| Nucleic Acids Research | Pages |
Characterization of Schizosaccharomyces pombeRad2 protein, a FEN-1 homolog
Introduction
Materials And Methods
Strains and vectors
Enzymes and chemicals
Overexpression and purification of Rad2p
Oligonucleotides
Substrates
Nuclease analysis
Thrombin cleavage of GST-Rad2p
Results
Expression and purification of S.pombe Rad2p
GST-Rad2p processes DNA flap and pseudo-Y substrates
GST-Rad2p displays 5[prime]->3[prime] double-stranded DNA exonuclease activity
Thrombin cleavage
Discussion
Acknowledgements
References
Characterization of Schizosaccharomyces pombeRad2 protein, a FEN-1 homolog
ABSTRACT
INTRODUCTION
Nucleases are an important class of enzymes that function in many types of nucleic acid reactions, including DNA replication, recombination and repair. The FEN-1 nucleases (five prime exonuclease or flap endonuclease) comprise the first major family of nucleases to be identified. Following the cloning of murine FEN-1 (1), homologs have been identified in a number of different species (2-7). Many of these were initially purified as exonucleases required for replication (3,4,8,9). Interestingly, several polymerases, including Escherichia coli DNA polymerase I (pol I) and Taq DNA polymerase, have been shown to possess nuclease activities similar to the FEN-1 family (10,11).
FEN-1 homologs possess two distinct nuclease activities, an endonuclease activity that cleaves near the branch point of a 5[prime]-flap DNA structure (the exact location varying between species) and a 5[prime]->3[prime] double-stranded DNA exonuclease activity (1,7,11-13). The endonuclease also recognizes double flap DNA configurations that are proposed structures in DNA end joining reactions as well as pseudo-Y structures (1,7,13). The exonuclease activity hydrolyzes exposed 5[prime]-ends in gaps and nicks in duplex DNA as well as double-stranded blunt ends. A flap of the opposite polarity (3[prime]-flap), Holliday junctions, heterologous loops, DNA bubbles and hairpin structures are not recognized by this class of nucleases (reviewed in 14). In addition, proliferating cell nuclear antigen (PCNA) and replication protein A (RPA) have been identified as enhancers of the FEN-1 endonuclease activity (15,16).
It has been determined that FEN-1 protein is necessary for completion of lagging strand replication (3,4,8,9). The biochemical function involves removal of Okazaki fragments by hydrolyzing the single ribonucleotide left following RNase H processing (17). It is also likely that FEN-1 protein functions as an endonuclease, independent of RNase H, recognizing a 5[prime] displaced DNA strand created by primer extension (17). Genetic analysis of FEN-1 mutations has led to several proposals for multiple cellular functions. In addition to increased UV sensitivity, further analysis of the null mutant of the Saccharomyces cerevisiae homolog of FEN-1, rad27, demonstrated sensitivity to methylmethanesulfonate (MMS), increased plasmid loss, increased spontaneous mutation level, increased mitotic recombination and a temperature-sensitive phenotype for growth (18,19). Some of these characteristics are also properties of E.coli DNA pol I mutants (polAex1) (20).
A putative FEN-1 homolog, rad2+, has been identified in Schizosaccharomyces pombe (6). The rad2-44 mutant cell line is temperature sensitive for growth and demonstrates increased sensitivity to UV irradiation, deficient UV damage repair and increased chromosome loss and/or non-disjunction (6,21). These phenotypes are consistent with possible roles in DNA replication, chromosome segregation and DNA repair. Epistasis analysis indicates a possible role for Rad2p in an excision repair pathway of UV light-induced DNA photoproducts that is distinct from nucleotide excision repair and is initiated by a protein termed UV damage endonuclease (UVDE) (22). Although genetic analysis has provided some information on potential cellular functions, the biochemical properties of Rad2p have not been previously described. Here we describe the overexpression, purification and characterization of a GST-Rad2p fusion protein from S.pombe. Biochemical analysis shows that GST-Rad2p possesses both a 5[prime]-flap DNA endonuclease activity as well as a 5[prime]->3[prime] double-stranded DNA exonuclease activity. GST-Rad2p cleaves a 5[prime]-pseudo-Y structure, but cannot process a 3[prime]-flap or a 3[prime]-pseudo-Y substrate. Genetic and biochemical analyses of other FEN-1 homologs, including initial analysis of the rad2-44 mutant in S.pombe, clearly demonstrate that this family of proteins is not only important for the completion of replication, but is also likely to have an important role in DNA repair.
MATERIALS AND METHODS
Strains and vectors
The E.coli strains INV[alpha]F[prime] and TOP10 were used for subcloning and propagation of plasmids. Saccharomyces cerevisiae DY150 (MATa ura3-53 leu2-3 112 trp1-1 ade2-1 his3-11 can1-100) was used for overexpression of Rad2p. The TA vector (pCR2.1) was purchased from Invitrogen and the pYEX4T-1 expression vector/system was purchased from Clonetech.
Enzymes and chemicals
All restriction enzymes, T4 DNA ligase and terminal transferase were purchased from Promega. Taq DNA polymerase was purchased from Fisher and T4 polynucleotide kinase was purchased from New England Biolabs. Thrombin protease and glutathione-Sepharose chromatography resin were purchased from Pharmacia. Bio-Rad protein reagent and the Silver Stain Plus kit were purchased from Bio-Rad. Reduced glutathione and SDS-PAGE protein molecular weight markers were purchased from Sigma. [[alpha]-32P]ddATP (3000 Ci/mmol) and [[gamma]-32P]ATP (3000 Ci/mmol) were purchased from Amersham. All other chemicals were of the highest grade commercially available.
Overexpression and purification of Rad2p
rad2+ was amplified by PCR from the [lambda]yes S.pombe cDNA library (ATCC) using the 5[prime] sense primer d(pGGGGATCCATGGGAATTAAAGGTT) and the 3[prime] antisense primer d(pGGGATCCTCAACGCTTTTTCTTGCT). The product was inserted into the pCR2.1 TA cloning vector. The rad2+ fragment was excised from the pCR2.1 vector and subcloned into the BamHI site of the pYEX4T-1 expression vector. The orientation of the insert was confirmed by cleavage with EcoRI. The rad2+ coding region was confirmed by sequence analysis and was identical to the previously reported sequence (6). The coding region was expressed with a GST leader sequence from the CUP1 promoter (23). Plasmids were transformed into S.cerevisiae DY150 and grown at 30°C on minimal medium plus adenine, histidine and tryptophan (YNB growth medium). In addition, uncut pYEX4T-1 was transformed as a control for protein induction, purification and activity analysis. Positive transformants were grown in YNB growth medium to mid log phase, resuspended in fresh medium and protein expression induced by addition of CuSO4 to a final concentration of 0.5 mM. Cells were harvested after 3 h, washed and resuspended in buffer A (50 mM Tris-HCl, pH 7.6, 10 mM [beta]-mercaptoethanol, 50 mM NaCl, 200 mM EDTA, 10% glycerol and protease inhibitors). Equal volumes of glass beads were added and cells were lysed by eight 1 min vortex bursts with 5 min on ice between bursts. Cell lysates were centrifuged at 40 000 g and soluble protein was dialyzed overnight in buffer B (buffer A minus EDTA). Dialyzed lysates were centrifuged again and dialyzed overnight in buffer C (50 mM Tris-HCl, pH 7.6, 10 mM MgCl2, 1 mM MnCl2, 10 mM [beta]-mercaptoethanol and 10% glycerol). Protein concentrations were determined by the Bradford assay using BSA as the standard (24). Crude lysates (150 mg) from GST-Rad2p overexpressing cells and vector-alone lysates were loaded onto a 2 ml glutathione-Sepharose column overnight at 0.1 ml/min. Columns were washed with 15 column volumes of 1× phosphate-buffered saline (PBS), 0.5 mM EDTA and 0.15 mM phenylmethylsulfonyl fluoride (PMSF) (25). Proteins were eluted with 50 mM Tris-HCl, pH 7.6, 10 mM glutathione, 25 mM NaCl, 10 mM [beta]-mercaptoethanol and 10% glycerol. Equal volumes of column fractions (1 µl) were analyzed for protein content on 10% SDS-polyacrylamide gels (26).
Oligonucleotides
The following oligodeoxynucleotides were used in the construction of Rad2p substrates (Fig.
Figure 1. Potential DNA substrates for Rad2p. All substrates were prepared as described in Materials and Methods. The asterisk indicates the position of the 32P label. Oligonucleotides that are labeled are underlined. Oligonucleotides were electrophoresed on a denaturing 20% polyacrylamide gel, visualized by UV shadowing, eluted from the gel in TE buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA) and ethanol precipitated. Oligos B and F were 3[prime]-end-labeled using terminal transferase and [[alpha]-32P]ddATP (27). Oligos B and D were 5[prime]-end-labeled using T4 polynucleotide kinase and [[gamma]-32P]ATP (28). End-labeled oligonucleotides were annealed to the respective complementary strands in TE buffer plus 50 mM MgCl2 by heating to 70°C followed by slowly cooling to room temperature. Duplex DNA species were purified on a 20% non-denaturing polyacrylamide gel, purified as described above, resuspended in TE buffer and stored at -20°C. Oligos A, B and C were annealed to create the 5[prime]-flap structure. Oligos A and B were annealed to create the 5[prime]-pseudo-Y structure. Oligos A, D and E were annealed to create the 3[prime]-flap. Oligos A and D were annealed to create the 3[prime]-pseudo-Y structure. Oligos F and G were annealed for the double-stranded template and oligo F was used as the single-stranded template. Endonuclease activity reactions were performed as follows. Protein (10 µg) was added to a reaction mixture containing 20 mM HEPES, pH 7.6, 10 mM MgCl2, 1 mM MnCl2, 1 mM [beta]-mercaptoethanol and 0.5 pmol end-labeled DNA substrate (100 µl final volume) and incubated for 30 min at 37°C. Reaction mixtures were extracted with phenol/chloroform/isoamyl alcohol (25:24:1) and the DNA precipitated by ethanol precipitation. Labeled samples (5000-10 000 c.p.m.) were loaded onto a 20% denaturing polyacrylamide gel and DNA strand scission products were visualized by autoradiography. In addition, Maxam-Gilbert base-specific chemical cleavage reaction products were run on the gel as nucleotide position markers (29). Exonuclease activity assays were carried out under similar conditions using 1.0 pmol end-labeled DNA substrate (120 min incubation time). The GST-Rad2p fusion protein (12 µg) was incubated for 24, 48 or 72 h at 4°C with 1-2 U thrombin (25). Samples were analyzed by SDS-PAGE (2 µg) and also tested for activity (10 µg) on the 3[prime]-end-labeled 5[prime]-flap substrate.
Substrates
Nuclease analysis
Thrombin cleavage of GST-Rad2p
RESULTS
Expression and purification of S.pombe Rad2p
The rad2+ coding region was amplified by PCR, cloned into the pYEX4T-1 expression vector and transformed into S.cerevisiae DY150 for protein induction. Extracts prepared from cells induced for 3 h with CuSO4 were shown to contain a 69.5 kDa band as determined by SDS-PAGE. The GST-Rad2p fusion protein was purified to near homogeneity as shown by SDS-PAGE analysis of column fractions obtained by glutathione-Sepharose affinity chromatography (Fig. 2). The same procedure was carried out using an expression vector that contained only the GST protein, as a control for induction, purification, activity analysis and as a gauge for potential contaminating nucleases (data not shown).
GST-Rad2p processes DNA flap and pseudo-Y substrates
FEN-1 proteins cleave DNA near the branch site of a 5[prime]-flap overhang substrate by endonuclease activity. In order to determine if GST-Rad2p possessed such an endonuclease activity, a substrate was constructed which was similar to that used by Harrington et al. (1), containing a 5[prime]-end-labeled flap strand. Aliquots of glutathione-Sepharose fraction 2 (Fig.
Figure 2. Purification of GST-Rad2p fusion protein. Crude lysate (150 mg) from cells overexpressing GST-Rad2p was loaded onto a 2 ml glutathione-Sepharose column. The column was washed and eluted as described in Materials and Methods. Aliquots from the crude, flow-through, washes and elution fractions were loaded onto a 10% SDS-polyacrylamide gel. Proteins were visualized by silver staining. Lane 1, Bio-Rad high range molecular weight protein markers; lane 2, crude lysate (1 µg); lane 3, column flow-through (1 µg); lanes 4 and 5, column washes; lanes 6-15, glutathione elution fractions (1 µl). The arrow indicates GST-Rad2p fusion protein. Numbers on the left indicate the size of molecular weight standards (kDa). Figure 3. Activity analysis of GST-Rad2p fusion protein. (A) Flap endonuclease activity. 5[prime]-End-labeled DNA substrates (0.5 pmol) were incubated with 10 µg GST alone, GST-Rad2p or no protein for 30 min at 37°C. Maxam-Gilbert base-specific chemical cleavage reaction products of the labeled DNA strand are indicated. 5[prime]-Flap substrate treated with: lane 1, no protein; lane 2, GST alone; lane 3, GST-Rad2p. 5[prime]-Pseudo-Y substrate treated with: lane 4, no protein; lane 5, GST-Rad2p; lane 6, GST alone. The sequence of the labeled strand is indicated on the left. The horizontal arrows on the right and left indicate the cleavage product and the nucleotide position of cleavage that corresponds to one base 3[prime] of the branch point in the duplex region (at the G-G site). The DNA cleavage product is the result of cleavage at the G-G site indicated by the vertical arrows in the substrate structures shown above the gel. (B) Duplex DNA exonuclease activity. 3[prime]-End-labeled double-stranded DNA (1.0 pmol) was incubated for 2 h at 37°C with either: lane 1, no protein; lane 2, GST alone; lane 3, GST-Rad2p. DNA strand scission products were separated on a 20% denaturing polyacrylamide gel and visualized by autoradiography as described in Materials and Methods. The end-labeled double-stranded DNA substrate (30mer) was incubated with GST-Rad2p and GST alone. Figure In order to determine if the N-terminal tag was interfering with flap endonuclease cleavage, the GST tag was removed by thrombin cleavage. SDS-PAGE analysis (Fig. Figure 4. Thrombin cleavage of GST-Rad2p. (A) SDS-PAGE analysis of GST-Rad2p cleavage by thrombin protease. GST-Rad2p (12 µg) was incubated with 1-2 U thrombin at 4°C for specified time periods. Aliquots of 2.0 µg from each reaction were loaded onto a 10% SDS-polyacrylamide gel and visualized by Coomassie blue staining. Lane 1, Bio-Rad low range molecular weight PAGE standards; lane 2, untreated GST-Rad2p; lanes 3-5, GST-Rad2p treated for 24 h with 0, 1 or 2 U thrombin; lanes 6-8, GST-Rad2p treated for 48 h with 0, 1 or 2 U thrombin; lanes 9-11, GST-Rad2p treated for 72 h with 0, 1 or 2 U thrombin. Arrows on the right indicate cleavage products; the top and bottom bands represent Rad2p and the GST tag respectively. The numbers on the left indicate the size of the molecular weight standards (kDa). (B) Activity analysis of thrombin-cleaved Rad2p. An aliquot of 10 µg of the cleavage reactions shown in (A) was incubated with 0.5 pmol 5[prime]-flap substrate (3[prime]-end-labeled) for 30 min at 37°C. DNA strand scission products were analyzed as described in Figure 2A. Lane 1, untreated GST-Rad2p; lanes 2-4, treated GST-Rad2p (24 h); lanes 5-7, treated GST-Rad2p (48 h); lanes 8-10, treated GST-Rad2p (72 h). The sequence of the labeled strand is indicated on the right. Horizontal arrows on the left and right indicate the major cleavage product resulting from incision at the G-G site. The major cleavage site is also indicated in the substrate structure at the top of the gel. This report provides an initial biochemical analysis of S.pombe Rad2p. The DNA cleavage patterns observed for GST-Rad2p are similar to the FEN-1 family of nucleases that are important for completion of lagging strand DNA replication (3,4,8,9). Genetic evidence has shown that mutations in the rad2 gene render a cell sensitive to UV irradiation and cells show an increased level of minichromosome loss (6). There has been no previous report, however, of the biochemical function of Rad2p. GST-Rad2p possesses the flap endonuclease activity of FEN-1 proteins. Figure In addition to the requirement for lagging strand DNA replication, there is a growing body of evidence that FEN-1 proteins are important in maintaining genomic integrity. Null mutations of the S.cerevisiae rad27 gene demonstrate an increase in microsatellite instability (30-33). It is possible that this phenotype is a result of secondary structure formation during replication. There is also evidence for a role of Rad2p in excision repair of UV photoproducts. A repair pathway, distinct from classic nucleotide excision repair, has been identified in S.pombe (21,34). The identification of an endonuclease (UVDE) that cleaves directly 5[prime] of the sites of UV photoproducts provides evidence that this `alternative' repair was through an excision repair pathway (35). Epistasis analysis with UVDE mutants and a rad2 deletion strain indicates that these proteins may be acting in the same repair pathway (22,36). Other proteins that may also be involved include rad18 and rhp51 (37). It is interesting to consider that the nuclease activity of Rad2p may be responsible for the excision of UV damage following cleavage by UVDE. Based on the available genetic and biochemical evidence involving the putative members of this repair pathway, several models have been proposed (Fig. Figure 5. Model for Rad2p in excision repair of UV light-induced DNA photoproducts. Excision repair is initiated by cleavage 5[prime] of a UV photoproduct (e.g. cyclobutane pyrimidine dimer) by UVDE. The product can subsequently be processed in at least two ways. Rad2p could remove the damage through exonuclease activity. This would leave a gap that could be filled-in by polymerase and sealed by ligase (pathway 1). Alternatively, the free end upstream of the dimer could undergo chain elongation by DNA polymerase, leaving a displaced flap structure. Rad2p could subsequently cleave the flap structure through endonuclease activity, leaving a nick to be sealed by ligase (pathway 2). The pathways depicted here show the minimum biochemical steps to achieve repair and do not show other accessory proteins (e.g. PCNA, RF-C, etc.) which may also be involved. We would like to thank Julie M.Villanueva and Rebecca L.Swanson for critically reading this manuscript and members of the Doetsch laboratory for technical assistance and helpful discussions. This work was supported by Research Grant CA73041 from the National Cancer Institute. J.L.A. was supported by the NIH Predoctoral Training Program in Genetics (grant 5T32 GMO08490-05).
GST-Rad2p displays 5[prime]->3[prime] double-stranded DNA exonuclease activity
Thrombin cleavage
DISCUSSION
ACKNOWLEDGEMENTS
REFERENCES
This article has been cited by other articles:
This page is run by Oxford University Press, Great Clarendon Street, Oxford OX2 6DP, as part of the OUP Journals
Comments and feedback: www-admin{at}oup.co.uk
Last modification: 30 Jul 1998
Copyright©Oxford University Press, 1998.
CiteULike 
Connotea 
Del.icio.us What's this?
G. Ishikawa, Y. Kanai, K.-i. Takata, R. Takeuchi, K. Shimanouchi, T. Ruike, T. Furukawa, S. Kimura, and K. Sakaguchi
DmGEN, a novel RAD2 family endo-exonuclease from Drosophila melanogaster
Nucleic Acids Res.,
December 1, 2004;
32(21):
6251 - 6259.
[Abstract]
[Full Text]
[PDF]
K. Tomita, T. Kibe, H.-Y. Kang, Y.-S. Seo, M. Uritani, T. Ushimaru, and M. Ueno
Fission Yeast Dna2 Is Required for Generation of the Telomeric Single-Strand Overhang
Mol. Cell. Biol.,
November 1, 2004;
24(21):
9557 - 9567.
[Abstract]
[Full Text]
[PDF]
N. M. Hollingsworth and S. J. Brill
The Mus81 solution to resolution: generating meiotic crossovers without Holliday junctions
Genes & Dev.,
January 15, 2004;
18(2):
117 - 125.
[Full Text]
[PDF]
J. L. Alleva and P. W. Doetsch
The nature of the 5'-terminus is a major determinant for DNA processing by Schizosaccharomyces pombe Rad2p, a FEN-1 family nuclease
Nucleic Acids Res.,
August 1, 2000;
28(15):
2893 - 2901.
[Abstract]
[Full Text]
[PDF]
J. Qiu, Y. Qian, P. Frank, U. Wintersberger, and B. Shen
Saccharomyces cerevisiae RNase H(35) Functions in RNA Primer Removal during Lagging-Strand DNA Synthesis, Most Efficiently in Cooperation with Rad27 Nuclease
Mol. Cell. Biol.,
December 1, 1999;
19(12):
8361 - 8371.
[Abstract]
[Full Text]
[PDF]
B. Kaur, J. L. A. Fraser, G. A. Freyer, S. Davey, and P. W. Doetsch
A Uve1p-Mediated Mismatch Repair Pathway in Schizosaccharomyces pombe
Mol. Cell. Biol.,
July 1, 1999;
19(7):
4703 - 4710.
[Abstract]
[Full Text]
[PDF]
L. A. Henricksen, S. Tom, Y. Liu, and R. A. Bambara
Inhibition of Flap Endonuclease 1 by Flap Secondary Structure and Relevance to Repeat Sequence Expansion
J. Biol. Chem.,
May 26, 2000;
275(22):
16420 - 16427.
[Abstract]
[Full Text]
[PDF]
This Article 
Abstract
Print PDF (181K)
Alert me when this article is cited
Alert me if a correction is posted
Services
Email this article to a friend
Similar articles in this journal
Similar articles in ISI Web of Science
Similar articles in PubMed
Alert me to new issues of the journal
Add to My Personal Archive
Download to citation manager
Search for citing articles in:
ISI Web of Science (23)
Request Permissions
Commercial Re-use Guidelines
for Open Access NAR Content
Google Scholar
Articles by Alleva, J. L.
Articles by Doetsch, P. W.
Search for Related Content
PubMed
PubMed Citation
Articles by Alleva, J. L.
Articles by Doetsch, P. W.
Social Bookmarking
What's this?