Figure 2A. Consistent with our earlier results with SAH (5), we found that addition of the cofactors leads to minor variations of the signal from the target base. The variations of the signal strength, sinefungin > SAM > SAH > none, were qualitatively reproducible in multiple experiments. To understand the nature of these effects better we compared binding of M.HhaI to the mismatched DNA substrate in the presence of the cofactor analogs using a gel mobility shift assay (Fig. 2B). Again, only slight differences were observed in this case, indicating that none of the compounds exerted a substantial effect on the association of M.HhaI with the GTGC duplex under the conditions of the chemical experiment. The binding trend, SAH > SAM > sinefungin, is, however, inverted as compared with the permanganate reactivity. The importance and molecular basis of this phenomenon is unclear. It should be noted that the enzyme-DNA complexes involving GTGC, regardless of the added cofactor (Fig. 2B, lanes 3-6), migrate more slowly than the ternary M.HhaI-GCGC-SAH complex (lane 2). As discussed previously (5,11), the variable compactness of the molecules appears to correlate with a conformational rearrangement of the 20 residue catalytic site loop in the enzyme that is required for catalysis (3).

Reactivity of thymines in the M.TaqI-DNA complexes

The generality of the KMnO4 modification assay was further tested by examining an adenine-specific MTase, M.TaqI. This enzyme transfers a methyl group from SAM onto the N6 position of adenine in the DNA sequence TCGA (36). First, we examined a duplex oligonucleotide containing the hemimethylated recognition sequence for M.TaqI (Table 1) in the presence of saturating concentrations of the MTase. However, no change was observed in the susceptibility to permanganate upon addition of M.TaqI on this or any other thymines on either strand (not shown). We then replaced the target adenine with thymine creating a T-T mismatch (TCGT; Table 1). As with M.HhaI, no exchange of the complete target base pair was feasible due to the impaired binding of such a substrate by M.TaqI (unpublished). We also examined two control duplexes in which either the 3[prime] neighboring, or the next succeeding nucleotide were mismatched thymines (TCGAT and TCGAAT, respectively). The 3[prime] terminal location of the target base within the recognition sequence of M.TaqI thus permitted the assessment of the reactivity of bases in the immediate vicinity to the target base without making exchanges of the specific recognition bases. Gel binding experiments confirmed that, under the conditions of the chemical reaction, all three mismatched substrates were bound with a similar affinity as the canonical hemimethylated substrate (not shown). Remarkably, permanganate reaction with the TCGT substrate indicated that addition of the enzyme leads to a clear enhancement of the reactivity of the mismatched thymine on the upper strand, and the signal is further increased in the presence of sinefungin (Fig. 3A, lanes 2-4). The TCGAT duplex in which the 3[prime] neighbor of the target base is a mismatched thymine also showed a discernible, albeit weaker, permanganate reactivity upon binding of both MTase and sinefungin (Fig. 3A, lanes 5-7). The weakest MTase-induced reactivity was observed with the third duplex, TCGAAT. In this case the signal is nearly equally distributed between the two successive thymines, the first of which is mispaired with cytosine, whereas the next one is paired with adenine. The mismatched thymines on the complementary strand appeared even less reactive (Fig. 3B). Overall, our data indicate that M.TaqI induces a broader distortion of the DNA duplex involving the target base and two 3[prime] neighboring nucleotides on the target strand. The strongest signal is seen at the target position and then diminishes with each successive nucleotide in the 3[prime] direction.


Figure 3. Permanganate reactivity of nucleotides in the mismatched duplexes TCGT, TCGAT and TCGAAT (5 nM) upon interaction with M.TaqI (50 nM) and sinefungin (0.1 mM). (A) Autoradiograph of degradation products of the duplexes 5[prime]-labeled on the target (upper) strand. Lane 1, G-marker; lane 2, TCGT; lane 3, TCGT + M.TaqI; lane 4, TCGT + M.TaqI + sinefungin; lane 5, TCGAT; lane 6, TCGAT + M.TaqI; lane 7, TCGAT + M.TaqI + sinefungin; lane 8, TCGAAT; lane 9, TCGAAT + M.TaqI; lane 10, TCGAAT + M.TaqI + sinefungin. (B) Autoradiograph of degradation products of the duplexes 5[prime]-labeled on the methylated (lower) strand. Lane 1, G-marker; lane 2, TCGT; lane 3, TCGT + M.TaqI; lane 4, TCGT + M.TaqI + sinefungin; lane 5, TCGAT; lane 6, TCGAT + M.TaqI; lane 7, TCGAT + M.TaqI + sinefungin; lane 8, TCGAAT; lane 9, TCGAAT + M.TaqI; lane 10, TCGAAT + M.TaqI + sinefungin.

Comparison of the permanganate reactivity involving the ternary M.TaqI complexes was performed in the presence of sinefungin. Unlike cytosine-C5 MTases, M.TaqI exhibits an 8-fold higher affinity for sinefungin than SAH (37), and this trend is characteristic of other adenine-specific MTases as well (38). As demonstrated in Figure 3, inclusion of sinefungin in the reactions leads to a stronger reactivity of mismatched thymines. The nature of the cofactor, however, appeared insignificant for the accessibility of the target thymine in the M.TaqI-TCGT complexes under the reaction conditions used (Fig. 4).


Figure 4. Cofactor effects on the permanganate reactivity of nucleotides on the target strand of TCGT duplex upon interaction with M.TaqI. Reaction conditions as in Figure 3. Lane 1, G-marker; lane 2, TCGT; lane 3, TCGT + M.TaqI; lane 4, TCGT + M.TaqI + SAM; lane 5, TCGT + M.TaqI + SAH; lane 6, TCGT + M.TaqI + sinefungin (Sin). Density profiles of individual lanes are shown on the right: lane 1 (red), lane 2 (green), lane 3 (magenta).

DISCUSSION

The KMnO4 oxidation leads to conversion of thymine to cis-thymine glycol (5,6-dihydroxy-5,6-dihydrothymine); the oxidized base undergoes further degradation leading to cleavage of the DNA strand upon piperidine treatment. Therefore, permanganate hyper-reactivity depends upon a higher solvent accessibility of the reactive thymine as compared with other thymines in DNA (30). Since the attack on the [pi] orbitals of the C6=C5 bond takes place from a face of the pyrimidine ring, double-stranded DNA is relatively resistant to permanganate oxidation (39). In this study, because of the structural constraints imposed by the recognition sequences of the enzymes and the chemistry of base modification, we used substrates containing mismatched thymine residues. In the G-T and T-T base-pairs, the thymines themselves are potential hot spots (40,41) due to the fact that they show significant deviations from the canonical Watson-Crick geometry (42), and are destabilized both kinetically and thermodynamically (43,44). A relatively low background signal at these mismatched thymines attained in our experiments can to some extent be attributed to the fact that, in four of the cases, the mismatched thymines were flanked with purine bases on both sides and, in the other two cases, flanked with purines on the 5[prime] side (Table 1). Control experiments with free duplexes containing the G-T mismatch preceded by cytosine gave a much stronger background signal which interfered with further analysis of the base flipping event in the case of the cytosine-N4 methyltransferase M.MvaI which recognizes the 5[prime]-CC(A/T)GG-3[prime] sites in DNA (data not shown).

Another potential danger of using mismatched substrates is that the DNA duplexes may exhibit some additional conformational flexibility at or in the vicinity of the lesion. This would mean that not only the background signal in the free state is affected but also that binding of protein may induce conformational changes that are somewhat different (exaggerated) as compared with those in the ordinarily base-paired DNA duplex. In fact, the M.HhaI-GTGC complex itself presents such an example, because opening of a mismatch is much more easily achieved than the disruption of the native G:C base pair (5,6,27). Control experiments with duplexes containing A:T base pairs at the target site were not possible due to the lack of specific interaction of such duplexes with the MTases. In the current study, the specific effects of the MTases on the susceptibility of mismatched thymines to permanganate can be divided into three categories: large enhancement, at the target position; moderate increase, at the 3[prime] adjacent position (for M.TaqI); and minor variations, at numerous non-target locations on both strands. Although fully consistent with the model of targeted unstacking of the thymines by the MTases, our data indicate that sub-optimal reaction conditions may lead to anomalous reactivity of certain mismatched thymines in the presence of enzyme (not shown). The risk of over-interpreting experimental data should be taken into account when mismatched DNA substrates are employed, but, clearly, this limitation will not apply to systems involving canonical duplexes.

The structural model for the ternary M.HhaI-DNA-cofactor complexes implies that both the target cytosine and itscomplementary orphan guanine are hidden in the interior of the molecule (3,9). The target cytosine is locked in the catalytic pocket of the enzyme and its accessibility is obstructed by the bound cofactor and the closed conformation of the active site loop. Therefore, one could hardly expect that despite its extrahelical location the target base would show enhanced reactivity with permanganate. Indeed, chemical footprinting studies of the cytosine-C5 methyltransferases M.HhaI, M.SssI and M.BspRI in the presence of SAH revealed no hyper-reactivity of purine bases or sugar backbone residues in the vicinity of the target cytosine (7,14). This discrepancy suggests that in fact the environment of the flipped-out thymine may be markedly different from that of the target cytosine in the ternary complexes. There are several independent lines of evidence that support this notion. Our gel mobility experiment shows that the ternary M.HhaI-GCGC-SAH complex is more compact as compared with the binary M.HhaI-GCGC complex or the M.HhaI-GTGC complexes, regardless of the added cofactor (Fig. 2B). This correlates with the substantially higher kinetic stability of the former complex as compared with the other two in competition binding experiments (6). Consistent with this are recent 19F-NMR experiments in which interactions between M.HhaI and a fluorinated DNA duplex have been studied (11). In the binary complex, the target base is in dynamic equilibrium between the stacked state and an ensemble of flipped-out states with little trapping of the target cytosine in the catalytic pocket. In these complexes, the active site loop must adopt an open conformation, or at least be open transiently. Addition of SAH leads to locking of the cytosine in a unique stable conformation with concurrent closure of the active site loop. Similarly with the GTGC duplex, replacement of the target cytosine with 2-amino-purine also gives `open' complexes with an extrahelical target residue upon interaction with M.HhaI (26). In aggregate, these results suggest that bulkier residues replacing the target cytosine may favor flipping by virtue of a lower base pair stability, but will hinder binding of the flipped-out base in the catalytic pocket due to steric constraints. The described `open' model of the M.HhaI-GTGC-SAH complex permits a more plausible explanation of the enhanced susceptibility of the target thymine to oxidation by permanganate. In contrast, uracil is not excluded from the catalytic center since in this case formation of the `closed' ternary complexes can be clearly observed (5). Uracil can even be methylated at the C5 position by the enzyme, although at a significantly lower rate than the canonical substrate (5,6).

The results of our comparative study of M.HhaI and M.TaqI provide evidence in support of a target base flipping mechanism by the adenine-N6 MTases. Although many structural details of the flipped out complex still remain obscure, the enhanced chemical accessibility of the thymine residue replacing the respective target bases in both types of MTases suggest a common general mechanism of action for cytosine-C5 and adenine-N6 enzymes. It has been shown recently that duplex oligonucleotides containing the fluorescent base analogue 2-aminopurine can be used to sense DNA base flipping. Consistent with the base flipping mechanism, a dramatic increase in fluorescence intensity was observed upon binding of the M.HhaI, M.TaqI or M.EcoRI MTases (24,26) to DNA duplexes in which the target base in the respective recognition sequence was replaced with 2-aminopurine. Moreover, recent binding studies of M.EcoRV (23), M.EcoRI (28) and M.TaqI (B.Holz, unpublished) showed a preferential binding of substrates containing mismatches or no base at the target base position, which had earlier been reported for M.HhaI and M.HpaII (5,6). It should be noted that the base flipping model for M.TaqI envisions that the lower strand thymine that is complementary to the target adenine would become unpaired if the adenine flips out of the DNA helix, and the environment of this orphan thymine was likely to change dramatically upon binding of the enzyme. The lack of signal indicates that apparently the orphan base is bound in the interior of the complex and is not exposed to solvent.

Beside these similarities, a clear mechanistic difference exists between the two classes of MTases. DNA bending studies of the adenine-specific MTases M.EcoRI and M.EcoRV, demonstrated that these enzymes bend their substrates by an angle of ~60° (8,45). In contrast, no bending appears necessary in the case of M.HhaI or M.HaeIII as observed either by crystal diffraction studies or in solution (3,8,13). Although the experiments to look at bases adjacent to the target base were not possible with M.HhaI, the current study suggests that distortions of the DNA helix by M.TaqI may be of a broader nature than those induced by M.HhaI. DNA bending may be one explanation for the broader reactivity pattern observed with M.TaqI. On the other hand, flipping of the target base alone may be sufficient to account for the higher accessibility of the 3[prime] neighboring thymine on the upper strand, especially if that thymine is mismatched. Notably, hydroxyl radical footprinting of a type I adenine-N6 MTase, M.EcoR124I, revealed a hyper-reactive site on each strand of the DNA which included the target nucleotide and both adjacent residues (46).

In conclusion, we have demonstrated the suitability of potassium permanganate for detection of flipped-out thymine residues in protein-DNA complexes. Our experiments were successful with both DNA methyltransferases analyzed: the cytosine-C5 MTase M.HhaI, for which base flipping is firmly established, and the adenine-N6 MTase M.TaqI, for which there are several lines of indirect evidence in support of a base-flipping mechanism. This finding appears to be in line with the previously described applications of the permanganate chemistry for the study of structural anomalies in the double helical DNA in both free state (39,47) and in complexes with proteins. The latter analysis can be performed both in vitro and in vivo and is usually aimed at identification of single-stranded or so-called open regions within protein-DNA complexes (48-50), or, if used in the footprinting mode, for analysis of regions protected by bound proteins (51,52). An example of highly targeted DNA deformation which resembles the action of MTases has recently been revealed by permanganate probing of the Vaccinia DNA topoisomerase (53). A single thymine base immediately 5[prime] of the scissile bond becomes hyper-reactive upon formation of the covalent DNA-topoisomerase intermediate. This finding invites further structural investigation using high resolution methods, and reinforces a high potential of this approach as a routine laboratory method for fast initial screening of enzymes suspected to employ base flipping in their interactions with DNA.

ACKNOWLEDGEMENTS

We would like to thank Laima Lazareviciute and Nathalie Bleimling for their help in purification of M.HhaI and M.TaqI, respectively. We also thank Roger Goody and MBI Fermentas for their continuing support. This work was supported in part by a Howard Hughes Medical Institute International Research Scholarship grant (S.K.), the Volkswagen-Stiftung (E.W. and S.K.), the Deutsche Forschungsgemeinschaft DFG (E.W.) and the NIH (GM 46127, R.J.R.).

REFERENCES

1. Roberts,R.J., Myers,P.A., Morrison,A. and Murray,K. (1976) J. Mol. Biol., 103, 199-208. MEDLINE Abstract

2. Mann,M.B. and Smith,H.O. (1979) In Usdin,E., Borchardt,R.T. and Creveling,C.R. (eds), Proceedings of the Conference on Transmethylation. Elsevier, NY, pp. 483-492.

3. Klimasauskas,S., Kumar,S., Roberts,R.J. and Cheng,X. (1994) Cell, 76, 357-369. MEDLINE Abstract

4. Mi,S., Alonso,D. and Roberts,R.J. (1995) Nucleic Acids Res., 23, 620-627. MEDLINE Abstract

5. Klimasauskas,S. and Roberts,R.J. (1995) Nucleic Acids Res., 23, 1388-1395. MEDLINE Abstract

6. Yang,A.S., Shen,J.-C., Zingg,J.-M., Mi,S. and Jones,P.A. (1995)Nucleic Acids Res., 23, 1380-1387. MEDLINE Abstract

7. Renbaum,P. and Razin,A. (1995) J. Mol. Biol., 248, 19-26. MEDLINE Abstract

8. Garcia,R.A., Bustamante,C.J. and Reich,N.O. (1996) Proc. Natl Acad. Sci. USA, 93, 7618-7622. MEDLINE Abstract

9. O'Gara,M., Klimasauskas,S., Roberts,R.J. and Cheng,X. (1996) J. Mol. Biol., 261, 634-645. MEDLINE Abstract

10. O'Gara,M., Roberts,R.J. and Cheng,X. (1996) J. Mol. Biol., 263, 597-606. MEDLINE Abstract

11. Klimasauskas,S., Szyperski,T., Serva,S. and Wüthrich,K. (1998) EMBO J., 17, 317-324. MEDLINE Abstract

12. Kumar,S., Cheng,X., Klimasauskas,S., Mi,S., Pósfai,J., Roberts,R.J. and Wilson,G.G. (1994) Nucleic Acids Res., 22, 1-10. MEDLINE Abstract

13. Reinisch,K.M., Chen,L., Verdine,G.L. and Lipscomb,W.N. (1995) Cell, 82, 143-153. MEDLINE Abstract

14. Finta,C. and Kiss,A. (1997) Nucleic Acids Res., 25, 2841-2846. MEDLINE Abstract

15. Kossykh,V.G., Schlagman,S.L. and Hattman,S. (1995) FEBS Lett., 370, 75-77. MEDLINE Abstract

16. Gabbara,S., Sheluho,D. and Bhagwat,A.S. (1995) Biochemistry, 34, 8914-8923. MEDLINE Abstract

17. Vassylyev,D.G. and Morikawa,K. (1997) Curr. Opin. Struct. Biol., 7, 103-109. MEDLINE Abstract

18. Cheng,X. and Roberts,R.J. (1998) Annu. Rev. Biochem., 67, in press.

19. Roberts,R.J. (1995) Cell, 82, 9-12. MEDLINE Abstract

20. Labahn,J., Granzin,J., Schluckebier,G., Robinson,D.P., Jack,W.E., Schildkraut,I. and Saenger,W. (1994) Proc. Natl Acad. Sci. USA, 91, 10957-10961. MEDLINE Abstract

21. Gong,W., O'Gara,M., Blumenthal,R.M. and Cheng,X. (1997)Nucleic Acids Res., 25, 2702-2715. MEDLINE Abstract

22. Schluckebier,G., O'Gara,M., Saenger,W. and Cheng,X. (1995) J. Mol. Biol., 247, 16-20. MEDLINE Abstract

23. Cal,S. and Connolly,B.A. (1997) J. Biol. Chem., 272, 490-496. MEDLINE Abstract

24. Allan,B.W. and Reich,N.O. (1996) Biochemistry, 35, 14757-14762. MEDLINE Abstract

25. McCullough,A.K., Dodson,M.L., Schärer,O.D. and Lloyd,R.S. (1997)J. Biol. Chem., 272, 27210-27217. MEDLINE Abstract

26. Holz,B., Klimasauskas,S., Serva,S. and Weinhold,E. (1998)Nucleic Acids Res., 26, 1076-1083. MEDLINE Abstract

27. Serva,S., Weinhold,E. and Klimasauskas,S. (1997) Biologija, 9-12.

28. Allan,B.W., Beechem,J.M., Lindstrom,W.M. and Reich,N.O. (1998)J. Biol. Chem., 273, 2368-2373. MEDLINE Abstract

29. Kumar,S., Cheng,X., Pflugrath,J.W. and Roberts,R.J. (1992) Biochemistry, 31, 8648-8653. MEDLINE Abstract

30. Rubin,C.M. and Schmid,C.W. (1980) Nucleic Acids Res., 8, 4613-4619. MEDLINE Abstract

31. Maxam,A.M. and Gilbert,W. (1980) Methods Enzymol., 65, 499-560. MEDLINE Abstract

32. Ross,S.A. and Burrows,C.J. (1996) Nucleic Acids Res., 24, 5062-5063. MEDLINE Abstract

33. Richterich,P., Lakey,N.D., Lee,H.-M., Mao,J., Smith,D. and Church,G.M. (1995) Nucleic Acids Res., 23, 4922-4923. MEDLINE Abstract

34. Cotton,R.G.H., Rodrigues,N.R. and Campbell,R.D. (1988)Proc. Natl Acad. Sci. USA, 85, 4397-4401.

35. Wu,J.C. and Santi,D.V. (1987) J. Biol. Chem., 262, 4778-4786. MEDLINE Abstract

36. McClelland,M. (1981) Nucleic Acids Res., 9, 6795-6804. MEDLINE Abstract

37. Schluckebier,G., Kozak,M., Bleimling,N., Weinhold,E. and Saenger,W. (1997) J. Mol. Biol., 265, 56-67. MEDLINE Abstract

38. Bergerat,A. and Guschlbauer,W. (1990) Nucleic Acids Res., 18, 4369-4375. MEDLINE Abstract

39. Nielsen,P.E. (1990) J. Mol. Recog., 3, 1-25.

40. Gogos,J.A., Karayiorgou,M., Aburatani,H. and Kafatos,F.C. (1990) Nucleic Acids Res., 18, 6807-6814. MEDLINE Abstract

41. Roberts,E., Deeble,V.J., Woods,C.G. and Taylor,G.R. (1997)Nucleic Acids Res., 25, 3377-3378. MEDLINE Abstract

42. Hunter,W.N., Brown,T., Kneale,G., Anand,N.N., Rabinovich,D. and Kennard,O. (1987) J. Biol. Chem., 262, 9962-9970. MEDLINE Abstract

43. Moe,J.G. and Russu,I.M. (1992) Biochemistry, 31, 8421-8428. MEDLINE Abstract

44. Boulard,Y., Cognet,J.A.H. and Fazakerley,G.V. (1997) J. Mol. Biol., 268, 331-347. MEDLINE Abstract

45. Cal,S. and Connolly,B.A. (1996) J. Biol. Chem., 271, 1008-1015. MEDLINE Abstract

46. Mernagh,D.R. and Kneale,G.G. (1996) Nucleic Acids Res., 24, 4853-4858. MEDLINE Abstract

47. Mitas,M., Yu,A., Dill,J., Kamp,T.J., Chambers,E.J. and Haworth,I.S. (1995) Nucleic Acids Res., 23, 1050-1059. MEDLINE Abstract

48. Wang,W., Carey,M. and Gralla,J.D. (1992) Science, 255, 450-453. MEDLINE Abstract

49. Visse,R., King,A., Moolenaar,G.F., Goosen,N. and van de Putte,P. (1994) Biochemistry, 33, 9881-9888. MEDLINE Abstract

50. Konieczny,I., Doran,K.S., Helinski,D.R. and Blasina,A. (1997)J. Biol. Chem., 272, 20173-20178. MEDLINE Abstract

51. Sasse-Dwight,S. and Gralla,J.D. (1991) Methods Enzymol., 208, 146-168. MEDLINE Abstract

52. Giardina,C. and Lis,J.T. (1995) Mol. Cell. Biol., 15, 2737-2744. MEDLINE Abstract

53. Sekiguchi,J. and Shuman,S. (1996) J. Biol. Chem., 271, 19436-19442. MEDLINE Abstract


*To whom correspondence should be addressed. Tel: +370 2 641887; Fax: +370 2 643436; Email: klimasau@ibt.lt


This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 20 Jul 1998
Copyright©Oxford University Press, 1998.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
D. Daujotyte, Z. Liutkeviciute, G. Tamulaitis, and S. Klimasauskas
Chemical mapping of cytosines enzymatically flipped out of the DNA helix
Nucleic Acids Res., June 1, 2008; 36(10): e57 - e57.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. Bischerour and R. Chalmers
Base-flipping dynamics in a DNA hairpin processing reaction
Nucleic Acids Res., April 4, 2007; (2007) gkm186v1.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
G. Krings and D. Bastia
Molecular Architecture of a Eukaryotic DNA Replication Terminus-Terminator Protein Complex
Mol. Cell. Biol., November 1, 2006; 26(21): 8061 - 8074.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Chandrashekaran, U. H. Manjunatha, and V. Nagaraja
KpnI restriction endonuclease and methyltransferase exhibit contrasting mode of sequence recognition
Nucleic Acids Res., June 10, 2004; 32(10): 3148 - 3155.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. M. Bujnicki, M. Feder, C. L. Ayres, and K. L. Redman
Sequence-structure-function studies of tRNA:m5C methyltransferase Trm4p and its relationship to DNA:m5C and RNA:m5U methyltransferases
Nucleic Acids Res., April 30, 2004; 32(8): 2453 - 2463.
[Abstract] [Full Text] [PDF]


Home page
Protein Eng Des SelHome page
D. Daujotyte, G. Vilkaitis, L. Manelyte, J. Skalicky, T. Szyperski, and S. Klimasauskas
Solubility engineering of the HhaI methyltransferase
Protein Eng. Des. Sel., April 1, 2003; 16(4): 295 - 301.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
X. Cheng and R. J. Roberts
AdoMet-dependent methylation, DNA methyltransferases and base flipping
Nucleic Acids Res., September 15, 2001; 29(18): 3784 - 3795.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
E. G. Malygin, A. A. Evdokimov, V. V. Zinoviev, L. G. Ovechkina, W. M. Lindstrom, N. O. Reich, S. L. Schlagman, and S. Hattman
A dual role for substrate S-adenosyl-L-methionine in the methylation reaction with bacteriophage T4 Dam DNA-[N6-adenine]-methyltransferase
Nucleic Acids Res., June 1, 2001; 29(11): 2361 - 2369.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. S. Szegedi, N. O. Reich, and R. I. Gumport
Substrate binding in vitro and kinetics of RsrI [N6-adenine] DNA methyltransferase
Nucleic Acids Res., October 15, 2000; 28(20): 3962 - 3971.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Jeltsch, F. Christ, M. Fatemi, and M. Roth
On the Substrate Specificity of DNA Methyltransferases. ADENINE-N6 DNA METHYLTRANSFERASES ALSO MODIFY CYTOSINE RESIDUES AT POSITION N4
J. Biol. Chem., July 9, 1999; 274(28): 19538 - 19544.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Holz, N. Dank, J. E. Eickhoff, G. Lipps, G. Krauss, and E. Weinhold
Identification of the Binding Site for the Extrahelical Target Base in N6-Adenine DNA Methyltransferases by Photo-cross-linking with Duplex Oligodeoxyribonucleotides Containing 5-Iodouracil at the Target Position
J. Biol. Chem., May 21, 1999; 274(21): 15066 - 15072.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Vilkaitis, A. Dong, E. Weinhold, X. Cheng, and S. Klimasauskas
Functional Roles of the Conserved Threonine 250 in the Target Recognition Domain of HhaI DNA Methyltransferase
J. Biol. Chem., December 1, 2000; 275(49): 38722 - 38730.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Vilkaitis, E. Merkiene, S. Serva, E. Weinhold, and S. Klimasauskas
The Mechanism of DNA Cytosine-5 Methylation. KINETIC AND MUTATIONAL DISSECTION OF HhaI METHYLTRANSFERASE
J. Biol. Chem., June 8, 2001; 276(24): 20924 - 20934.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Print PDF (341K) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (25)
Right arrowRequest Permissions
Right arrow Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Right arrow Articles by Serva, S.
Right arrow Articles by Klimasauskas, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Serva, S.
Right arrow Articles by Klimasauskas, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?